Search Results

Search found 14548 results on 582 pages for 'const reference'.

Page 541/582 | < Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • Windows phone app xaml error

    - by thewarri0r9
    i am developing an app for windows phone 8 and i stuck on this code which visual studio showing invalid xaml. But Code compiles and works well. Invalid xaml Code is : <DataTemplate x:Key="AddrBookItemTemplate"> <StackPanel Margin="0,0,0,2" Orientation="Horizontal"> <StackPanel Width="80" Orientation="Horizontal" Height="80"> <Ellipse Margin="0" Height="70" Width="70" HorizontalAlignment="Left" Stroke="{x:Null}"> <Ellipse.Fill> <ImageBrush Stretch="Fill" ImageSource="{Binding imageBytes, Converter={StaticResource BytesToImageConverter}}"/> </Ellipse.Fill> </Ellipse> </StackPanel> <StackPanel Height="80" Margin="0" Width="380" HorizontalAlignment="Left"> <TextBlock FontWeight="Bold" Text="{Binding FirstName}" FontFamily="Segoe WP Semibold" FontSize="30" VerticalAlignment="Top" Margin="5,0,0,0" HorizontalAlignment="Left" /> <TextBlock Text="{Binding Phone}" FontFamily="Segoe WP" FontSize="24" Foreground="{StaticResource PhoneTextBoxReadOnlyBrush}" Margin="5,0,0,-12" Width="320" HorizontalAlignment="Left" VerticalAlignment="Top"/> </StackPanel> </StackPanel> </DataTemplate> I am serializing image by converting it to byte, it works fine but if image is null it gives an error. code behind: if (e.Results != null) { List<AddressBook> source = new List<AddressBook>(); foreach (var result in e.Results) { if (result.PhoneNumbers.FirstOrDefault() != null && result.GetPicture()!=null) { BitmapImage bmp = new BitmapImage(); BitmapImage nullbmp = new BitmapImage(); if (result.GetPicture() == null) { bmp.UriSource = new Uri(@"/Images/ci2.png", UriKind.RelativeOrAbsolute); } else { bmp.SetSource(result.GetPicture()); } listobj.Add(new AddressBook() { FirstName = result.DisplayName != null ? result.DisplayName : "", imageBytes = AddressBook.imageConvert(bmp), EmailAddress = "", LastName = "", Phone = result.PhoneNumbers.FirstOrDefault() != null ? result.PhoneNumbers.FirstOrDefault().PhoneNumber : "", }); } } Above code show an error "object reference not set to instance of an object". I want to show the default image (or color) in ellipse when image is null.What should I do?

    Read the article

  • What is the best practice to segment c#.net projects based on a single base project

    - by Anthony
    Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • Spring's JdbcDaoSupport (using MySQL Connector/J) fails after executing sql that adds FK

    - by John
    I am using Spring's JdbcDaoSupport class with a DriverManagerDataSource using the MySQL Connector/J 5.0 driver (driverClassName=com.mysql.jdbc.driver). allowMultiQueries is set to true in the url. My application is an in-house tool we recently developed that executes sql scripts in a directory one-by-one (allows us to re-create our schema and reference table data for a given date, etc, but I digress). The sql scripts sometime contain multiple statements (hence allowMultiQueries), so one script can create a table, add indexes for that table, etc. The problem happens when including a statement to add a foreign key constraint in one of these files. If I have a file that looks like... --(column/constraint names are examples) CREATE TABLE myTable ( fk1 BIGINT(19) NOT NULL, fk2 BIGINT(19) NOT NULL, PRIMARY KEY (fk1, fk2) ); ALTER TABLE myTable ADD CONSTRAINT myTable_fk1 FOREIGN KEY (fk1) REFERENCES myOtherTable (id) ; ALTER TABLE myTable ADD CONSTRAINT myTable_fk2 FOREIGN KEY (fk2) REFERENCES myOtherOtherTable (id) ; then JdbcTemplate.execute throws an UncategorizedSqlException with the following error message and stack trace: Exception in thread "main" org.springframework.jdbc.UncategorizedSQLException: StatementCallback; uncategorized SQLException for SQL [ THE SQL YOU SEE ABOVE LISTED HERE ]; SQL state [HY000]; error code [1005]; Can't create table 'myDatabase.myTable' (errno: 150); nested exception is java.sql.SQLException: Can't create table 'myDatabase.myTable' (errno: 150) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:83) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) and the table and foreign keys are not inserted. Also, especially weird: if I take the foreign key statements out of the script I showed above and then place them in their own script that executes after (so I now have 1 script with just the create table statement, and 1 script with the add foreign key statements that executes after that) then what happens is: tool executes create table script, works fine, table is created tool executes add fk script, throws the same exception as seen above (except errno=121 this time), but the FKs actually get added (!!!) In other words, when the create table/FK statements are in the same script then the exception is thrown and nothing is created, but when they are different scripts a nearly identical exception is thrown but both things get created. Any help on this would be greatly appreciated. Please let me know if you'd like me to clarify anything more.

    Read the article

  • NSMutableArray memory leak when reloading objects

    - by Davin
    I am using Three20/TTThumbsviewcontroller to load photos. I am struggling since quite a some time now to fix memory leak in setting photosource. I am beginner in Object C & iOS memory management. Please have a look at following code and suggest any obvious mistakes or any errors in declaring and releasing variables. -- PhotoViewController.h @interface PhotoViewController : TTThumbsViewController <UIPopoverControllerDelegate,CategoryPickerDelegate,FilterPickerDelegate,UISearchBarDelegate>{ ...... NSMutableArray *_photoList; ...... @property(nonatomic,retain) NSMutableArray *photoList; -- PhotoViewController.m @implementation PhotoViewController .... @synthesize photoList; ..... - (void)LoadPhotoSource:(NSString *)query:(NSString *)title:(NSString* )stoneName{ NSLog(@"log- in loadPhotosource method"); if (photoList == nil) photoList = [[NSMutableArray alloc] init ]; [photoList removeAllObjects]; @try { sqlite3 *db; NSFileManager *fileMgr = [NSFileManager defaultManager]; NSString* documentsPath = [NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES) objectAtIndex:0]; NSString *dbPath = [documentsPath stringByAppendingPathComponent: @"DB.s3db"]; BOOL success = [fileMgr fileExistsAtPath:dbPath]; if(!success) { NSLog(@"Cannot locate database file '%@'.", dbPath); } if(!(sqlite3_open([dbPath UTF8String], &db) == SQLITE_OK)) { NSLog(@"An error has occured."); } NSString *_sql = query;//[NSString stringWithFormat:@"SELECT * FROM Products where CategoryId = %i",[categoryId integerValue]]; const char *sql = [_sql UTF8String]; sqlite3_stmt *sqlStatement; if(sqlite3_prepare(db, sql, -1, &sqlStatement, NULL) != SQLITE_OK) { NSLog(@"Problem with prepare statement"); } if ([stoneName length] != 0) { NSString *wildcardSearch = [NSString stringWithFormat:@"%@%%",[stoneName stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]]; sqlite3_bind_text(sqlStatement, 1, [wildcardSearch UTF8String], -1, SQLITE_STATIC); } while (sqlite3_step(sqlStatement)==SQLITE_ROW) { NSString* urlSmallImage = @"Mahallati_NoImage.png"; NSString* urlThumbImage = @"Mahallati_NoImage.png"; NSString *designNo = [NSString stringWithUTF8String:(char *) sqlite3_column_text(sqlStatement,2)]; designNo = [designNo stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; NSString *desc = [NSString stringWithUTF8String:(char *) sqlite3_column_text(sqlStatement,7)]; desc = [desc stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; NSString *caption = designNo;//[designNo stringByAppendingString:desc]; caption = [caption stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; NSString *smallFilePath = [documentsPath stringByAppendingPathComponent: [NSString stringWithFormat:@"Small%@.JPG",designNo] ]; smallFilePath = [smallFilePath stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; if ([fileMgr fileExistsAtPath:smallFilePath]){ urlSmallImage = [NSString stringWithFormat:@"Small%@.JPG",designNo]; } NSString *thumbFilePath = [documentsPath stringByAppendingPathComponent: [NSString stringWithFormat:@"Thumb%@.JPG",designNo] ]; thumbFilePath = [thumbFilePath stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]]; if ([fileMgr fileExistsAtPath:thumbFilePath]){ urlThumbImage = [NSString stringWithFormat:@"Thumb%@.JPG",designNo]; } NSNumber *photoProductId = [NSNumber numberWithInt:(int)sqlite3_column_int(sqlStatement, 0)]; NSNumber *photoPrice = [NSNumber numberWithInt:(int)sqlite3_column_int(sqlStatement, 6)]; char *productNo1 = sqlite3_column_text(sqlStatement, 3); NSString* productNo; if (productNo1 == NULL) productNo = nil; else productNo = [NSString stringWithUTF8String:productNo1]; Photo *jphoto = [[[Photo alloc] initWithCaption:caption urlLarge:[NSString stringWithFormat:@"documents://%@",urlSmallImage] urlSmall:[NSString stringWithFormat:@"documents://%@",urlSmallImage] urlThumb:[NSString stringWithFormat:@"documents://%@",urlThumbImage] size:CGSizeMake(123, 123) productId:photoProductId price:photoPrice description:desc designNo:designNo productNo:productNo ] autorelease]; [photoList addObject:jphoto]; [jphoto release]; } } @catch (NSException *exception) { NSLog(@"An exception occured: %@", [exception reason]); } self.photoSource = [[[MockPhotoSource alloc] initWithType:MockPhotoSourceNormal title:[NSString stringWithFormat: @"%@",title] photos: photoList photos2:nil] autorelease]; } Memory leaks happen when calling above LoadPhotosource method again with different query... I feel its something wrong in declaring NSMutableArray (photoList), but can't figure out how to fix memory leak. Any suggestion is really appreciated.

    Read the article

  • Unset/Change Binding in WPF

    - by captcalamares
    How can I unset the binding applied to an object so that I can apply another binding to it from a different location? Suppose I have two data templates binded to the same object reference. Data Template #1 is the default template to be loaded. I try to bind a button command to a Function1 from my DataContext class: <Button Content="Button 1" CommandParameter="{Binding }" Command="{Binding DataContext.Function1, RelativeSource={RelativeSource AncestorType={x:Type Window}}}"/> This actually works and the function gets binded. However, when I try to load Data Template # 2 to the same object (while trying to bind another button command to a different function (Function2) from my DataContext class): <Button Content="Button 2" CommandParameter="{Binding }" Command="{Binding DataContext.Function2, RelativeSource={RelativeSource AncestorType={x:Type Window}}}" /> It doesn't work and the first binding is still the one executed. Is there a workaround to this? EDIT (for better problem context): I defined my templates in my Window.Resources: <Window.Resources> <DataTemplate DataType="{x:Type local:ViewModel1}"> <local:View1 /> </DataTemplate> <DataTemplate DataType="{x:Type local:ViewModel2}"> <local:View2 /> </DataTemplate> </Window.Resources> The View1.xaml and the View2.xaml contain the button definitions that I described above (I want them to command the control of my process flow). ViewModel1 and ViewModel2 are my ViewModels that implement the interface IPageViewModel which is the type of my variable CurrentPageViewModel. In my XAML, I binded ContentControl to the variable CurrentPageViewModel: <ContentControl Content="{Binding CurrentPageViewModel}" HorizontalAlignment="Center"/> In my .CS, I have a list defined as List<IPageViewModel> PageViewModels, which I use to contain the instances of my two View Models: PageViewModels.Add(new ViewModel1()); PageViewModels.Add(new ViewModel2()); // Set starting page CurrentPageViewModel = PageViewModels[0]; When I try to change my CurrentPageViewModel to the other view model, this is when I want the new binding to work. Unfortunately, it doesn't. Am I doing things the right way?

    Read the article

  • initializing a vector of custom class in c++

    - by Flamewires
    Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • C++ file input/output search

    - by Brian J
    Hi I took the following code from a program I'm writing to check a user generated string against a dictionary as well as other validation. My problem is that although my dictionary file is referenced correctly,the program gives the default "no dictionary found".I can't see clearly what I'm doing in error here,if anyone has any tips or pointers it would be appreciated, Thanks. //variables for checkWordInFile #define gC_FOUND 99 #define gC_NOT_FOUND -99 // static bool certifyThat(bool condition, const char* error) { if(!condition) printf("%s", error); return !condition; } //method to validate a user generated password following password guidelines. void validatePass() { FILE *fptr; char password[MAX+1]; int iChar,iUpper,iLower,iSymbol,iNumber,iTotal,iResult,iCount; //shows user password guidelines printf("\n\n\t\tPassword rules: "); printf("\n\n\t\t 1. Passwords must be at least 9 characters long and less than 15 characters. "); printf("\n\n\t\t 2. Passwords must have at least 2 numbers in them."); printf("\n\n\t\t 3. Passwords must have at least 2 uppercase letters and 2 lowercase letters in them."); printf("\n\n\t\t 4. Passwords must have at least 1 symbol in them (eg ?, $, £, %)."); printf("\n\n\t\t 5. Passwords may not have small, common words in them eg hat, pow or ate."); //gets user password input get_user_password: printf("\n\n\t\tEnter your password following password rules: "); scanf("%s", &password); iChar = countLetters(password,&iUpper,&iLower,&iSymbol,&iNumber,&iTotal); iUpper = countLetters(password,&iUpper,&iLower,&iSymbol,&iNumber,&iTotal); iLower =countLetters(password,&iUpper,&iLower,&iSymbol,&iNumber,&iTotal); iSymbol =countLetters(password,&iUpper,&iLower,&iSymbol,&iNumber,&iTotal); iNumber = countLetters(password,&iUpper,&iLower,&iSymbol,&iNumber,&iTotal); iTotal = countLetters(password,&iUpper,&iLower,&iSymbol,&iNumber,&iTotal); if(certifyThat(iUpper >= 2, "Not enough uppercase letters!!!\n") || certifyThat(iLower >= 2, "Not enough lowercase letters!!!\n") || certifyThat(iSymbol >= 1, "Not enough symbols!!!\n") || certifyThat(iNumber >= 2, "Not enough numbers!!!\n") || certifyThat(iTotal >= 9, "Not enough characters!!!\n") || certifyThat(iTotal <= 15, "Too many characters!!!\n")) goto get_user_password; iResult = checkWordInFile("dictionary.txt", password); if(certifyThat(iResult != gC_FOUND, "Password contains small common 3 letter word/s.")) goto get_user_password; iResult = checkWordInFile("passHistory.txt",password); if(certifyThat(iResult != gC_FOUND, "Password contains previously used password.")) goto get_user_password; printf("\n\n\n Your new password is verified "); printf(password); //writing password to passHistroy file. fptr = fopen("passHistory.txt", "w"); // create or open the file for( iCount = 0; iCount < 8; iCount++) { fprintf(fptr, "%s\n", password[iCount]); } fclose(fptr); printf("\n\n\n"); system("pause"); }//end validatePass method int checkWordInFile(char * fileName,char * theWord){ FILE * fptr; char fileString[MAX + 1]; int iFound = -99; //open the file fptr = fopen(fileName, "r"); if (fptr == NULL) { printf("\nNo dictionary file\n"); printf("\n\n\n"); system("pause"); return (0); // just exit the program } /* read the contents of the file */ while( fgets(fileString, MAX, fptr) ) { if( 0 == strcmp(theWord, fileString) ) { iFound = -99; } } fclose(fptr); return(0); }//end of checkwORDiNFile

    Read the article

  • Filling in gaps for outlines

    - by user146780
    I'm using an algorithm to generate quads. These become outlines. The algorithm is: void OGLENGINEFUNCTIONS::GenerateLinePoly(const std::vector<std::vector<GLdouble>> &input, std::vector<GLfloat> &output, int width) { output.clear(); if(input.size() < 2) { return; } int temp; float dirlen; float perplen; POINTFLOAT start; POINTFLOAT end; POINTFLOAT dir; POINTFLOAT ndir; POINTFLOAT perp; POINTFLOAT nperp; POINTFLOAT perpoffset; POINTFLOAT diroffset; POINTFLOAT p0, p1, p2, p3; for(unsigned int i = 0; i < input.size() - 1; ++i) { start.x = static_cast<float>(input[i][0]); start.y = static_cast<float>(input[i][1]); end.x = static_cast<float>(input[i + 1][0]); end.y = static_cast<float>(input[i + 1][1]); dir.x = end.x - start.x; dir.y = end.y - start.y; dirlen = sqrt((dir.x * dir.x) + (dir.y * dir.y)); ndir.x = static_cast<float>(dir.x * 1.0 / dirlen); ndir.y = static_cast<float>(dir.y * 1.0 / dirlen); perp.x = dir.y; perp.y = -dir.x; perplen = sqrt((perp.x * perp.x) + (perp.y * perp.y)); nperp.x = static_cast<float>(perp.x * 1.0 / perplen); nperp.y = static_cast<float>(perp.y * 1.0 / perplen); perpoffset.x = static_cast<float>(nperp.x * width * 0.5); perpoffset.y = static_cast<float>(nperp.y * width * 0.5); diroffset.x = static_cast<float>(ndir.x * 0 * 0.5); diroffset.y = static_cast<float>(ndir.y * 0 * 0.5); // p0 = start + perpoffset - diroffset //p1 = start - perpoffset - diroffset //p2 = end + perpoffset + diroffset // p3 = end - perpoffset + diroffset p0.x = start.x + perpoffset.x - diroffset.x; p0.y = start.y + perpoffset.y - diroffset.y; p1.x = start.x - perpoffset.x - diroffset.x; p1.y = start.y - perpoffset.y - diroffset.y; p2.x = end.x + perpoffset.x + diroffset.x; p2.y = end.y + perpoffset.y + diroffset.y; p3.x = end.x - perpoffset.x + diroffset.x; p3.y = end.y - perpoffset.y + diroffset.y; output.push_back(p2.x); output.push_back(p2.y); output.push_back(p0.x); output.push_back(p0.y); output.push_back(p1.x); output.push_back(p1.y); output.push_back(p3.x); output.push_back(p3.y); } } The problem is that there are then gaps as seen here: http://img816.imageshack.us/img816/2882/eeekkk.png There must be a way to fix this. I see a pattern but I just cant figure it out. There must be a way to fill the missing inbetweens. Thanks

    Read the article

  • Programmatically Binding to a Property

    - by M312V
    I know it's a generic title, but my question is specific. I think it will boil down to a question of practice. So, I have the following code: public class Component : UIElement { public Component() { this.InputBindings.Add(new MouseBinding(SomeCommandProperty, new MouseGesture(MouseAction.LeftClick))); } } I could easily aggregate the ViewModel that owns SomeCommandProperty into the Component class, but I'm currently waiving that option assuming there is another way. Component is a child of ComponentCollection which is child of a Grid which DataContext is the ViewModel. ComponentCollection as the name suggests contains a collection of Components. <Grid Name="myGrid"> <someNamespace:ComponentCollection x:Name="componentCollection"/> </Grid> It's the same scenario as the XAML below, but with TextBlock. I guess I'm trying to replicate what's being done in the XAML below programatically. Again, Component's top most ancestor's DataContext is set to ViewModel. <Grid Name="myGrid"> <TextBlock Text="SomeText"> <TextBlock.InputBindings> <MouseBinding Command="{Binding SomeCommandProperty}" MouseAction="LeftClick" /> </TextBlock.InputBindings> </TextBlock> </Grid> Update 1 Sorry, I'm unable to comment because I lack the reputation points. Basically, I have a custom control which inherit from a Panel which children are a collection of Component. It's not a hack, like I've mentioned, I could directly have access to SomeCommandProperty If I aggregate the ViewModel into Component. Doing so, however, feels icky. That is, having direct access to ViewModel from a Model. I guess the question I'm asking is. Given the situation that Component's parent UIElement's DataContext is set to ViewModel, is it possible to access SomeCommandProperty without Component owning a reference to the ViewModel that owns SomeCommandProperty? Programatically, that is. Using ItemsControl doesn't change the fact that I still need to bind SomeCommandProperty to each Items.

    Read the article

  • Pass param to a silverlight application

    - by Lucas_Santos
    In my javascript I create my <OBJECT> tag var htmlEmbedSilverlight = "<div id='silverlightControlHost'> " + "<object data='data:application/x-silverlight-2,' type='application/x-silverlight-2' width='550px' height='250px'> " + "<param name='source' value='../../ClientBin/FotoEmprestimoChave.xap'/> " + "<param name='onError' value='onSilverlightError' /> " + "<param name='background' value='white' /> " + "<param name='minRuntimeVersion' value='4.0.60310.0' /> " + "<param name='autoUpgrade' value='true' /> " + "<param name='initparams' values='chave_id=" + data + "' /> " + "<a href='http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0' style='text-decoration:none'> " + "<img src='http://go.microsoft.com/fwlink/?LinkId=161376' alt='Get Microsoft Silverlight' style='border-style:none'/> " + "</a> " + "</object><iframe id='_sl_historyFrame' style='visibility:hidden;height:0px;width:0px;border:0px'></iframe></div>"; $("#tiraFotoSilverlight").html(htmlEmbedSilverlight); This is a reference to my Silverlight application where I call in my Web Application. The problem is my <param name='initparams' values='chave_id=" + data + "' /> " because in my App.xaml in Silverlight, I have the code below private void Application_Startup(object sender, StartupEventArgs e) { if (e.InitParams != null) { foreach (var item in e.InitParams) { this.Resources.Add(item.Key, item.Value); } } this.RootVisual = new MainPage(); } Where InitParams always has Count = 0 and I don't know why. Can someone help me ? I'm just trying to pass a value to my Silverlight application, without a PostBack. Rendered <object width="550px" height="250px" type="application/x-silverlight-2" data="data:application/x-silverlight-2,"> <param value="../../ClientBin/FotoEmprestimoChave.xap" name="source"> <param value="onSilverlightError" name="onError"> <param value="white" name="background"> <param value="4.0.60310.0" name="minRuntimeVersion"> <param value="true" name="autoUpgrade"> <param values="chave_id=1" name="initparams"> <a style="text-decoration:none" href="http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0"> </object>

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • cellForRowAtIndexPath called too late

    - by Mihai Fonoage
    Hi, I am trying to re-load a table every time some data I get from the web is available. This is what I have: SearchDataViewController: - (void)parseDatatXML { parsingDelegate = [[XMLParsingDelegate alloc] init]; parsingDelegate.searchDataController = self; // CONTAINS THE TABLE THAT NEEDS RE-LOADING; ImplementedSearchViewController *searchController = [[ImplementedSearchViewController alloc] initWithNibName:@"ImplementedSearchView" bundle:nil]; ProjectAppDelegate *delegate = [[UIApplication sharedApplication] delegate]; UINavigationController *nav = (UINavigationController *)[delegate.splitViewController.viewControllers objectAtIndex: 0]; NSArray *viewControllers = [[NSArray alloc] initWithObjects:nav, searchController, nil]; self.splitViewController.viewControllers = viewControllers; [viewControllers release]; // PASS A REFERENCE TO THE PARSING DELEGATE SO THAT IT CAN CALL reloadData on the table parsingDelegate.searchViewController = searchController; [searchController release]; // Build the url request used to fetch data ... NSURLRequest *dataURLRequest = [NSURLRequest requestWithURL:[NSURL URLWithString:dataURL]]; parsingDelegate.feedConnection = [[[NSURLConnection alloc] initWithRequest:dataURLRequest delegate:parsingDelegate] autorelease]; } ImplementedSearchViewController: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSLog(@"count = %d", [keys count]); // keys IS A NSMutableArray return [self.keys count]; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { ... cell.textLabel.text = [keys objectAtIndex:row]; ... } XMLParsingDelgate: -(void) updateSearchTable:(NSArray *)array { ... [self.currentParseBatch addObject:(NSString *)[array objectAtIndex:1]]; // RELOAD TABLE [self.searchViewController.table reloadData]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qualifiedName attributes:(NSDictionary *)attributeDict { if ([elementName isEqualToString:@"..."]) { self.currentParseBatch = [NSMutableArray array]; searchViewController.keys = self.currentParseBatch; ... } ... } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if ([elementName isEqualToString:@"..."]) { ... [self performSelectorOnMainThread:@selector(updateSearchTable:) withObject:array waitUntilDone:NO]; } ... } My problem is that when I debug, the calls go between reloadData and numberOfRowsInSection until the keys array is filled with the last data, time at which the cellForRowAtIndexPath gets called. I wanted the table to be updated for each element I send, one by one, instead of just in the end. Any ideas why this behavior? Thank you!

    Read the article

  • Exit code 3 (not my return value, looking for source)

    - by Kathoz
    Greetings, my program exits with the code 3. No error messages, no exceptions, and the exit is not initiated by my code. The problem occurs when I am trying to read extremely long integer values from a text file (the text file is present and correctly opened, with successful prior reading). I am using very large amounts of memory (in fact, I think that this might be the cause, as I am nearly sure I go over the 2GB per process memory limit). I am also using the GMP (or, rather, MPIR) library to multiply bignums. I am fairly sure that this is not a file I/O problem as I got the same error code on a previous program version that was fully in-memory. System: MS Visual Studio 2008 MS Windows Vista Home Premium x86 MPIR 2.1.0 rc2 4GB RAM Where might this error code originate from? EDIT: this is the procedure that exits with the code void condenseBinSplitFile(const char *sourceFilename, int partCount){ //condense results file into final P and Q std::string tempFilename; std::string inputFilename(sourceFilename); std::string outputFilename(BIN_SPLIT_FILENAME_DATA2); mpz_class *P = new mpz_class(0); mpz_class *Q = new mpz_class(0); mpz_class *PP = new mpz_class(0); mpz_class *QQ = new mpz_class(0); FILE *sourceFile; FILE *resultFile; fpos_t oldPos; int swapCount = 0; while (partCount > 1){ std::cout << partCount << std::endl; sourceFile = fopen(inputFilename.c_str(), "r"); resultFile = fopen(outputFilename.c_str(), "w"); for (int i=0; i<partCount/2; i++){ //Multiplication order: //Get Q, skip P //Get QQ, mul Q and QQ, print Q, delete Q //Jump back to P, get P //Mul P and QQ, delete QQ //Skip QQ, get PP //Mul P and PP, delete P and PP //Get Q, skip P mpz_inp_str(Q->get_mpz_t(), sourceFile, CALC_BASE); fgetpos(sourceFile, &oldPos); skipLine(sourceFile); skipLine(sourceFile); //Get QQ, mul Q and QQ, print Q, delete Q mpz_inp_str(QQ->get_mpz_t(), sourceFile, CALC_BASE); (*Q) *= (*QQ); mpz_out_str(resultFile, CALC_BASE, Q->get_mpz_t()); fputc('\n', resultFile); (*Q) = 0; //Jump back to P, get P fsetpos(sourceFile, &oldPos); mpz_inp_str(P->get_mpz_t(), sourceFile, CALC_BASE); //Mul P and QQ, delete QQ (*P) *= (*QQ); (*QQ) = 0; //Skip QQ, get PP skipLine(sourceFile); skipLine(sourceFile); mpz_inp_str(PP->get_mpz_t(), sourceFile, CALC_BASE); //Mul P and PP, delete PP, print P, delete P (*P) += (*PP); (*PP) = 0; mpz_out_str(resultFile, CALC_BASE, P->get_mpz_t()); fputc('\n', resultFile); (*P) = 0; } partCount /= 2; fclose(sourceFile); fclose(resultFile); //swap filenames tempFilename = inputFilename; inputFilename = outputFilename; outputFilename = tempFilename; swapCount++; } delete P; delete Q; delete PP; delete QQ; remove(BIN_SPLIT_FILENAME_RESULTS); if (swapCount%2 == 0) rename(sourceFilename, BIN_SPLIT_FILENAME_RESULTS); else rename(BIN_SPLIT_FILENAME_DATA2, BIN_SPLIT_FILENAME_RESULTS); }

    Read the article

  • Using VBA / Macro to highlight changes in excel

    - by Zaj
    I have a spread sheet that I send out to various locations to have information on it updated and then sent back to me. However, I had to put validation and lock the cells to force users to input accurate information. Then I can to use VBA to disable the work around of cut copy and paste functions. And additionally I inserted a VBA function to force users to open the excel file in Macros. Now I'm trying to track the changes so that I know what was updated when I recieve the sheet back. However everytime i do this I get an error when someone savesthe document and randomly it will lock me out of the document completely. I have my code pasted below, can some one help me create code in the VBA forum to highlight changes instead of through excel's share/track changes option? ThisWorkbook (Code): Option Explicit Const WelcomePage = "Macros" Private Sub Workbook_BeforeClose(Cancel As Boolean) Call ToggleCutCopyAndPaste(True) 'Turn off events to prevent unwanted loops Application.EnableEvents = False 'Evaluate if workbook is saved and emulate default propmts With ThisWorkbook If Not .Saved Then Select Case MsgBox("Do you want to save the changes you made to '" & .Name & "'?", _ vbYesNoCancel + vbExclamation) Case Is = vbYes 'Call customized save routine Call CustomSave Case Is = vbNo 'Do not save Case Is = vbCancel 'Set up procedure to cancel close Cancel = True End Select End If 'If Cancel was clicked, turn events back on and cancel close, 'otherwise close the workbook without saving further changes If Not Cancel = True Then .Saved = True Application.EnableEvents = True .Close savechanges:=False Else Application.EnableEvents = True End If End With End Sub Private Sub Workbook_BeforeSave(ByVal SaveAsUI As Boolean, Cancel As Boolean) 'Turn off events to prevent unwanted loops Application.EnableEvents = False 'Call customized save routine and set workbook's saved property to true '(To cancel regular saving) Call CustomSave(SaveAsUI) Cancel = True 'Turn events back on an set saved property to true Application.EnableEvents = True ThisWorkbook.Saved = True End Sub Private Sub Workbook_Open() Call ToggleCutCopyAndPaste(False) 'Unhide all worksheets Application.ScreenUpdating = False Call ShowAllSheets Application.ScreenUpdating = True End Sub Private Sub CustomSave(Optional SaveAs As Boolean) Dim ws As Worksheet, aWs As Worksheet, newFname As String 'Turn off screen flashing Application.ScreenUpdating = False 'Record active worksheet Set aWs = ActiveSheet 'Hide all sheets Call HideAllSheets 'Save workbook directly or prompt for saveas filename If SaveAs = True Then newFname = Application.GetSaveAsFilename( _ fileFilter:="Excel Files (*.xls), *.xls") If Not newFname = "False" Then ThisWorkbook.SaveAs newFname Else ThisWorkbook.Save End If 'Restore file to where user was Call ShowAllSheets aWs.Activate 'Restore screen updates Application.ScreenUpdating = True End Sub Private Sub HideAllSheets() 'Hide all worksheets except the macro welcome page Dim ws As Worksheet Worksheets(WelcomePage).Visible = xlSheetVisible For Each ws In ThisWorkbook.Worksheets If Not ws.Name = WelcomePage Then ws.Visible = xlSheetVeryHidden Next ws Worksheets(WelcomePage).Activate End Sub Private Sub ShowAllSheets() 'Show all worksheets except the macro welcome page Dim ws As Worksheet For Each ws In ThisWorkbook.Worksheets If Not ws.Name = WelcomePage Then ws.Visible = xlSheetVisible Next ws Worksheets(WelcomePage).Visible = xlSheetVeryHidden End Sub Private Sub Workbook_Activate() Call ToggleCutCopyAndPaste(False) End Sub Private Sub Workbook_Deactivate() Call ToggleCutCopyAndPaste(True) End Sub This is in my ModuleCode: Option Explicit Sub ToggleCutCopyAndPaste(Allow As Boolean) 'Activate/deactivate cut, copy, paste and pastespecial menu items Call EnableMenuItem(21, Allow) ' cut Call EnableMenuItem(19, Allow) ' copy Call EnableMenuItem(22, Allow) ' paste Call EnableMenuItem(755, Allow) ' pastespecial 'Activate/deactivate drag and drop ability Application.CellDragAndDrop = Allow 'Activate/deactivate cut, copy, paste and pastespecial shortcut keys With Application Select Case Allow Case Is = False .OnKey "^c", "CutCopyPasteDisabled" .OnKey "^v", "CutCopyPasteDisabled" .OnKey "^x", "CutCopyPasteDisabled" .OnKey "+{DEL}", "CutCopyPasteDisabled" .OnKey "^{INSERT}", "CutCopyPasteDisabled" Case Is = True .OnKey "^c" .OnKey "^v" .OnKey "^x" .OnKey "+{DEL}" .OnKey "^{INSERT}" End Select End With End Sub Sub EnableMenuItem(ctlId As Integer, Enabled As Boolean) 'Activate/Deactivate specific menu item Dim cBar As CommandBar Dim cBarCtrl As CommandBarControl For Each cBar In Application.CommandBars If cBar.Name <> "Clipboard" Then Set cBarCtrl = cBar.FindControl(ID:=ctlId, recursive:=True) If Not cBarCtrl Is Nothing Then cBarCtrl.Enabled = Enabled End If Next End Sub Sub CutCopyPasteDisabled() 'Inform user that the functions have been disabled MsgBox " Cutting, copying and pasting have been disabled in this workbook. Please hard key in data. " End Sub

    Read the article

  • NHibernate and objects with value-semantics

    - by Groo
    Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

    Read the article

< Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >