Search Results

Search found 16894 results on 676 pages for 'block device'.

Page 532/676 | < Previous Page | 528 529 530 531 532 533 534 535 536 537 538 539  | Next Page >

  • iSCSI, failover and XenServer

    - by jemmille
    I have an iSCSI fail over implementation setup so if one of my storage units fails the other takes over immediately (it also runs the NFS shares). When fail over occurs, volumes are exported, the IP is switched to the other machine and the targets are reconfigured. The fail over of the storage system itself works just fine. I use NexentaStor for my filer. When I do a test (manual) fail over of my storage the following occurs: Note: I run the admin VM's on NFS and customer based VM's on iSCSI All NFS based VM's remain up and working perfectly through the failover and after All VM 's running on iSCSI eventually report the following: An error about not being able to write to a particular block An error about journaling not working Then the file system goes RO To get the VM's working again I have to do the following: Force shutdown of the "broken" VM's. Detach the iSCSI SR Re-attach the iSCSI SR Boot the VM on a different server (5 in my pool) If I don't boot on a different server I get this error "Internal error: Failure("The VDI <uuid&gt; is already attached in RW mode; it can't be attached in RO mode!")" The only way I have found to fix that error is to reboot the entire server it was running on previously which is obviously a huge pain. Currently multipathing is NOT enabled (but can be and the same thing still occurs). I have edited much of the /etc/iscsid.conf file to work with the timeout settings but to no avail. In short, my storage fails over properly but XenServer does not keep the connection alive. As a thought, the error that shows up in #4 above might be the ultimate cause and fixing that would fix everything? Any help would be appreciated more than you know.

    Read the article

  • Sticky connection and HTTPS support for HAProxy

    - by Saif
    We have 2 HTTP Load balancer with HAproxy and heartbeat. There are 4 apache nodes in this cluster. It's doing round robin load balancing. The HTTP cluster working fine. We are having problem with our portal because it uses SSO. We need sticky connection support in our HAproxy. Also we need load balancing for HTTPS traffic. Here's our HAproxy conf file. global # to have these messages end up in /var/log/haproxy.log you will # need to: # # 1) configure syslog to accept network log events. This is done # by adding the '-r' option to the SYSLOGD_OPTIONS in # /etc/sysconfig/syslog # # 2) configure local2 events to go to the /var/log/haproxy.log # file. A line like the following can be added to # /etc/sysconfig/syslog # # local2.* /var/log/haproxy.log # log 127.0.0.1 local0 log 127.0.0.1 local1 notice chroot /var/lib/haproxy pidfile /var/run/haproxy.pid maxconn 4000 user haproxy group haproxy daemon # turn on stats unix socket stats socket /var/lib/haproxy/stats #--------------------------------------------------------------------- # common defaults that all the 'listen' and 'backend' sections will # use if not designated in their block #--------------------------------------------------------------------- defaults mode http log global option httplog option dontlognull option http-server-close option forwardfor except 127.0.0.0/8 option redispatch retries 3 timeout http-request 10s timeout queue 1m timeout connect 10s timeout client 1m timeout server 1m timeout http-keep-alive 10s timeout check 10s maxconn 3000 #--------------------------------------------------------------------- # main frontend which proxys to the backends #--------------------------------------------------------------------- frontend main *:5000 acl url_static path_beg -i /static /images /javascript /stylesheets acl url_static path_end -i .jpg .gif .png .css .js use_backend static if url_static default_backend app #--------------------------------------------------------------------- # static backend for serving up images, stylesheets and such #--------------------------------------------------------------------- backend static balance roundrobin server static 127.0.0.1:4331 check #--------------------------------------------------------------------- # round robin balancing between the various backends #--------------------------------------------------------------------- backend app listen ha-http 10.190.1.28:80 mode http stats enable stats auth admin:xxxxxx balance roundrobin cookie JSESSIONID prefix option httpclose option forwardfor option httpchk HEAD /haproxy.txt HTTP/1.0 server apache1 portal-04:80 cookie A check server apache2 im-01:80 cookie B check server apache3 im-02:80 cookie B check server apache4 im-03:80 cookie B check Please advice. Thanks for your help in advance.

    Read the article

  • Unable to boot with Windows 2008 DVD / USB Key

    - by r0ca
    Hi everyone, I am trying to install Windows 2008 server on a HP Proliant DL180 G5. There is no built-in DVD reader so I need to use my LaCie USB one. When I put the CD in and boot from the USB DVD on the server, I get the error message: Boot Failed! Please insert boot media in selected boot device. So I tried with another Windows bootable CD and still no luck. What I've done then, I copied the installation DVD on my 16go USB key. Again, impossible to boot from the USB Key. I have 2 147go SAS 15k HDD on my server. They are not showing in the Bios. I was wondering if this is a reason why nothing will boot on it. I am trying to find a way to deploy Windows 2008 server on my HP server as soon as possible. If you guys have ideas, feel free to let me know :) Best regards, David. System Information: HP Proliant DL180 G5 Quad-Core 2.5 4GO Ram 2x 147GO SAS 15k P.S. This is my first installation ever on SAS/SCSI HDD. Thanks a bunch! Edit: Well, my bad! I purchased a new USB DVD and now I can install Windows 2008 server. Thanks a bunch for your help!

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Identifying mail account used in CRAM-MD5 transaction

    - by ManiacZX
    I suppose this is one of those where the tool for identifying the problem is also the tool used for taking advantage of it. I have a mail server that I am seeing emails that spam is being sent through it. It is not an open relay, the messages in question are being sent by someone authenticating to the smtp with CRAM-MD5. However, the logs only capture the actual data passed, which has been hashed so I cannot see what user account is being used. My suspicion is a simple username/password combo or a user account's password has otherwise been compromised, but I cannot do much about it without knowing what user it is. Of course I can block the IP that is doing it, but that doesn't fix the real problem. I have both the CRAM-MD5 Base64 challenge string and the hashed client auth string containing the username, password and challenge string. I am looking for a way to either reverse this (which I haven't been able to find any information on) or otherwise I suppose I need a dictionary attack tool designed for CRAM-MD5 to run through two lists, one for username and one for password and the constant of the challenge string until it finds a matching result of the authentication string I have logged. Any information on reversing using the data I have logged, a tool to identify it or any alternative methods you have used for this situation would be greatly appreciated.

    Read the article

  • How to multiseat with HW 3d accel on CentOS 6.3 Final?

    - by user35070
    I would like to setup a multiseat configuration on CentOS 6.3 (two video cards, two keyboards, two mice, two monitors) and have hardware accelerated 3D on both monitors. 3D HW acceleration rules out Xephyr. I saw somewhere that recent versions of GDM (3.3 and newer?) don't support multiseat, so do I have to install KDM to make this work? If I just create a duplicate section with new device identifiers in my xorg.conf file, will this 'just work'? Using different ports on the same video card and separate keyboards, mice, and displays, the result was a desktop which spanned both monitors with both keyboards and mice acting as the same input in the GUI. I will power down and put in the new video card and report on the results soon. Both video cards are nvidia. UPDATE after putting in another NVIDIA video card, default behavior (before changing xorg.conf) is that one screen works normally, and both mice and keyboards are connected to it. Changing xorg.conf and the display manager to KDM and following the directions here https://help.ubuntu.com/community/MultiseatX#Ubuntu_10.04_.28Lucid.29 , I have 2 mirrored screens connected to separate video cards, DRI enabled, and 2 mice both connected to the same pointer. Keyboards don't do anything, however, I probably just need to fix a setting in xorg.conf I would still like to get multiseat functionality, eg. separate screens with separate input devices I have verified that the separate X processes are running (see page above) using 'ps aux | grepX [01]'

    Read the article

  • Can I attach a VPN firewall to an existing network and have it manage VPN connections?

    - by jules
    I'm quite new to networking and am trying to set up my first VPN connection. The Situation: I have been contracted for some programming at a facility some distance from my location. I would like to be able to set up a simple VPN connection to their network so that I may make adjustments without significant travel. Their Current Network: Six devices (one I need to connect to) plugged into a basic router (Dlink). This router has an internet connection and a static ip address. My Hopeful (questionable) Proposal: I attach a VPN Firewall I happen to own (Netgear FVS318) as device number seven on the client network. I disable routing / DHCP in the Netgear. I forward the appropriate IPSec ports from the Dlink to the Netgear. I then create a VPN connection on my office Windows 7 machine to the remote network. The request is forwarded from the Dlink to the Netgear where the VPN connection is authenticated. I now have a remote-access connection from my office PC to the client's local network. The Question: Will this proposal work? If not, would another possibility be to attach a computer with a VPN server to the client network? Also, as a note: the client has requested I not replace their router or place mine in-between theirs and the internet :( Thanks very much!

    Read the article

  • Backing up VMs to a tape drive

    - by Aljoscha Vollmerhaus
    I've got myself one of these fancy tape drives, HP LTO2 with 200/400 GB cartridges. The st driver reports it like this: scsi 1:0:0:0: Sequential-Access HP Ultrium 2-SCSI T65D I can store and retrieve files like a charm using tar, both tar cf /dev/st0 somedirectory and tar xf /dev/st0 work flawless. However, what I really would like to backup are LVM LVs. They contain entire virtual machines with varying partition layouts, so using mount and tar is not an option. I've tried using something like dd if=/dev/VG/LV bs=64k of=/dev/st0 to achieve this, but there seem to be various problems associated with this approach. Firstly, I would like to be able to store more than 1 LV on a single tape. Now I guess I could seek to concatenate the data on the tape, but I think this would not work very well in an automated scenario with many different LVs of various sizes. Secondly, I would like to store a small XML file along with the raw data that contains some information about the VM contained in the LV. I could dump everything to a directory and tar it up - not very desirable, I would have to set aside huge amounts of scratch space. Is there an easier way to achieve this? Thirdly, from googling around it seems like it would be wise to use something like mbuffer when writing to the tape, to prevent what wikipedia calls "shoe-shining" the tape. However, I can't get anything useful done with mbuffer. The mbuffer man page suggests this for writing to a tape device: mbuffer -t -m 10M -p 80 -f -o $TAPE So I've tried this: dd if=/dev/VG/LV | mbuffer -t -m 10M -p 80 -f -d 64k -o /dev/st0 Note the added "-d 64k" to account for the 64k block size of the tape. However, reading data back from a tape written in this way never seems to yield any useful results - dd has been running for ages now, and managed to transfer only 361M of data from the tape. What's wrong here?

    Read the article

  • Can I have a single solid state drive and a RAID array on the same machine?

    - by jaminto
    Hi- To summarize, i'm looking to use a single solid state drive as my primary drive, and two conventional sata drives in a RAID 1 configuration for data. I am trying to install 64-bit Windows 7 onto this configuration. Is this possible? Here are the details: I built a desktop that has been running 64-bit Vista on two 500Gb in a RAID 1 array for a few years. I just purchased an Intel X25-M 80Gb Sata Solid-State Drive, and was planning on using this a my primary drive, and keeping the RAID 1 array as my data drive. I added the SSD drive and in the RAID setup, configured it as a RAID 0 array of only one disk. Then, I tried to do a clean install of windows 7 64-bit, but got stuck in the "Missing driver for CD/DVD drive" black hole of selecting driver files and Windows telling me that i don't have the appropriate driver for my hardware. The missing hardware is NOT a CD/DVD drive, since i'm installing off of my only CD/DVD drive. Plus at one point i was able to point it at a driver for my raid controller, and then my hard drives magically showed up as browsable sources for finding drivers for some other unnamed device that setup couldn't recognize. After a few hours of trying drivers (this was a very slow process) i decided to reboot and look at the BIOS settings. I'm using an ASUS M2A-VM motherboard which has an ATI SB600 RAID controller on board. I switched the "On board SATA Type" setting from "SATA" to "AHCI" thinking that since AHCI is an Intel thing, this would help. Unfortunately, this abandoned my RAID configuration, and my previously mirrored drives are showing up as separate drives when i boot into my current windows installation. Am i trying to do the impossible here? Should i just buy a separate SATA/RAID PCI card and plug the SSD into that? Any help would be greatly appreciated.

    Read the article

  • client flips between internal and external IP addresses??

    - by jmiller-miramontes
    I have what seems like a not-particularly-complicated home network, all things considered: a DSL line comes in to a modem/router, which goes off to a switch, which supports a bunch of machines. My machines live in a 192.168.0.x address space; however, I'm running some public servers on the network, so I have a block of 8 (5, really) static IP addresses that are mapped to the servers by the router. The non-servers get 192.168.0.x addresses via NAT; some machines have static addresses and some get addresses from DHCP. Locally, I'm running a DNS server (named) to map between the domain names and the 192.168 address space. Somewhat messy, but everything basically works. Except: One of my local non-server clients occasionally switches from its internal address to its external address. That is, if I check the logs of a website I'm running internally, the hits coming from this client sometimes show up with the internal 192.168 address, and sometimes with the external (216.103...) address. It will flip back and forth for no apparent reason, without my doing anything. This can be a problem in terms of how the clients interact with the way I have some of the clients' SSH systems configured (e.g., allowing access from the internal network but not the external network), but it also Just Seems Wrong. I will confess that I'm kinda skating on the very edge of my networking competence here, but I can't for the life of me figure out what's going on. If it helps, the client in question is running Mac OS X / 10.6; its address is statically assigned, is not one of the five externally-accessible addresses, and gets its DNS from (first) the internal DNS server and (second) my ISP's DNS servers. I can't swear that none of the other NAT clients are also showing this problem; the one I'm dealing with is my everyday machine, so this is where I run into it. Does anybody out there have any advice? This is driving me crazy...

    Read the article

  • Convert HTACCESS mod_rewrite directives to nginx format?

    - by Chris
    I'm brand new to nginx and I am trying to convert the app I wrote over from Apache as I need the ability to serve a lot of clients at once without a lot of overhead! I'm getting the hang of setting up nginx and FastCGI PHP but I can't wrap my head around nginx's rewrite format just yet. I know you have to write some simple script that goes in the server {} block in the nginx config but I'm not yet familiar with the syntax. Could anyone with experience with both Apache and nginx help me convert this to nginx format? Thanks! # ------------------------------------------------------ # # Rewrite from canonical domain (remove www.) # # ------------------------------------------------------ # RewriteCond %{HTTP_HOST} ^www.domain.com RewriteRule (.*) http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # This redirects index.php to / # # ------------------------------------------------------ # RewriteCond %{THE_REQUEST} ^[A-Z]+\ /(index|index\.php)\ HTTP/ RewriteRule ^(index|index\.php)$ http://domain.com/ [R=301,L] # ------------------------------------------------------ # # This rewrites 'directories' to their PHP files, # # fixes trailing-slash issues, and redirects .php # # to 'directory' to avoid duplicate content. # # ------------------------------------------------------ # RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)$ $1.php [L] RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)/$ http://domain.com/$1 [R=301,L] RewriteCond %{THE_REQUEST} ^[A-Z]+\ /[^.]+\.php\ HTTP/ RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^([^.]+)\.php$ http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # If it wasn't redirected previously and is not # # a file on the server, rewrite to image generation # # ------------------------------------------------------ # RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^([a-z0-9_\-@#\ "'\+]+)/?([a-z0-9_\-]+)?(\.png|/)?$ generation/image.php?user=${escapemap:$1}&template=${escapemap:$2} [NC,L]

    Read the article

  • No Outbound Internet on Windows Home Server

    - by Kyle B.
    Could someone provide some steps for me to check my internet connection on my Windows Home Server? It seems to have intermittent connectivity issues and I am unsure of how to diagnose the problem because it is a headless (no monitor, no keyboard) machine so the only way to get to the device is via remote desktop (which works fine). When connected to the machine, it doesn't pull up any microsoft.com sites and some other sites it does pull up (i.e. gmail.com) and some it doesn't (stackoverflow.com). To make matters more complicated, it has worked intermittently in the past for reasons unknown. Are there tools I can use to properly diagnose the reason for the connection failure? I can ping 127.0.0.1 just fine, I have internet working on my other router-connected machines, so I'm not sure why this one would fail. Any suggestions would be much appreciated and up-voted :) ** edit - thanks for suggestions guys, I'm going to try these tonight and will update my post. ** edit #2 - I hoping this is a more permanant fix, but I have both changed my port on the router as well as restarted the router at the same time. The internet (for the moment) appears to be working. I will be sure to try everything we have discussed should this problem persist. Thanks, Kyle

    Read the article

  • How can I stream audio signals from various devices/computers to my home server?

    - by Breakthrough
    I currently have a headless home server set up (running Ubuntu 12.04 server edition) running a simple Apache HTTP server. The server is near an audio receiver, which controls a set of indoor and outdoor speakers in my home. Recently, my father purchased a Bluetooth adapter, which our various laptops and cellphones can connect to, outputting the music to the speakers. I was hoping to find a solution that worked over Wi-Fi, namely because it won't cost anything (I already have a server with an audio card), and it doesn't depend on Bluetooth. Is there any cross-platform (preferably free and open-source) solution that I can use which will allow me to stream audio to my home server, over my home network, from a wide variety of devices (laptops running Windows/Linux or cellphones running Android/BB/iOS)? I need something that works at least with Windows and Android. Also, just to clairfy, I want something that simply allows devices to connect to my server and output an audio signal without any action on the server end (since it's a server hidden away near my receiver). Any subsequent connection attempt should be dropped, so only one device can be in control of the stereo at once.

    Read the article

  • iOS 6 in-app email does not send from within any app that supports it

    - by Joe Termine
    A strange problem -- Last night I upgraded to the final release of iOS 6 on my iPhone 4S and my iPad 2. When I open an app that allows you to send emails from within the app (e.g. adobe Reader, TurboScan, etc.) -- doesn't matter which one -- I am prompted with the email dialog from within the app, I can compose the message, but when I go to send one of two things will happen: either the email sending sound will "swoosh" and the dialog will close (leading me to think it worked) or some apps with good error handling will say there is an "error sending email." The error logs on my device are not reporting errors. It's just that the email doesn't really send. I have two Exchange mail boxes on these devices. One connects to a corporate network hosting on-premise exchange 2007 and the other connects to Gmail over the exchange interface. Have attempted to delete and re-pair these accounts (one at a time) without any change. I'm wondering if others are experiencing this problem, or whether I should just wipe the devices and chalk it up to (another) failed upgrade. Thoughts much appreciated. Joe

    Read the article

  • Cannot access SMC8014WG-SI provided by TimeWarner/RoadRunner administrative interface...

    - by Matt Rogish
    I just received installation of RoadRunner internet/TV/Voice and I was given a wi-fi router from the TimeWarner folks. The model is a SMC SMC8014WG-SI. Unfortunately, the password it uses is WEP and that is, as we all know, completely insecure. The tech that was here didn't know how to change it to something like WPA2 w/TKIP, and I was on hold for 20 minutes with the TimeWarner folks before I gave up. My problem is that the default web interface (http://192.168.0.1) isn't responding. I can ping it, I can access the internet through it, but I can't get to the admin interface. I did a "hard reset" of the device but still no dice. My suspicion is that the wi-fi admin interface is disabled (a common setting) but the wired interface isn't working on either of my two laptops (I've tried two laptops with two different cables, no link light activated). Am I SOL? Did they lock this down so I can't do what I want to do? Worst-case is I just hook up my go-to WRT54G router to the other modem and leave this one turned off, but I'd rather use their hardware to avoid any "It's not our problem" in the future. Any thoughts? Thanks!!

    Read the article

  • Chef: nested data bag data to template file returns "can't convert String into Integer"

    - by Dalho Park
    I'm creating simple test recipe with a template and data bag. What I'm trying to do is creating a config file from data bag that has simple nested information, but I receive error "can't convert String into Integer" Here are my setting file 1) recipe/default.rb data1 = data_bag_item( 'mytest', 'qa' )['test'] data2 = data_bag_item( 'mytest', 'qa' ) template "/opt/env/test.cfg" do source "test.erb" action :create_if_missing mode 0664 owner "root" group "root" variables({ :pepe1 = data1['part.name'], :pepe2 = data2['transport.tcp.ip2'] }) end 2)my data bag named "mytest" $knife data bag show mytest qa id: qa test: part.name: L12 transport.tcp.ip: 111.111.111.111 transport.tcp.port: 9199 transport.tcp.ip2: 222.222.222.222 3)template file test.erb part.name=<%= @pepe1 % transport.tcp.binding=<%= @pepe2 % Error reurns when I run chef-client on my server, [2013-06-24T19:50:38+00:00] DEBUG: filtered backtrace of compile error: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in []',/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:inblock in from_file',/var/chef/cache/cookbooks/config_test/recipes/default.rb:12:in from_file' [2013-06-24T19:50:38+00:00] DEBUG: filtered backtrace of compile error: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in[]',/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in block in from_file',/var/chef/cache/cookbooks/config_test/recipes/default.rb:12:infrom_file' [2013-06-24T19:50:38+00:00] DEBUG: backtrace entry for compile error: '/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in `[]'' [2013-06-24T19:50:38+00:00] DEBUG: Line number of compile error: '19' Recipe Compile Error in /var/chef/cache/cookbooks/config_test/recipes/default.rb TypeError can't convert String into Integer Cookbook Trace: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in []' /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:inblock in from_file' /var/chef/cache/cookbooks/config_test/recipes/default.rb:12:in `from_file' Relevant File Content: /var/chef/cache/cookbooks/config_test/recipes/default.rb: 12: template "/opt/env/test.cfg" do 13: source "test.erb" 14: action :create_if_missing 15: mode 0664 16: owner "root" 17: group "root" 18: variables({ 19 :pepe1 = data1['part.name'], 20: :pepe2 = data2['transport.tcp.ip2'] 21: }) 22: end 23: I tried many things and if I comment out "pepe1 = data1['part.name'],", then :pepe2 = data2['transport.tcp.ip2'] works fine. only nested data "part.name" cannot be set to @pepe1. Does anyone knows why I receive the errors? thanks,

    Read the article

  • Black screen appears when booting new install of Ubuntu 11.10 on my desktop, cannot access Grub menu to fix

    - by izn
    I installed 11.10 on my desktop PC but get a black screen after the BIOS screen when I try to boot it. I was able to run 10.04.04 on my hard drive before installing 11.10 and I am also able to use 11.10 on my usb pendrive and CD ROM. I've tried unplugging all USB devices before booting and also upgrading from 11.10 to 11.10. Holding the shift key from the BIOS screen doesn't allow me to access the GRUB menu to try: Highlight the first entry, press “e” to edit it. Navigate to words “quiet splash”, delete them and type “nomodeset” in their place (without quotes). Press Ctrl + X to continue boot. Once on the desktop, go to System Administration Additional Drivers and activate the recommended drivers. So running 11.10 on my pendrive, I tried editing /etc/default/grub, commenting out the GRUB_HIDDEN_TIMEOUT setting by putting a '#' in front of it to display the grub menu and setting GRUB_TIMEOUT setting to a value greater than or equal to 1 e.g. GRUB_TIMEOUT=10. However, when I run sudo update-grub, I get: /usr/sbin/grub-probe: error: cannot find a device for / (is /dev mounted?) I get the same error with update-grub after: sudo mount /dev/sda1 /mnt and after: sudo grub-install --root-directory=/mnt /dev/sda reboot sudo update-grub Other suggestions to fix the update-grub problem: Open synaptic, then purge all the related grub installed packages and reinstall grub-pc then and finally: sudo update-grub Or use Grub Customizer http://ubuntuforums.org/showthread.php?t=1195275 What would be the best way to approach this? I'm concerned about purging "all the related grub installed packages" but if it's true some files are corrupted this would seem necessary. Also, was I executing the correct commands i.e. with mount and grub-install, before running grub-update?

    Read the article

  • How to find cause of main file system going to read only mode

    - by user606521
    Ubuntu 12.04 File system goes to readonly mode frequently. First of all I have read this question file system is going into read only mode frequently already. But I have to know if it's not caused by something else than dying hard drive. This is server provided by my client and I am just runing there some node.js workers + one node.js server and I am using mongodb. From time to time (every 20-50h) system suddenly makes filesystem read only, mongodb process fails (due read-only fs) and my node workers/server (which are started by forever) are just killed. Here is the log from dmesg - I can see there some errors and messages that FS is going to read-only, and there is also some JOURNAL error but I would like to find cause of those errors.. http://speedy.sh/Ux2VV/dmesg.log.txt edit smartctl -t long /dev/sda smartctl 5.41 2011-06-09 r3365 [x86_64-linux-3.5.0-23-generic] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net SMART support is: Unavailable - device lacks SMART capability. A mandatory SMART command failed: exiting. To continue, add one or more '-T permissive' options. What I am doing wrong? Same is for sda2. Morover now when I type any command that not exists in shell I get this: Sorry, command-not-found has crashed! Please file a bug report at: https://bugs.launchpad.net/command-not-found/+filebug Please include the following information with the report:

    Read the article

  • How can I erase the traces of Folder Redirection from the Default Domain Policy

    - by bruor
    I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

    Read the article

  • how to correctly mount fat32 partition in Ubuntu in order to preserve case

    - by Dean
    I've found there are couple of problems might be related how my FAT32 partition was mounted. I hope you can help me to solve the problem. I also included the command I used to help others when they find this post, sorry to those might feel I should use less space. I've the following file structures on my disk dean@notebook:~$ sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Disk identifier: 0x08860886 Device Boot Start End Blocks Id System /dev/sda1 * 1 13 102400 7 HPFS/NTFS Partition 1 does not end on cylinder boundary. /dev/sda2 13 5737 45978624 7 HPFS/NTFS /dev/sda3 5738 10600 39062047+ 83 Linux /dev/sda4 10601 19457 71143852+ 5 Extended /dev/sda5 10601 11208 4883728+ 82 Linux swap / Solaris /dev/sda6 11209 15033 30720000 b W95 FAT32 /dev/sda7 15033 19457 35537920 7 HPFS/NTFS In the etc/fstab I've got UUID=91c57a65-dc53-476b-b219-28dac3682d31 / ext4 defaults 0 1 UUID=BEA2A8AFA2A86D99 /media/NTFS ntfs-3g quiet,defaults,locale=en_US.utf8,umask=0 0 0 UUID=0C0C-9BB3 /media/FAT32 vfat user,auto,utf8,fmask=0111,dmask=0000,uid=1000 0 0 /dev/sda5 swap swap sw 0 0 /dev/sda1 /media/sda1 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 /dev/sda2 /media/sda2 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 I checked my id using id and I've got dean@notebook:~$ id uid=1000(dean) gid=1000(dean) groups=4(adm),20(dialout),24(cdrom),46(plugdev),103(fuse),104(lpadmin),115(admin),120(sambashare),1000(dean) I don't know why with these settings I still have problem of using svn like in this one Thank you for your help!

    Read the article

  • Setup site folders on Apache and PHP

    - by Cobus Kruger
    I'm trying to set up my first Apache server on my Windows PC at home and I have real trouble finding out which configuration settings go where. I downloaded and installed XAMPP which seemed to get everything nicely set up and can see a working website on http://localhost. So far so good. The point of this is to develop a website of course, and to make my life easier (irony?), I wanted to let the web site root point to my Eclipse project folder. So I opened httpd-vhosts.conf, uncommented a VirtualHost block and changed its DocumentRoot to my local path. Now when I try to load http://localhost I get a 403 (Access denied) error. So where do I configure permissions for my folder? And is that all I need to let my site run from the folder specified or am I going to have to clear another hurdle? Update: I tried to simplify things a little, so I reinstalled XAMPP and got back to a working http://localhost. Then I confirmed that httpd-vhosts.conf is included in httpd.conf and made the following changes to httpd-vhosts.conf: Uncommented the line NameVirtualHost *:80 Added a virtual host shown below. Restarted Apache and saw the expected page on http://localhost <VirtualHost *:80> DocumentRoot "C:/xampp/htdocs/" ServerName localhost ErrorLog "logs/dummy-host2.localhost-error.log" CustomLog "logs/dummy-host2.localhost-access.log" combined </VirtualHost> I then created a new folder named C:\testweb, added an index.html file and changed the DocumentRoot line shown above. For all intents and purposes I would then expect the two configurations to be equivalent. But this setup gives me an error 403. Even though the C:\testweb folder already had the same permissions as the C:\xampp\htdocs folder, I then went further and gave the Everyone group full control of C:\testweb and got exactly the same problem. So what did I miss?

    Read the article

  • Issues installing new drivers

    - by Luke
    I have a Windows XP Home SP3 system that won't detect anything on USB. It works on Ubuntu Live (off USB), and the USB keyboard and mouse work in the BIOS. Physically speaking, I'm sure it's fine. I installed the SMBus drivers and the USB driver from the motherboard's website, adn that went fine. If I plug anything in, it can detect the type of thing it is (i.e. keyboard, mouse, flash drive, etc) and even the name sometimes (i.e. Microsoft 5 button mouse), but won't accept any drivers. I have tried putting the Windows CD in the drive, but that didn't help. I have scanned for viruses and CHKDSK with no issues, and ran a MemTest86 with no issues. I am limited to one PS/2 connection for inputs, so I'm using the keyboard and haven't tried WU yet. A colleague suggested trying a new USB controller, so I put in a PCI one that only had drivers for 9x on the CD, so I assume that XP has them built in. It goes through the Found New Hardware wizard, but never actually finds drivers. I have also tried running SFC /SCANNOW and System Restore. SFC just flashes and goes away, making me believe it may be a hidden virus somewhere, but everything else seems to work, including MSE. I have reason to believe it's just an issue with detecting hardware, since even the USB Controller card can't seem to find drivers, but it can detect WHEN a USB device is connected Anyone else run into this, or have a suggestion short of re-installing Windows?

    Read the article

  • I must clear my cmos to be able to boot

    - by Fredou
    I have this Asus p7p55d-e pro for about 8 months(got it last July) and for this last 3-4 days I cannot boot without clearing my CMOS what I have is: Seasonic M12D 750W ASUS P7P55D-E Pro Intel Core i5 760 Quad Core Processor Lynnfield LGA1156 XFX GeForce® 8800 GT Alpha Dog 512MB DDR3 Standard (PV-T88P-YDF4) 2x Corsair XMS3 CMX4GX3M2A1600C7 4GB DDR3 2X2GB DDR3-1600 CL 7-8-7-20 I tried to remove all the unnecessary stuff: HD/dvd/pci card/usb cable/etc I tried with only 1 dimm filled, instead of my 4, each one individually it didn't work I tried changing the battery, here goes a few dollars to nowhere, didn't work if I don't reset the CMOS it sometime stock on RAM led, sometime on BOOT DEVICE led, when this happen, it stuck on CPU speed detection when I boot right after the reset, i MUST click on the F2 option (boot with default bios setting) if i go into the bios and save/restart, i have to reset it again when booted, everything is rock solid stable, tried memtest, cpu stress, etc, etc. without issue what should be my next step? trying a new psu? (i need to find one..) doing rma? (i need this mb since it's my only computer...) something else?

    Read the article

  • Cent OS ifcfg configuration for ranges of IP's with different netmask

    - by Aaron Schlegel
    I have 1 set of 30 public IP's with a netmask of 255.255.255.0 and another set of 30 IP's with a netmask of 255.255.255.128. Both sets of IP's also have different gateways. How can I virtually assign the IP's to the machine? I have tried creating ifcfg-eth0:0 ifcfg-eth0:1 ifcfg-eth0:X ect for each IP. Below is my ifcfg file with. I have this for each IP with the correct gateway IP and netmask for each of my 60 IP's. If I do ip addr show it does show all of the 60 addresses with the correct broadcast IP and netmask. However I can only use 30 of my IP's that are from the same netmask. Am I doing this correctly? If the IP's show up with ip addr show does that mean I have correctly assigned them to the machine virtually? I want to check before I blame my hosting company for not routing the IP's correctly. DEVICE="eth0:1" BOOTPROTO="static" DNS1="**.**.**.**" DNS2="**.**.**.**" GATEWAY="2**.**.***.126" HOSTNAME="localhost.localdomain" HWADDR="0*:19:**:**:**:**" IPADDR="2**.*.**.**" IPV6INIT="no" MTU="1500" NETMASK="255.255.255.128" NM_CONTROLLED="yes" ONBOOT="yes" TYPE="Ethernet" Also is there a better way to do this? I have used ifcfg-eth0:0-range1 before to assign a range of IP's from the same netmask. Is it possible to do this with ranges with different netmask? Thanks!

    Read the article

  • Installed Paragon HFS+ for Windows 8, now my pc won't recognize the external firewire drive

    - by Steve
    I'm not incredibly knowledgeable about computers and I really need some help. Just got a Seagate external firewire drive this morning. I downloaded the necessary pc driver (Paragon HFS+ for Windows 8) through their website per the instructions that came with the drive. After installation, I restarted and the pc recognized the firewire drive just fine. About three hours into copying files from my pc to the firewire drive, it gave me an error and told me the files couldn't be copied. When I clicked to get out of the message, the computer crashed. After an hour of it trying to repair itself in safe mode, it restored me to an earlier version before the system crashed. Here's my current dilemma: The Paragon HFS+ is still showing up in my programs as installed, but the Device Manager is not recognizing the drive. When I try to uninstall and reinstall Paragon, it interrupts me with a message saying "The setup must update files or services that cannot be updated while the system is running" and basically gives me the finger. I have no idea what to do now, as it won't let me uninstall and reinstall Paragon, and I have no idea why it crashed my computer in the first place. Is there possibly another Mac - PC firewire driver I can try downloading instead? I really don't know what I'm doing and any help would be greatly appreciated.

    Read the article

< Previous Page | 528 529 530 531 532 533 534 535 536 537 538 539  | Next Page >