Search Results

Search found 14182 results on 568 pages for 'andrew answer'.

Page 538/568 | < Previous Page | 534 535 536 537 538 539 540 541 542 543 544 545  | Next Page >

• MySQL - Calculating fields on the fly vs storing calculated data

  - by Christian Varga

  Hi Everyone, I apologise if this has been asked before, but I can't seem to find an answer to a question that I have about calculating on the fly vs storing fields in a database. I read a few articles that suggested it was preferable to calculate when you can, but I would just like to know if that still applies to the following 2 examples. Example 1. Say you are storing data relating to a car. You store the fuel tank size in litres, and how many litres it uses per 100km. You also want to know how many KMs it can travel, which can be calculated from the tank size and economy. I see 2 ways of doing this: When a car is added or updated, calculate the amount of KMs and store this as a static field in the database. Every time a car is accessed, calculate the amount of KMs on the fly. Because the cars economy/tank size doesn't change (although it could be edited), the KMs is a pretty static value. I don't see why we would calculate it every single time the car is accessed. Wouldn't this waste cpu time as opposed to simply storing it in a separate field in the database and calculating only when a car is added or updated? My next example, which is almost an entirely different question (but on the same topic), relates to counting children. Let's say we have a app which has categories and items. We have a view where we display all the categories, and a count of all the items inside each category. Again, I'm wondering what's better. To perform a MySQL query to count all the items in each category every single time the page is accessed? Or store the count in a field in the categories table and update when an item is added / deleted? I know it is redundant to store anything that can be calculated, but I worry that calculating fields or counting records might be slow as opposed to storing the data in a field. If it's not then please let me know, I just want to learn about when to use either method. On a small scale I guess it wouldn't matter either way, but apps like Facebook, would they really count the amount of friends you have every time someone views your profile or would they just store it as a field? I'd appreciate any responses to both of these scenarios, and any resource that might explain the benefits of calculating vs storing. Thanks in advance, Christian

  Read the article

• Loading the last related record instantly for multiple parent records using Entity framework

  - by Guillaume Schuermans

  Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

  Read the article

• waiting for 2 different events in a single thread

  - by João Portela

  component A (in C++) - is blocked waiting for alarm signals (not relevant) and IO signals (1 udp socket). has one handler for each of these. component B (java) - has to receive the same information the component A udp socket receives. periodicaly gives instructions that should be sent through component A udp socket. How to join both components? it is strongly desirable that: the changes to attach component B to component A are minimal (its not my code and it is not very pleasent to mess with). the time taken by the new operations (usually communicating with component B) interfere very little with the usual processing time of component A - this means that if the operations are going to take a "some" time I would rather use a thread or something to do them. note: since component A receives udp packets more frequently that it has component B instructions to forward, if necessary, it can only forward the instructions (when available) from the IO handler. my initial ideia was to develop a component C (in C++) that would sit inside the component A code (is this called an adapter?) that when instanciated starts the java process and makes the necessary connections (that not so little overhead in the initialization is not a problem). It would have 2 stacks, one for the data to give component B (lets call it Bstack) and for the data to give component A (lets call it Astack). It would sit on its thread (lets call it new-thread) waiting for data to be available in Bstack to send it over udp, and listen on the udp socket to put data on the Astack. This means that the changes to component A are only: when it receives a new UDP packet put it on the Bstack, and if there is something on the Astack sent it over its UDP socket (I decided for this because this socket would only be used in the main thread). One of the problems is that I don't know how to wait for both of these events at the same time using only one thread. so my questions are: Do I really need to use the main thread to send the data over component A socket or can I do it from the new-thread? (I think the answer is no, but I'm not sure about race conditions on sockets) how to I wait for both events? boost::condition_variable or something similar seems the solution in the case of the stack and boost::asio::io_service io_service.run() seems like the thing to use for the socket. Is there any other alternative solution for this problem that I'm not aware of? Thanks for reading this long text but I really wanted you to understand the problem.

  Read the article

• To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

  - by Globalkeith

  Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

  Read the article

• GHC.Generics and Type Families

  - by jberryman

  This is a question related to my module here, and is simplified a bit. It's also related to this previous question, in which I oversimplified my problem and didn't get the answer I was looking for. I hope this isn't too specific, and please change the title if you can think if a better one. Background My module uses a concurrent chan, split into a read side and write side. I use a special class with an associated type synonym to support polymorphic channel "joins": {-# LANGUAGE TypeFamilies #-} class Sources s where type Joined s newJoinedChan :: IO (s, Messages (Joined s)) -- NOT EXPORTED --output and input sides of channel: data Messages a -- NOT EXPORTED data Mailbox a instance Sources (Mailbox a) where type Joined (Mailbox a) = a newJoinedChan = undefined instance (Sources a, Sources b)=> Sources (a,b) where type Joined (a,b) = (Joined a, Joined b) newJoinedChan = undefined -- and so on for tuples of 3,4,5... The code above allows us to do this kind of thing: example = do (mb , msgsA) <- newJoinedChan ((mb1, mb2), msgsB) <- newJoinedChan --say that: msgsA, msgsB :: Messages (Int,Int) --and: mb :: Mailbox (Int,Int) -- mb1,mb2 :: Mailbox Int We have a recursive action called a Behavior that we can run on the messages we pull out of the "read" end of the channel: newtype Behavior a = Behavior (a -> IO (Behavior a)) runBehaviorOn :: Behavior a -> Messages a -> IO () -- NOT EXPORTED This would allow us to run a Behavior (Int,Int) on either of msgsA or msgsB, where in the second case both Ints in the tuple it receives actually came through separate Mailboxes. This is all tied together for the user in the exposed spawn function spawn :: (Sources s) => Behavior (Joined s) -> IO s ...which calls newJoinedChan and runBehaviorOn, and returns the input Sources. What I'd like to do I'd like users to be able to create a Behavior of arbitrary product type (not just tuples) , so for instance we could run a Behavior (Pair Int Int) on the example Messages above. I'd like to do this with GHC.Generics while still having a polymorphic Sources, but can't manage to make it work. spawn :: (Sources s, Generic (Joined s), Rep (Joined s) ~ ??) => Behavior (Joined s) -> IO s The parts of the above example that are actually exposed in the API are the fst of the newJoinedChan action, and Behaviors, so an acceptable solution can modify one or all of runBehaviorOn or the snd of newJoinedChan. I'll also be extending the API above to support sums (not implemented yet) like Behavior (Either a b) so I hoped GHC.Generics would work for me. Questions Is there a way I can extend the API above to support arbitrary Generic a=> Behavior a? If not using GHC's Generics, are there other ways I can get the API I want with minimal end-user pain (i.e. they just have to add a deriving clause to their type)?

  Read the article

• Why does std::map operator[] create an object if the key doesn't exist?

  - by n1ck

  Hi, I'm pretty sure I already saw this question somewhere (comp.lang.c++? Google doesn't seem to find it there either) but a quick search here doesn't seem to find it so here it is: Why does the std::map operator[] create an object if the key doesn't exist? I don't know but for me this seems counter-intuitive if you compare to most other operator[] (like std::vector) where if you use it you must be sure that the index exists. I'm wondering what's the rationale for implementing this behavior in std::map. Like I said wouldn't it be more intuitive to act more like an index in a vector and crash (well undefined behavior I guess) when accessed with an invalid key? Refining my question after seeing the answers: Ok so far I got a lot of answers saying basically it's cheap so why not or things similar. I totally agree with that but why not use a dedicated function for that (I think one of the comment said that in java there is no operator[] and the function is called put)? My point is why doesn't map operator[] work like a vector? If I use operator[] on an out of range index on a vector I wouldn't like it to insert an element even if it was cheap because that probably mean an error in my code. My point is why isn't it the same thing with map. I mean, for me, using operator[] on a map would mean: i know this key already exist (for whatever reason, i just inserted it, I have redundancy somewhere, whatever). I think it would be more intuitive that way. That said what are the advantage of doing the current behavior with operator[] (and only for that, I agree that a function with the current behavior should be there, just not operator[])? Maybe it give clearer code that way? I don't know. Another answer was that it already existed that way so why not keep it but then, probably when they (the ones before stl) choose to implement it that way they found it provided an advantage or something? So my question is basically: why choose to implement it that way, meaning a somewhat lack of consistency with other operator[]. What benefit do it give? Thanks

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Saving JQuery Draggable Sitemap Values Correctly

  - by mdolon

  I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

  Read the article

• Image animation problem in silverlight

  - by Jak

  Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

  Read the article

• Remote Postgresql - extremely slow

  - by Muffinbubble

  Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

  Read the article

• Downloading large file with php

  - by Alessandro

  Hi, I have to write a php script to download potentially large files. The file I'm reporting here works fine most of the times. However, if the client's connection is slow the request ends (with status code 200) in the middle of the downloading, but not always at the very same point, and not at the very same time. I tried to overwrite some php.ini variables (see the first statements) but the problem remains. I don't know if it's relevant but my hosting server is SiteGround, and for simple static file requests, the download works fine also with slow connections. I've found Forced downloading large file with php but I didn't understand mario's answer. I'm new to web programming. So here's my code. <?php ini_set('memory_limit','16M'); ini_set('post_max_size', '30M'); set_time_limit(0); include ('../private/database_connection.php'); $downloadFolder = '../download/'; $fileName = $_POST['file']; $filePath = $downloadFolder . $fileName; if($fileName == NULL) { exit; } ob_start(); session_start(); if(!isset($_SESSION['Username'])) { // or redirect to login (remembering this download request) $_SESSION['previousPage'] = 'download.php?file=' . $fileName; header("Location: login.php"); exit; } if (file_exists($filePath)) { header('Content-Description: File Transfer'); header('Content-Type: application/octet-stream'); //header('Content-Disposition: attachment; filename='.$fileName); header("Content-Disposition: attachment; filename=\"$fileName\""); header('Content-Transfer-Encoding: binary'); header('Expires: 0'); header('Cache-Control: must-revalidate, post-check=0, pre-check=0'); //header('Pragma: public'); header('Content-Length: ' . filesize($filePath)); ob_clean(); flush(); // download // 1 // readfile($filePath); // 2 $file = @fopen($filePath,"rb"); if ($file) { while(!feof($file)) { print(fread($file, 1024*8)); flush(); if (connection_status()!=0) { @fclose($file); die(); } } @fclose($file); } exit; } else { header('HTTP/1.1 404 File not found'); exit; } ?>

  Read the article

• One registry key for many products not deleted on uninstall

  - by NC1

  My company has many products, we want to create a registry key Software\$(var.Manufacturer)that will have all of our products if our customers have installed more than one (which is likely) I then want to have a secondary key for each of our products which get removed on uninstall but the main one does not. I have tried to achieve this like below but my main key gets deleted so all of my other products also get deleted from the registry. I know this is trivial but I cannot find an answer. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="*" MultiInstance="yes" Permanent="yes"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="*" MultiInstance="yes" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef> EDIT: I have got my registry keys to stay using the following code. However they only all delete wen all products are deleted, not one by one as they need to. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="FF75CA48-27DE-430E-B78F-A1DC9468D699" Permanent="yes" Shared="yes" Win64="$(var.Win64)"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="D94FA576-970F-4503-B6C6-BA6FBEF8A60A" Win64="$(var.Win64)" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" ForceDeleteOnUninstall="yes"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef>

  Read the article

• Making Visual C++ DLL from C++ class

  - by prosseek

  I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

  Read the article

• Having problems creating an array from XML data in Acrobat Javascript, please help if you can

  - by Kevin Minke

  I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

  Read the article

• C++ string sort like a human being?

  - by Walter Nissen

  I would like to sort alphanumeric strings the way a human being would sort them. I.e., "A2" comes before "A10", and "a" certainly comes before "Z"! Is there any way to do with without writing a mini-parser? Ideally it would also put "A1B1" before "A1B10". I see the question "Natural (human alpha-numeric) sort in Microsoft SQL 2005" with a possible answer, but it uses various library functions, as does "Sorting Strings for Humans with IComparer". Below is a test case that currently fails: #include <set> #include <iterator> #include <iostream> #include <vector> #include <cassert> template <typename T> struct LexicographicSort { inline bool operator() (const T& lhs, const T& rhs) const{ std::ostringstream s1,s2; s1 << toLower(lhs); s2 << toLower(rhs); bool less = s1.str() < s2.str(); std::cout<<s1.str()<<" "<<s2.str()<<" "<<less<<"\n"; return less; } inline std::string toLower(const std::string& str) const { std::string newString(""); for (std::string::const_iterator charIt = str.begin(); charIt!=str.end();++charIt) { newString.push_back(std::tolower(*charIt)); } return newString; } }; int main(void) { const std::string reference[5] = {"ab","B","c1","c2","c10"}; std::vector<std::string> referenceStrings(&(reference[0]), &(reference[5])); //Insert in reverse order so we know they get sorted std::set<std::string,LexicographicSort<std::string> > strings(referenceStrings.rbegin(), referenceStrings.rend()); std::cout<<"Items:\n"; std::copy(strings.begin(), strings.end(), std::ostream_iterator<std::string>(std::cout, "\n")); std::vector<std::string> sortedStrings(strings.begin(), strings.end()); assert(sortedStrings == referenceStrings); }

  Read the article

• SQL Server architecture guidance

  - by Liam

  Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

  Read the article

• Blit Queue Optimization Algorithm

  - by martona

  I'm looking to implement a module that manages a blit queue. There's a single surface, and portions of this surface (bounded by rectangles) are copied to elsewhere within the surface: add_blt(rect src, point dst); There can be any number of operations posted, in order, to the queue. Eventually the user of the queue will stop posting blits, and ask for an optimal set of operations to actually perform on the surface. The task of the module is to ensure that no pixel is copied unnecessarily. This gets tricky because of overlaps of course. A blit could re-blit a previously copied pixel. Ideally blit operations would be subdivided in the optimization phase in such a way that every block goes to its final place with a single operation. It's tricky but not impossible to put this together. I'm just trying to not reinvent the wheel. I looked around on the 'net, and the only thing I found was the SDL_BlitPool Library which assumes that the source surface differs from the destination. It also does a lot of grunt work, seemingly unnecessarily: regions and similar building blocks are a given. I'm looking for something higher-level. Of course, I'm not going to look a gift horse in the mouth, and I also don't mind doing actual work... If someone can come forward with a basic idea that makes this problem seem less complex than it does right now, that'd be awesome too. EDIT: Thinking about aaronasterling's answer... could this work? Implement customized region handler code that can maintain metadata for every rectangle it contains. When the region handler splits up a rectangle, it will automatically associate the metadata of this rectangle with the resulting sub-rectangles. When the optimization run starts, create an empty region handled by the above customized code, call this the master region Iterate through the blt queue, and for every entry: Let srcrect be the source rectangle for the blt beng examined Get the intersection of srcrect and master region into temp region Remove temp region from master region, so master region no longer covers temp region Promote srcrect to a region (srcrgn) and subtract temp region from it Offset temp region and srcrgn with the vector of the current blt: their union will cover the destination area of the current blt Add to master region all rects in temp region, retaining the original source metadata (step one of adding the current blt to the master region) Add to master region all rects in srcrgn, adding the source information for the current blt (step two of adding the current blt to the master region) Optimize master region by checking if adjacent sub-rectangles that are merge candidates have the same metadata. Two sub-rectangles are merge candidates if (r1.x1 == r2.x1 && r1.x2 == r2.x2) | (r1.y1 == r2.y1 && r1.y2 == r2.y2). If yes, combine them. Enumerate master region's sub-rectangles. Every rectangle returned is an optimized blt operation destination. The associated metadata is the blt operation`s source.

  Read the article

• How do you unit test the real world?

  - by Kim Sun-wu

  I'm primarily a C++ coder, and thus far, have managed without really writing tests for all of my code. I've decided this is a Bad Idea(tm), after adding new features that subtly broke old features, or, depending on how you wish to look at it, introduced some new "features" of their own. But, unit testing seems to be an extremely brittle mechanism. You can test for something in "perfect" conditions, but you don't get to see how your code performs when stuff breaks. A for instance is a crawler, let's say it crawls a few specific sites, for data X. Do you simply save sample pages, test against those, and hope that the sites never change? This would work fine as regression tests, but, what sort of tests would you write to constantly check those sites live and let you know when the application isn't doing it's job because the site changed something, that now causes your application to crash? Wouldn't you want your test suite to monitor the intent of the code? The above example is a bit contrived, and something I haven't run into (in case you haven't guessed). Let me pick something I have, though. How do you test an application will do its job in the face of a degraded network stack? That is, say you have a moderate amount of packet loss, for one reason or the other, and you have a function DoSomethingOverTheNetwork() which is supposed to degrade gracefully when the stack isn't performing as it's supposed to; but does it? The developer tests it personally by purposely setting up a gateway that drops packets to simulate a bad network when he first writes it. A few months later, someone checks in some code that modifies something subtly, so the degradation isn't detected in time, or, the application doesn't even recognize the degradation, this is never caught, because you can't run real world tests like this using unit tests, can you? Further, how about file corruption? Let's say you're storing a list of servers in a file, and the checksum looks okay, but the data isn't really. You want the code to handle that, you write some code that you think does that. How do you test that it does exactly that for the life of the application? Can you? Hence, brittleness. Unit tests seem to test the code only in perfect conditions(and this is promoted, with mock objects and such), not what they'll face in the wild. Don't get me wrong, I think unit tests are great, but a test suite composed only of them seems to be a smart way to introduce subtle bugs in your code while feeling overconfident about it's reliability. How do I address the above situations? If unit tests aren't the answer, what is? Thanks!

  Read the article

• controlling the class names generated by JAXB for xsd:attributeGroup?

  - by Stephen Winnall

  I am using JAXB to bind XML to Java for an application that I am writing. I have an element called measure which contains two amount elements called amount and maxAmount, with which I want to model a lower and an upper limiting value. amount and maxAmount are otherwise identical and I would like them to be implemented with the same class when unmarshalled into Java. The following is an extract from the XML schema which I feed to JAXB: <xsd:attributeGroup name="AmountAttributes"> <xsd:attribute name="quantity" type="xsd:decimal"/> <xsd:attribute name="numerator" type="xsd:nonNegativeInteger"/> <xsd:attribute name="denominator" type="xsd:positiveInteger"/> </xsd:attributeGroup> <xsd:element name="measure"> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" name="amount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> <xsd:element minOccurs="0" name="maxAmount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> JAXB creates from this a more elaborate version of the following: public class Measure { protected Measure.Amount amount; protected Measure.MaxAmount maxAmount; public static class Measure.Amount {} public static class Measure.MaxAmount {} } Measure.Amount and Measure.MaxAmount are identical except for their names, but - of course - as far as Java is concerned they have little to do with each other. Is there a way of making JAXB use the same class for both amount and maxAmount? Just to come completely clean ;-) I should mention that I generate the XML schema from RNC using Trang. If the answer to the question is "change the XML schema", I have the supplementary question "how do I change the RNC to produce that XML schema?". My RNC looks like this: AmountAttributes = QuantityAttribute? & attribute numerator { xsd:nonNegativeInteger }? & attribute denominator { xsd:positiveInteger }? QuantityAttribute = attribute quantity { xsd:decimal } Measure = element measure { element amount { AmountAttributes }?, element maxAmount { AmountAttributes }? }+ I use RNC because I find it simpler to understand, but if the solution to my problem means just using XML Schema, so be it. Steve

  Read the article

• web design PSD to html -> more direct ways?

  - by Assembler

  At work I see one colleague designing a site in Photoshop/Fireworks, I see another taking this data, slicing it up and using Dreamweaver to rebuild the same from scratch. It seems like too much mucking around! I know that Photoshop can output a tables based HTML, and Fireworks will create divs with absolute positioning; neither appear to be very helpful. Admittedly, I haven't tried much of (DW/FW) (CS4/CS3) since becoming a programmer, so I don't know if new versions are addressing this work flow issue, but are we still double handling things? Can we attach some sort of layout metadata (this is a rollover button, this will be a SWF, this will be text, this logo will hide "xyz" <h1> text etc) to slices to aid in layout generation? are there some secret tools which assist in this conversion process? Or are we still restricted to doing things by hand? The frustration continues when said hand built page needs to be reworked again to fit Smarty Templates/Wordpress/generic CMS. I acknowledge that designers need to be free of systems to be able to do whatever, but most conventional sites have: a header with navigation a sidebar with more links the main content part maybe another sidebar a footer Given the similarity of a lot of components, shouldn't there be a more systematic approach to going from sliced designs to functional HTML? Or am I over-simplifying things? -edit- Mmmmm.... I suppose I will accept an answer, but they weren't really what I was looking for. It just seems like designing the DOM is a bit of holy grail ("It's only a model!"), and maybe with all the "groovy" things you can do with HTML and Javascript, it would be mighty hard work, but with a set of constraints (that 960 stuff looks interesting), some well designed reset style sheets and a bit of... fairy dust? we should be able to improve the work flow. Photoshop's tables by themselves are pretty much useless, I agree, but surely we can take this data, and then select a group of cells and say "right, this is a text div, overflow:auto" or "these cells are an image block, style it with the same height/width as the selected area". Admittedly here at work there are other elephants in the room that need to make their formal introductions to management, but some parts of the designpage workflow seem... uneducated at best.

  Read the article

• How to override loading a TImage from the object inspector (at run-time)?

  - by Mawg

  Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

  Read the article

• Doing some stuff right before the user exits the page

  - by Mike

  I have seen some questions here regarding what I want to achieve and have based what I have so far on those answer. But there is a slight misbehavior that is still irritating me. What I have is sort of a recovery feature. Whenever you are typing text, the client sends a sync request to the server every 45 seconds. It does 2 things. First, it extends the lease the client has on the record (only one person may edit at one time) for another 60 seconds. Second, it sends the text typed so far to the server in case the server crashes, internet connection fails, etc. In that case, the next time the user enters our application, the user is notified that something has gone wrong and that some text was recovered. Think of Microsoft or OpenOffice recovery whenever they crash! Of course, if the user leaves the page willingly, the user does not need to be notified and as a result, the recovery is deleted. I do that final request via a beforeunload event. Everything went fine until I was asked to make a final adjustment... The same behavior you have here at stack overflow when you exit the editor... a confirm dialogue. This works so far, BUT, the confirm dialogue is shown twice. Here is the code. The event if (local.sync.autosave_textelement) { window.onbeforeunload = exitConfirm; } The function function exitConfirm() { var local = Core; if (confirm('blub?')) { local.sync.autosave_destroy = true; sync(false); return true; } else { return false; } }; Some problem irrelevant clarifications: Core is a global Object that contains a lot of variables that are used everywhere. sync makes an ajax request. The values are based on the values that the Core.sync object contains. The parameter determines if the call should be async (default) or sync. Edit 1 I did try to separate both things (recovery deletion and user confirmation that is) into beforeunload and unload. The problem there was that unload is a bit too late. The user gets informed that there is a recovery even though it is scheduled to be deleted. If you refresh the page 1 second later, the dialogue disappears as the file was deleted by then.

  Read the article

• current_user.user_type_id = @employer ID

  - by sscirrus

  I am building a system with a User model (authenticated using AuthLogic) and three user types in three models: one of these models is Employer. Each of these three models has_many :users, :as = :authenticable. I start by having a new visitor to the site create their own 'User' record with username, password, which user type they are, etc. Upon creation, the user is sent to the 'new' action for one of the three models. So, if they tell us they are an employer, we redirect_to :controller = "employers, :action = "new". Question: When the employer has submitted, I want to set the current_user.user_type_id equal to the employer ID. This should be simple... but it's not working. # Employers Controller / new def new @employer = Employer.new 1.times {@employer.addresses.build} render :layout => 'forms' end # Employers Controller / create def create @employer = Employer.new(params[:employer]) if @employer.save if current_user.blank? redirect_to :controller => "users", :action => "new" else current_user.user_type_id = @employer.id current_user.user_type = "Employer" redirect_to :action => "home", :id => current_user.user_type_id end else render :action => "new" end end ------UPDATE------ Hi guys. In response: I am using this table structure because each of my three user type models have lots of different fields and each has different relationships to the other models, which is why I've avoided STI. By 1.times (@employer.addresses.build) I'm connecting the employer model to the address polymorphic table in one form, so I'm asking the controller to build a new address to go along with the new employer. Averell: you mentioned encapsulating... something in the model using a 'setter' method. I have no idea what you mean by this - could you please explain how this works (or direct me to an example elsewhere)? With tsdbrown's answer I have managed to create the behavior I want... if there's a more elegant way to accomplish the same thing I'd love to learn how. Thanks very much. Thanks to tsdbrown for answering the current_user.save problem!

  Read the article

• Why is this statement treated as a string instead of its result?

  - by reve_etrange

  I am trying to perform some composition-based filtering on a large collection of strings (protein sequences). I wrote a group of three subroutines in order to take care of it, but I'm running into trouble in two ways - one minor, one major. The minor trouble is that when I use List::MoreUtils 'pairwise' I get warnings about using $a and $b only once and them being uninitialized. But I believe I'm calling this method properly (based on CPAN's entry for it and some examples from the web). The major trouble is an error "Can't use string ("17/32") as HASH ref while "strict refs" in use..." It seems like this can only happen if the foreach loop in &comp is giving the hash values as a string instead of evaluating the division operation. I'm sure I've made a rookie mistake, but can't find the answer on the web. The first time I even looked at perl code was last Wednesday... use List::Util; use List::MoreUtils; my @alphabet = ( 'A', 'R', 'N', 'D', 'C', 'Q', 'E', 'G', 'H', 'I', 'L', 'K', 'M', 'F', 'P', 'S', 'T', 'W', 'Y', 'V' ); my $gapchr = '-'; # Takes a sequence and returns letter = occurrence count pairs as hash. sub getcounts { my %counts = (); foreach my $chr (@alphabet) { $counts{$chr} = ( $[0] =~ tr/$chr/$chr/ ); } $counts{'gap'} = ( $[0] =~ tr/$gapchr/$gapchr/ ); return %counts; } # Takes a sequence and returns letter = fractional composition pairs as a hash. sub comp { my %comp = getcounts( $[0] ); foreach my $chr (@alphabet) { $comp{$chr} = $comp{$chr} / ( length( $[0] ) - $comp{'gap'} ); } return %comp; } # Takes two sequences and returns a measure of the composition difference between them, as a scalar. # Originally all on one line but it was unreadable. sub dcomp { my @dcomp = pairwise { $a - $b } @{ values( %{ comp( $[0] ) } ) }, @{ values( %{ comp( $[1] ) } ) }; @dcomp = apply { $_ ** 2 } @dcomp; my $dcomp = sqrt( sum( 0, @dcomp ) ) / 20; return $dcomp; } Much appreciation for any answers or advice!

  Read the article

• AnimationDrawable, when does it end?

  - by Syb

  I know there have been several people with the same question. Which is: How do i know when a frame by frame animation has ended? I have not had any useful answer on fora i visited. So i thought, let's see if they know at stackoverflow. But I could not sit still in the mean time, so i made a work around of this, but it does not really work the way i would like it to. here is the code: public class Main extends Activity { AnimationDrawable sybAnimation; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); ImageView imageView = (ImageView)findViewById(R.id.ImageView01); imageView.setBackgroundResource(R.anim.testanimation); sybAnimation = (AnimationDrawable) imageView.getBackground(); imageView.post(new Starter()); } class Starter implements Runnable { public void run() { sybAnimation.start(); long totalDuration = 0; for(int i = 0; i< sybAnimation.getNumberOfFrames();i++){ totalDuration += sybAnimation.getDuration(i); } Timer timer = new Timer(); timer.schedule(new AnimationFollowUpTimerTask(R.id.ImageView01, R.anim.testanimation_reverse),totalDuration); } } class AnimationFollowUpTimerTask extends TimerTask { private int id; private int animationToRunId; public AnimationFollowUpTimerTask(int idOfImageView, int animationXML){ id = idOfImageView; animationToRunId = animationXML; } @Override public void run() { ImageView imageView = (ImageView)findViewById(id); imageView.setBackgroundResource(animationToRunId); AnimationDrawable anim = (AnimationDrawable) imageView.getBackground(); anim.start(); } } basically I make a timertask which is scheduled with the same time as the animation to take. In that run() I want to load a new animation into the imageView and start that animation, this however does not work. Does anyone know how to get this to work, or even better, have a better way to find out when an AnimationDrawable has ended its animation?

  Read the article

< Previous Page | 534 535 536 537 538 539 540 541 542 543 544 545  | Next Page >