Search Results

Search found 14548 results on 582 pages for 'const reference'.

Page 541/582 | < Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >

  • Windows phone app xaml error

    - by thewarri0r9
    i am developing an app for windows phone 8 and i stuck on this code which visual studio showing invalid xaml. But Code compiles and works well. Invalid xaml Code is : <DataTemplate x:Key="AddrBookItemTemplate"> <StackPanel Margin="0,0,0,2" Orientation="Horizontal"> <StackPanel Width="80" Orientation="Horizontal" Height="80"> <Ellipse Margin="0" Height="70" Width="70" HorizontalAlignment="Left" Stroke="{x:Null}"> <Ellipse.Fill> <ImageBrush Stretch="Fill" ImageSource="{Binding imageBytes, Converter={StaticResource BytesToImageConverter}}"/> </Ellipse.Fill> </Ellipse> </StackPanel> <StackPanel Height="80" Margin="0" Width="380" HorizontalAlignment="Left"> <TextBlock FontWeight="Bold" Text="{Binding FirstName}" FontFamily="Segoe WP Semibold" FontSize="30" VerticalAlignment="Top" Margin="5,0,0,0" HorizontalAlignment="Left" /> <TextBlock Text="{Binding Phone}" FontFamily="Segoe WP" FontSize="24" Foreground="{StaticResource PhoneTextBoxReadOnlyBrush}" Margin="5,0,0,-12" Width="320" HorizontalAlignment="Left" VerticalAlignment="Top"/> </StackPanel> </StackPanel> </DataTemplate> I am serializing image by converting it to byte, it works fine but if image is null it gives an error. code behind: if (e.Results != null) { List<AddressBook> source = new List<AddressBook>(); foreach (var result in e.Results) { if (result.PhoneNumbers.FirstOrDefault() != null && result.GetPicture()!=null) { BitmapImage bmp = new BitmapImage(); BitmapImage nullbmp = new BitmapImage(); if (result.GetPicture() == null) { bmp.UriSource = new Uri(@"/Images/ci2.png", UriKind.RelativeOrAbsolute); } else { bmp.SetSource(result.GetPicture()); } listobj.Add(new AddressBook() { FirstName = result.DisplayName != null ? result.DisplayName : "", imageBytes = AddressBook.imageConvert(bmp), EmailAddress = "", LastName = "", Phone = result.PhoneNumbers.FirstOrDefault() != null ? result.PhoneNumbers.FirstOrDefault().PhoneNumber : "", }); } } Above code show an error "object reference not set to instance of an object". I want to show the default image (or color) in ellipse when image is null.What should I do?

    Read the article

  • Spring's JdbcDaoSupport (using MySQL Connector/J) fails after executing sql that adds FK

    - by John
    I am using Spring's JdbcDaoSupport class with a DriverManagerDataSource using the MySQL Connector/J 5.0 driver (driverClassName=com.mysql.jdbc.driver). allowMultiQueries is set to true in the url. My application is an in-house tool we recently developed that executes sql scripts in a directory one-by-one (allows us to re-create our schema and reference table data for a given date, etc, but I digress). The sql scripts sometime contain multiple statements (hence allowMultiQueries), so one script can create a table, add indexes for that table, etc. The problem happens when including a statement to add a foreign key constraint in one of these files. If I have a file that looks like... --(column/constraint names are examples) CREATE TABLE myTable ( fk1 BIGINT(19) NOT NULL, fk2 BIGINT(19) NOT NULL, PRIMARY KEY (fk1, fk2) ); ALTER TABLE myTable ADD CONSTRAINT myTable_fk1 FOREIGN KEY (fk1) REFERENCES myOtherTable (id) ; ALTER TABLE myTable ADD CONSTRAINT myTable_fk2 FOREIGN KEY (fk2) REFERENCES myOtherOtherTable (id) ; then JdbcTemplate.execute throws an UncategorizedSqlException with the following error message and stack trace: Exception in thread "main" org.springframework.jdbc.UncategorizedSQLException: StatementCallback; uncategorized SQLException for SQL [ THE SQL YOU SEE ABOVE LISTED HERE ]; SQL state [HY000]; error code [1005]; Can't create table 'myDatabase.myTable' (errno: 150); nested exception is java.sql.SQLException: Can't create table 'myDatabase.myTable' (errno: 150) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:83) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) and the table and foreign keys are not inserted. Also, especially weird: if I take the foreign key statements out of the script I showed above and then place them in their own script that executes after (so I now have 1 script with just the create table statement, and 1 script with the add foreign key statements that executes after that) then what happens is: tool executes create table script, works fine, table is created tool executes add fk script, throws the same exception as seen above (except errno=121 this time), but the FKs actually get added (!!!) In other words, when the create table/FK statements are in the same script then the exception is thrown and nothing is created, but when they are different scripts a nearly identical exception is thrown but both things get created. Any help on this would be greatly appreciated. Please let me know if you'd like me to clarify anything more.

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • SQL Native Client 10 Performance miserable (due to server-side cursors)

    - by namezero
    we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

    Read the article

  • GetAcceptExSockaddrs returns garbage! Does anyone know why?

    - by David
    Hello, I'm trying to write a quick/dirty echoserver in Delphi, but I notice that GetAcceptExSockaddrs seems to be writing to only the first 4 bytes of the structure I pass it. USES SysUtils; TYPE BOOL = LongBool; DWORD = Cardinal; LPDWORD = ^DWORD; short = SmallInt; ushort = Word; uint16 = Word; uint = Cardinal; ulong = Cardinal; SOCKET = uint; PVOID = Pointer; _HANDLE = DWORD; _in_addr = packed record s_addr : ulong; end; _sockaddr_in = packed record sin_family : short; sin_port : uint16; sin_addr : _in_addr; sin_zero : array[0..7] of Char; end; P_sockaddr_in = ^_sockaddr_in; _Overlapped = packed record Internal : Int64; Offset : Int64; hEvent : _HANDLE; end; LP_Overlapped = ^_Overlapped; IMPORTS function _AcceptEx (sListenSocket, sAcceptSocket : SOCKET; lpOutputBuffer : PVOID; dwReceiveDataLength, dwLocalAddressLength, dwRemoteAddressLength : DWORD; lpdwBytesReceived : LPDWORD; lpOverlapped : LP_OVERLAPPED) : BOOL; stdcall; external MSWinsock name 'AcceptEx'; procedure _GetAcceptExSockaddrs (lpOutputBuffer : PVOID; dwReceiveDataLength, dwLocalAddressLength, dwRemoteAddressLength : DWORD; LocalSockaddr : P_Sockaddr_in; LocalSockaddrLength : LPINT; RemoteSockaddr : P_Sockaddr_in; RemoteSockaddrLength : LPINT); stdcall; external MSWinsock name 'GetAcceptExSockaddrs'; CONST BufDataSize = 8192; BufAddrSize = SizeOf (_sockaddr_in) + 16; VAR ListenSock, AcceptSock : SOCKET; Addr, LocalAddr, RemoteAddr : _sockaddr_in; LocalAddrSize, RemoteAddrSize : INT; Buf : array[1..BufDataSize + BufAddrSize * 2] of Byte; BytesReceived : DWORD; Ov : _Overlapped; BEGIN //WSAStartup, create listen socket, bind to port 1066 on any interface, listen //Create event for overlapped (autoreset, initally not signalled) //Create accept socket if _AcceptEx (ListenSock, AcceptSock, @Buf, BufDataSize, BufAddrSize, BufAddrSize, @BytesReceived, @Ov) then WinCheck ('SetEvent', _SetEvent (Ov.hEvent)) else if GetLastError <> ERROR_IO_PENDING then WinCheck ('AcceptEx', GetLastError); {do WaitForMultipleObjects} _GetAcceptExSockaddrs (@Buf, BufDataSize, BufAddrSize, BufAddrSize, @LocalAddr, @LocalAddrSize, @RemoteAddr, @RemoteAddrSize); So if I run this, connect to it with Telnet (on same computer, connecting to localhost) and then type a key, WaitForMultipleObjects will unblock and GetAcceptExSockaddrs will run. But the result is garbage! RemoteAddr.sin_family = -13894 RemoteAddr.sin_port = 64 and the rest is zeroes. What gives? Thanks in advance!

    Read the article

  • Programmatically Binding to a Property

    - by M312V
    I know it's a generic title, but my question is specific. I think it will boil down to a question of practice. So, I have the following code: public class Component : UIElement { public Component() { this.InputBindings.Add(new MouseBinding(SomeCommandProperty, new MouseGesture(MouseAction.LeftClick))); } } I could easily aggregate the ViewModel that owns SomeCommandProperty into the Component class, but I'm currently waiving that option assuming there is another way. Component is a child of ComponentCollection which is child of a Grid which DataContext is the ViewModel. ComponentCollection as the name suggests contains a collection of Components. <Grid Name="myGrid"> <someNamespace:ComponentCollection x:Name="componentCollection"/> </Grid> It's the same scenario as the XAML below, but with TextBlock. I guess I'm trying to replicate what's being done in the XAML below programatically. Again, Component's top most ancestor's DataContext is set to ViewModel. <Grid Name="myGrid"> <TextBlock Text="SomeText"> <TextBlock.InputBindings> <MouseBinding Command="{Binding SomeCommandProperty}" MouseAction="LeftClick" /> </TextBlock.InputBindings> </TextBlock> </Grid> Update 1 Sorry, I'm unable to comment because I lack the reputation points. Basically, I have a custom control which inherit from a Panel which children are a collection of Component. It's not a hack, like I've mentioned, I could directly have access to SomeCommandProperty If I aggregate the ViewModel into Component. Doing so, however, feels icky. That is, having direct access to ViewModel from a Model. I guess the question I'm asking is. Given the situation that Component's parent UIElement's DataContext is set to ViewModel, is it possible to access SomeCommandProperty without Component owning a reference to the ViewModel that owns SomeCommandProperty? Programatically, that is. Using ItemsControl doesn't change the fact that I still need to bind SomeCommandProperty to each Items.

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • NSMutableArray memory leak when reloading objects

    - by Davin
    I am using Three20/TTThumbsviewcontroller to load photos. I am struggling since quite a some time now to fix memory leak in setting photosource. I am beginner in Object C & iOS memory management. Please have a look at following code and suggest any obvious mistakes or any errors in declaring and releasing variables. -- PhotoViewController.h @interface PhotoViewController : TTThumbsViewController <UIPopoverControllerDelegate,CategoryPickerDelegate,FilterPickerDelegate,UISearchBarDelegate>{ ...... NSMutableArray *_photoList; ...... @property(nonatomic,retain) NSMutableArray *photoList; -- PhotoViewController.m @implementation PhotoViewController .... @synthesize photoList; ..... - (void)LoadPhotoSource:(NSString *)query:(NSString *)title:(NSString* )stoneName{ NSLog(@"log- in loadPhotosource method"); if (photoList == nil) photoList = [[NSMutableArray alloc] init ]; [photoList removeAllObjects]; @try { sqlite3 *db; NSFileManager *fileMgr = [NSFileManager defaultManager]; NSString* documentsPath = [NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES) objectAtIndex:0]; NSString *dbPath = [documentsPath stringByAppendingPathComponent: @"DB.s3db"]; BOOL success = [fileMgr fileExistsAtPath:dbPath]; if(!success) { NSLog(@"Cannot locate database file '%@'.", dbPath); } if(!(sqlite3_open([dbPath UTF8String], &db) == SQLITE_OK)) { NSLog(@"An error has occured."); } NSString *_sql = query;//[NSString stringWithFormat:@"SELECT * FROM Products where CategoryId = %i",[categoryId integerValue]]; const char *sql = [_sql UTF8String]; sqlite3_stmt *sqlStatement; if(sqlite3_prepare(db, sql, -1, &sqlStatement, NULL) != SQLITE_OK) { NSLog(@"Problem with prepare statement"); } if ([stoneName length] != 0) { NSString *wildcardSearch = [NSString stringWithFormat:@"%@%%",[stoneName stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]]; sqlite3_bind_text(sqlStatement, 1, [wildcardSearch UTF8String], -1, SQLITE_STATIC); } while (sqlite3_step(sqlStatement)==SQLITE_ROW) { NSString* urlSmallImage = @"Mahallati_NoImage.png"; NSString* urlThumbImage = @"Mahallati_NoImage.png"; NSString *designNo = [NSString stringWithUTF8String:(char *) sqlite3_column_text(sqlStatement,2)]; designNo = [designNo stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; NSString *desc = [NSString stringWithUTF8String:(char *) sqlite3_column_text(sqlStatement,7)]; desc = [desc stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; NSString *caption = designNo;//[designNo stringByAppendingString:desc]; caption = [caption stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; NSString *smallFilePath = [documentsPath stringByAppendingPathComponent: [NSString stringWithFormat:@"Small%@.JPG",designNo] ]; smallFilePath = [smallFilePath stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; if ([fileMgr fileExistsAtPath:smallFilePath]){ urlSmallImage = [NSString stringWithFormat:@"Small%@.JPG",designNo]; } NSString *thumbFilePath = [documentsPath stringByAppendingPathComponent: [NSString stringWithFormat:@"Thumb%@.JPG",designNo] ]; thumbFilePath = [thumbFilePath stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; if ([fileMgr fileExistsAtPath:thumbFilePath]){ urlThumbImage = [NSString stringWithFormat:@"Thumb%@.JPG",designNo]; } NSNumber *photoProductId = [NSNumber numberWithInt:(int)sqlite3_column_int(sqlStatement, 0)]; NSNumber *photoPrice = [NSNumber numberWithInt:(int)sqlite3_column_int(sqlStatement, 6)]; char *productNo1 = sqlite3_column_text(sqlStatement, 3); NSString* productNo; if (productNo1 == NULL) productNo = nil; else productNo = [NSString stringWithUTF8String:productNo1]; Photo *jphoto = [[[Photo alloc] initWithCaption:caption urlLarge:[NSString stringWithFormat:@"documents://%@",urlSmallImage] urlSmall:[NSString stringWithFormat:@"documents://%@",urlSmallImage] urlThumb:[NSString stringWithFormat:@"documents://%@",urlThumbImage] size:CGSizeMake(123, 123) productId:photoProductId price:photoPrice description:desc designNo:designNo productNo:productNo ] autorelease]; [photoList addObject:jphoto]; [jphoto release]; } } @catch (NSException *exception) { NSLog(@"An exception occured: %@", [exception reason]); } self.photoSource = [[[MockPhotoSource alloc] initWithType:MockPhotoSourceNormal title:[NSString stringWithFormat: @"%@",title] photos: photoList photos2:nil] autorelease]; } Memory leaks happen when calling above LoadPhotosource method again with different query... I feel its something wrong in declaring NSMutableArray (photoList), but can't figure out how to fix memory leak. Any suggestion is really appreciated.

    Read the article

  • What is the best practice to segment c#.net projects based on a single base project

    - by Anthony
    Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

    Read the article

  • Pass param to a silverlight application

    - by Lucas_Santos
    In my javascript I create my <OBJECT> tag var htmlEmbedSilverlight = "<div id='silverlightControlHost'> " + "<object data='data:application/x-silverlight-2,' type='application/x-silverlight-2' width='550px' height='250px'> " + "<param name='source' value='../../ClientBin/FotoEmprestimoChave.xap'/> " + "<param name='onError' value='onSilverlightError' /> " + "<param name='background' value='white' /> " + "<param name='minRuntimeVersion' value='4.0.60310.0' /> " + "<param name='autoUpgrade' value='true' /> " + "<param name='initparams' values='chave_id=" + data + "' /> " + "<a href='http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0' style='text-decoration:none'> " + "<img src='http://go.microsoft.com/fwlink/?LinkId=161376' alt='Get Microsoft Silverlight' style='border-style:none'/> " + "</a> " + "</object><iframe id='_sl_historyFrame' style='visibility:hidden;height:0px;width:0px;border:0px'></iframe></div>"; $("#tiraFotoSilverlight").html(htmlEmbedSilverlight); This is a reference to my Silverlight application where I call in my Web Application. The problem is my <param name='initparams' values='chave_id=" + data + "' /> " because in my App.xaml in Silverlight, I have the code below private void Application_Startup(object sender, StartupEventArgs e) { if (e.InitParams != null) { foreach (var item in e.InitParams) { this.Resources.Add(item.Key, item.Value); } } this.RootVisual = new MainPage(); } Where InitParams always has Count = 0 and I don't know why. Can someone help me ? I'm just trying to pass a value to my Silverlight application, without a PostBack. Rendered <object width="550px" height="250px" type="application/x-silverlight-2" data="data:application/x-silverlight-2,"> <param value="../../ClientBin/FotoEmprestimoChave.xap" name="source"> <param value="onSilverlightError" name="onError"> <param value="white" name="background"> <param value="4.0.60310.0" name="minRuntimeVersion"> <param value="true" name="autoUpgrade"> <param values="chave_id=1" name="initparams"> <a style="text-decoration:none" href="http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0"> </object>

    Read the article

  • Merge Sort issue when removing the array copy step

    - by Ime Prezime
    I've been having an issue that I couldn't debug for quite some time. I am trying to implement a MergeSort algorithm with no additional steps of array copying by following Robert Sedgewick's algorithm in "Algorithm's in C++" book. Short description of the algorithm: The recursive program is set up to sort b, leaving results in a. Thus, the recursive calls are written to leave their result in b, and we use the basic merge program to merge those files from b into a. In this way, all the data movement is done during the course of the merges. The problem is that I cannot find any logical errors but the sorting isn't done properly. Data gets overwritten somewhere and I cannot determine what logical error causes this. The data is sorted when the program is finished but it is not the same data any more. For example, Input array: { A, Z, W, B, G, C } produces the array: { A, G, W, W, Z, Z }. I can obviously see that it must be a logical error somewhere, but I have been trying to debug this for a pretty long time and I think a fresh set of eyes could maybe see what I'm missing cause I really can't find anything wrong. My code: static const int M = 5; void insertion(char** a, int l, int r) { int i,j; char * temp; for (i = 1; i < r + 1; i++) { temp = a[i]; j = i; while (j > 0 && strcmp(a[j-1], temp) > 0) { a[j] = a[j-1]; j = j - 1; } a[j] = temp; } } //merging a and b into c void merge(char ** c,char ** a, int N, char ** b, int M) { for (int i = 0, j = 0, k = 0; k < N+M; k++) { if (i == N) { c[k] = b[j++]; continue; } if (j == M) { c[k] = a[i++]; continue; } c[k] = strcmp(a[i], b[j]) < 0 ? a[i++] : b[j++]; } } void mergesortAux(char ** a, char ** b, int l, int r) { if(r - l <= M) { insertion(a, l, r); return; } int m = (l + r)/2; mergesortAux(b, a, l, m); //merge sort left mergesortAux(b, a, m+1, r); //merge sort right merge(a+l, b+l, m-l+1, b+m+1, r-m); //merge } void mergesort(char ** a,int l, int r, int size) { static char ** aux = (char**)malloc(size * sizeof(char*)); for(int i = l; i < size; i++) aux[i] = a[i]; mergesortAux(a, aux, l, r); free(aux); }

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

    - by McKev
    I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

    Read the article

< Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >