Search Results

Search found 15385 results on 616 pages for 'browser compatibility'.

Page 585/616 | < Previous Page | 581 582 583 584 585 586 587 588 589 590 591 592  | Next Page >

  • jQuery tablesorter - loss of functionality after AJAX call

    - by Nick
    I have recently been experimenting with the tablesorter plugin for jQuery. I have successfully got it up and running in once instance, and am very impressed. However, I have tried to apply the tablesorter to a different table, only to encounter some difficulties... Basically the table causing a problem has a <ul> above it which acts as a set of tabs for the table. so if you click one of these tabs, an AJAX call is made and the table is repopulated with the rows relevant to the specific tab clicked. When the page initially loads (i.e. before a tab has been clicked) the tablesorter functionality works exactly as expected. But when a tab is clicked and the table repopulated, the functionality disappears, rendering it without the sortable feature. Even if you go back to the original tab, after clicking another, the functionality does not return - the only way to do so is a physical refresh of the page in the browser. I have seen a solution which seems similar to my problem on this site, and someone recommends using the jQuery plugin, livequery. I have tried this but to no avail :-( If someone has any suggestions I would be most appreciative. I can post code snippets if it would help (though I know the instantiation code for tablesorter is fine as it works on tables with no tabs - so it's definitely not that!) EDIT: As requested, here are some code snippets: The table being sorted is <table id="#sortableTable#">..</table>, the instantiation code for tablesorter I am using is: $(document).ready(function() { $("#sortableTable").tablesorter( { headers: //disable any headers not worthy of sorting! { 0: { sorter: false }, 5: { sorter: false } }, sortMultiSortKey: 'ctrlKey', debug:true, widgets: ['zebra'] }); }); And I tried to rig up livequery as follows: $("#sortableTable").livequery(function(){ $(this).tablesorter(); }); This has not helped though... I am not sure whether I should use the id of the table with livequery as it is the click on the <ul> I should be responding to, which is of course not part of the table itself. I have tried a number of variations in the hope that one of them will help, but to no avail :-(

    Read the article

  • flickr.photos.search strange behavior with nested xml response

    - by JohnIdol
    I am querying flickr with the following request: view-source:http://www.flickr.com/services/rest/?method=flickr.photos.search&api_key=MY_KEY&text=cork&per_page=12&&format=rest if I put the above url in the browser I get the following as I would expect: <rsp stat="ok"> <photos page="1" pages="22661" perpage="12" total="271924"> <photo id="4587565363" owner="46277999@N05" secret="717118838d" server="4029" farm="5" title="06052010(001)" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587466773" owner="25901874@N06" secret="32c5a1a57f" server="4002" farm="5" title="black wine cork 2 BW" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4588084730" owner="25901874@N06" secret="b27eef5635" server="4032" farm="5" title="black wine cork 2" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587457789" owner="43115275@N00" secret="ae0daa0ab6" server="4034" farm="5" title="Matthew" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587443837" owner="49967920@N07" secret="2b4c1a58de" server="4066" farm="5" title="Two car garage" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4588050906" owner="45827769@N06" secret="72de138f7e" server="4067" farm="5" title="Dabie Mountains, Central China" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587979300" owner="36531359@N00" secret="e5f8b30734" server="3299" farm="4" title="stroll" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587304769" owner="7904649@N02" secret="995062f550" server="4034" farm="5" title="IMG_4325" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587306827" owner="7904649@N02" secret="b92d7ff916" server="4050" farm="5" title="IMG_4329" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587311657" owner="7904649@N02" secret="bb1b34ccf8" server="4053" farm="5" title="IMG_4336" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587933110" owner="7904649@N02" secret="f733b1d482" server="3300" farm="4" title="IMG_4334" ispublic="1" isfriend="0" isfamily="0" /> <photo id="4587930650" owner="7904649@N02" secret="9bc202b3ed" server="4018" farm="5" title="IMG_4331" ispublic="1" isfriend="0" isfamily="0" /> </photos> </rsp> Now I've got something very simple PHP to query the exact same url, called from javascript through AJAX - it all works as I can see putting a breakpoint in my javascript function that handles the response: function HandleResponse(response) { document.getElementById('ResponseDiv').innerHTML = response; } Looking at response value in the snippet above I see what I expect (xml formed as above) - then the strangest thing happens: when I inspect the DOM instead of having photo elements all as children of photos they're all nested within each other. What amI missing - How is this possible in light of the fact that the response string is definitely formed as I would expect it to be?

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • Cannot Call WordPress Plugin Files Under wp-content

    - by Volomike
    I have a client who has many blog customers. Each of these WordPress blogs calls a plugin that provides a product link. The way that link is composed looks like this: {website}/wp-content/plugins/prodx/product?id=432320 This works fine on all blogs except two. On those two, when you try to call the URL, you get a 404. So, I disabled all plugins except prodx and reverted the theme to default (Kubrick), thinking perhaps a plugin intercept with add_action() API was doing this, such as intercepting URLs and redirecting them. However, this did not help. So, I upgraded the WordPress to the latest version. Again, didn't fix. So, I checked permissions, comparing with a blog that worked just fine. Again, didn't fix. So I replaced the .htaccess, using one from a working blog. Again, didn't fix. So I replaced all the files using some from a working blog that was identical to this one, and then restored the wp-config.php file back so that it talked to the right blog database. Again, didn't fix. Again I checked permissions meticulously, comparing to a perfectly working blog. Again, didn't fix. So, I created a test.php that looks like so: <?php print_r($_GET); echo "hello world"; I then copied it into another plugin folder and used my browser to get to it -- again, 404. So I copied it into the root of wp-content/plugins and tried to call it there -- again, 404. So I copied it into wp-content -- again, 404. Last, I copied it into the root of the WordPress blog website, and this time, it worked! Doesn't make sense. I started to think that perhaps something was going on with /etc/httpd/conf/httpd.conf for this customer, but the only thing I saw different in their for this customer was the IP address was different than the customer's blog that worked. Each customer gets their own IP in this environment my client has built. My client sysop is baffled too. What do you think is going on? Is there something wrong in the WP database for this customer? Is there something wrong in httpd.conf?

    Read the article

  • JQuery - Pass variables to PHP script via AJAX call and then display file

    - by hfidgen
    Hiya, I'm trying to generate Outlook event files for my events, doing so on the fly as and when someone requests it by pressing a link on the page. Here's what i've got so far, but I can't find out how to get the browser to download the content which is returned. I know how I could do this if I sent everything via _GET, but I'd prefer to do it via _POST, hence I'm going down this route.. Any thoughts? Thanks! HTML / Javascript <script> $(function() { $(".button").click(function() { // validate and process form // first hide any error messages var start = $("input#start").val(); var end = $("input#end").val(); var dataString = 'start='+ start + '&end=' + end; $.ajax({ type: "POST", url: "/calendar.php", data: dataString, success: function(data) { //Need to return the file contents somehow! } }); return false; }); }); </script> <form name="calendar" method="post" action=""> <input type="hidden" name="start" id="start" value="<?php echo $start; ?>" /> <input type="hidden" name="end" id="end" value="<?php echo $end; ?>" /> <input type="submit" name="submit" class="button" id="submit_btn" value="Outlook" /> </fieldset> </form> PHP File <?php if (isset($_POST['start'])) { $start = $_POST['start']; $end = $_POST['end']; $c = header("Content-Type: text/Calendar"); $c .= header("Content-Disposition: inline; filename=calendar.ics"); $c .= "BEGIN:VCALENDAR\n"; $c .= "VERSION:2.0\n"; $c .= "PRODID:-//xxxyyyy//NONSGML //EN\n"; $c .= "METHOD:REQUEST\n"; // requied by Outlook $c .= "BEGIN:VEVENT\n"; $c .= "UID:". $start . $end ."-" . "-xxxxyyyy.com\n"; // required by Outlook $c .= "DTSTAMP:".date('Ymd').'T'.date('His')."\n"; // required by Outlook $c .= "DTSTART:20080413T000000\n"; $c .= "SUMMARY:" . "\n"; $c .= "DESCRIPTION:" . "\n"; $c .= "END:VEVENT\n"; $c .= "END:VCALENDAR\n"; echo $c; } else { echo "Sorry you can't access this page directly"; } ?>

    Read the article

  • Can mono produce valid xhtml?

    - by z-boss
    I installed Mono and MonoDevelop 2.2 on my Windows PC. Created a default C# ASP.NET Web Application project. Here's the Default.aspx it created: <%@ Page Language="C#" Inherits="test.Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html> <head runat="server"> <title>Default</title> </head> <body> <form id="form1" runat="server"> <asp:Button id="button1" runat="server" Text="Click me!" OnClick="button1Clicked" /> </form> </body> </html> When I run it it feeds this html to the browser: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html> <head><title> Default </title></head> <body> <form name="form1" method="post" action="Default.aspx" id="form1"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKMTQ2OTkzNDMyMWRkjWseIg+2HCgaNiY+XHmVKEq/CFg=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWAgLB5qLABwKs34rGBvJAYc3UJn3AcjSPjq8DVpMxclAk" /> </div> <input type="submit" name="button1" value="Click me!" id="button1" /> </form> </body> </html> XHTML validation fails with 3 errors: 1. Line 3, Column 1: Missing xmlns attribute for element html. The value should be: http://www.w3.org/1999/xhtml 2. Line 8, Column 13: there is no attribute "name" 3. Line 17, Column 71: document type does not allow element "input" here; missing one of "p", "h1", "h2", "h3", "h4", "h5", "h6", "div", "pre", "address", "fieldset", "ins", "del" start-tag Is there some setting I'm missing?

    Read the article

  • Android pluginable application

    - by Alxandr
    I've been trying to create an android-application the last couple of weeks, and mostly everything has worked out great, but there is one thing that I was wondering about, and that is pluginability trough the use of intents. What I'm trying to create is basically a comic-reader. As of the version I use now, I open the application and get a list of commics that are my favourites, then I enter one to get a detailed view, and finally I enter a page. This is managed trough 3 activities. List, Details and Page. However, as of now the application can only read comics of one source (a specialiced xml-feed comming from my server), and I was hoping to be able to expand this a litle (also, the page-activity and some other stuff needs to be cleaned up in, so I'm thinking about remaking from scratch, and just take the first go as a learning-round). And I came up with an idea which I think sounds great, but I don't know if it's possible, but this is what I'm thinking about: The user enters the application and get an (first time empty) list of comics. The user hits a button to find comics, this launces an intent that says something like "find comic" or something like that. This should cause the system to display all matching activities. This would make it possible to provide different comic-providers trough different applications. Another activity kicks in and might displays some options to the user (for instance a file-browser), or might not (in the example of an xml-feed, which should just load). The list is returned to the first activity and displayed to the user. The second (find) activity is closed. The user picks a comic from the list. This should open some details-activity. The details-activity should receive a key which corresponds to the comic selected. This should be unique amongst the comic-providers. The details-view should get it's data trough some cind of content-provider, or an activity (whichever is most suited, if one of them is). The user can select a page. This should be the same routine as step 5. My question is, is this possible in the android system, and if it is, is it a bad idea? And also, is there any better way to achieve more or less the same thing?

    Read the article

  • xml appending issue - in ie, chrome browsers

    - by 3gwebtrain
    Hi, i am using this coding for my xml information to append in to html. As well it works fine. but in the ie7,ie8 as well chrome browser it's not propelry. This code work9ing well with firefox,opera, safari.. i unable to find, what is the mistake i made this.. any one help me please? $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var receivedData = myData; var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) // alert('thisTitle : '+thisTitle+'thisIntro :'+thisIntro); $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); // Append content of 'list' node $('ul.level'+count).append($(this).children()); }); }); }); })

    Read the article

  • Uploading files to varbinary(max) in SQL Server -- works on one server, not the other

    - by pjabbott
    I have some code that allows users to upload file attachments into a varbinary(max) column in SQL Server from their web browser. It has been working perfectly fine for almost two years, but all of a sudden it stopped working. And it stopped working on only the production database server -- it still works fine on the development server. I can only conclude that the code is fine and there is something up with the instance of SQL Server itself. But I have no idea how to isolate the problem. I insert a record into the ATTACHMENT table, only inserting non-binary data like the title and the content type, and then chunk-upload the uploaded file using the following code: // get the file stream System.IO.Stream fileStream = postedFile.InputStream; // make an upload buffer byte[] fileBuffer; fileBuffer = new byte[1024]; // make an update command SqlCommand fileUpdateCommand = new SqlCommand("update ATTACHMENT set ATTACHMENT_DATA.WRITE(@Data, NULL, NULL) where ATTACHMENT_ID = @ATTACHMENT_ID", sqlConnection, sqlTransaction); fileUpdateCommand.Parameters.Add("@Data", SqlDbType.Binary); fileUpdateCommand.Parameters.AddWithValue("@ATTACHMENT_ID", newId); while (fileStream.Read(fileBuffer, 0, fileBuffer.Length) > 0) { fileUpdateCommand.Parameters["@Data"].Value = fileBuffer; fileUpdateCommand.ExecuteNonQuery(); <------ FAILS HERE } fileUpdateCommand.Dispose(); fileStream.Close(); Where it says "FAILS HERE", it sits for a while and then I get a SQL Server timeout error on the very first iteration through the loop. If I connect to the development database instead, everything works fine (it runs through the loop many, many times and the commit is successful). Both servers are identical (SQL Server 9.0.3042) and the schemas are identical as well. When I open Activity Monitor right after the timeout to see what's going it, it says the last command is (@Data binary(1024),@ATTACHMENT_ID decimal(4,0))update ATTACHMENT set ATTACHMENT_DATA.WRITE(@Data, NULL, NULL) where ATTACHMENT_ID = @ATTACHMENT_ID which I would expect but it also says it has a status of "Suspended" and a wait type of "PAGEIOLATCH_SH". I looked this up and it seems to be a bad thing but I can't find anything specific to my stuation. Ideas?

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • Approach for authentication and storing user details.

    - by cappuccino
    Hey folks, I am using the Zend Framework but my question is broadly about sessions / databases / auth (PHP MySQL). Currently this is my approach to authentication: 1) User signs in, the details are checked in database. - Standard stuff really. 2) If the details are correct only the user's unique ID is stored in the session and a security token (user unique ID + IP + Browser info + salt). The session in written to the filesystem. I've been reading around and many are saying that storing stuff in sessions is not a good idea, and that you should really only write a unique ID which refers back to the user's details and a security token to prevent session hijacking. So this is the approach i've taken, i use to write the user's details in session, but i've moved that out. Wanted to know your opinions on this. I'm keeping sessions in the filesystem since i don't run on multiple servers, and since i'm only writting a tiny tiny bit of data to sessions, i thought that performance would be greater keeping sessions in the filesystem to reduce load on the database. Once the session is written on authentication, it really is only read-only from then on. 3) The rest of the user's details (like subscription details, permissions, account info etc) are cached in the filesystem (this can always be easily moved to memory if i wanted even more performance). So rather than keeping the user's details in session, the user's details are cached in the file system. I'm using Zend_Cache and the unique cache id is something like md5(/cache/auth/2892), the number is the unique id of the user. I guess the benefit of this method is that once the user is logged in, there is essentially not database queries being run to get the user's details. Just wonder if this approach is better than keeping the whole lot in session... 4) As the user moves throughout the site the only thing that is checked is the ID in the session and the security token. So, overall the first question is 1) is the filesystem more efficient than a database for this purpose 2) have i taken enough security precautions 3) is separating user detail's from the session into a cached file a pointless task? Thanks.

    Read the article

  • How can I embed a conditional comment for IE with innerHTML?

    - by Samuel Charpentier
    Ok so I want to conditionally add this line of code; <!--[if ! IE]> <embed src="logo.svg" type="image/svg+xml" /> <![endif]--> Using: document.getElementById("logo") .innerHTML='...'; In a if()/else() statement and it don't write it! If i get rid of the selective comment ( <!--[if ! IE]><![endif]-->) and only put the SVG ( <embed src="logo.svg" type="image/svg+xml" /> ) it work! what should I do? I found a way around but i think in the Android browser the thing will pop up twice. here's what I've done ( and its Validated stuff!); <!DOCTYPE html> <html> <head> <META CHARSET="UTF-8"> <title>SVG Test</title> <script type="text/javascript"> //<![CDATA[ onload=function() { var ua = navigator.userAgent.toLowerCase(); var isAndroid = ua.indexOf("android") > -1; //&& ua.indexOf("mobile"); if(isAndroid) { document.getElementById("logo").innerHTML='<img src="fin_palais.png"/>'; } } //]]> </script> </head> <body> <div id="logo"> <!--[if lt IE 9]> <img src="fin_palais.png"/> <![endif]--> <!--[if gte IE 9]><!--> <embed src="fin_palais.svg" type="image/svg+xml" /> <!--<![endif]--> </div> </body>

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • Problems with creating and using of delegate-protocols

    - by Flocked
    Hello, I have the problem that I have created a delegate protocol, but the necessary methods are not executed, although I have implemented the protocol in my header file. Here are the detailed explanation: I created an instance of my ViewController (TimeLineViewController), which will be displayed. This ViewController contains a UITableView, which in turn receives the individual Cells / Rows from one instance of my TableViewCell. So the ViewController creates an instance of TableCellView. The TableViewCell contains a UITextView, which contains web links. Now I want, that not safari opens the links, but my own built-in browser. Unfortunately TableViewCell can not open a new ViewController with a WebView, so I decided to create a delegate protocol. The whole thing looks like this: WebViewTableCellDelegate.h: @protocol WebViewTableCellDelegate -(void)loadWeb; @end Then I created a instance WebViewDelegate in the TableViewCell: id <WebViewTableCellDelegate> _delegate; In the .m of the TableViewCell: @interface UITextView (Override) @end @class WebView, WebFrame; @protocol WebPolicyDecisionListener; @implementation UITextView (Override) - (void)webView:(WebView *)webView decidePolicyForNavigationAction:(NSDictionary *)actionInformation request:(NSURLRequest *)request frame:(WebFrame *)frame decisionListener:(id < WebPolicyDecisionListener >)listener { NSLog(@"request: %@", request); [_delegate loadWeb]; } @end - (void)setDelegate:(id <WebViewTableCellDelegate>)delegate{ _delegate = delegate;} And in my TimeLineViewController I implemented the protocol with < and the loadWeb-metode: - (void)loadWeb{ WebViewController *web = [[WebViewController alloc] initWithNibName:nil bundle:nil]; web.modalTransitionStyle = UIModalTransitionStyleFlipHorizontal; [self presentModalViewController: web animated:YES]; [web release]; } And when the instance of the TableViewCell will be created in the TimelineViewController: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *MyIdentifier = @"MyIdentifier"; MyIdentifier = @"tableCell"; TableViewCell *cell = (TableViewCell *)[tableView dequeueReusableCellWithIdentifier:MyIdentifier]; if(cell == nil) { [[NSBundle mainBundle] loadNibNamed:@"TableViewCell" owner:self options:nil]; cell = tableCell;} [cell setDelegate:self]; //… } It is the first time I created a own delegate-protocol, so maybe there are stupid mistakes. Also I´m learnung Objective-C and programming generally only for 4 weeks. Thanks for your help! EDIT: I think i found the problem, but I dont know how to resolve it. I try to use [_delegate loadWeb]; in the subclass of the UITextView (because that is the only way i can react on the weblinks) and the subclass can´t use [_delegate loadWeb];. I tried this in a other methode and it worked.

    Read the article

  • How do I update with a newly-created detached entity using NHibernate?

    - by Daniel T.
    Explanation: Let's say I have an object graph that's nested several levels deep and each entity has a bi-directional relationship with each other. A -> B -> C -> D -> E Or in other words, A has a collection of B and B has a reference back to A, and B has a collection of C and C has a reference back to B, etc... Now let's say I want to edit some data for an instance ofC. In Winforms, I would use something like this: var instanceOfC; using (var session = SessionFactory.OpenSession()) { // get the instance of C with Id = 3 instanceOfC = session.Linq<C>().Where(x => x.Id == 3); } SendToUIAndLetUserUpdateData(instanceOfC); using (var session = SessionFactory.OpenSession()) { // re-attach the detached entity and update it session.Update(instanceOfC); } In plain English, we grab a persistent instance out of the database, detach it, give it to the UI layer for editing, then re-attach it and save it back to the database. Problem: This works fine for Winform applications because we're using the same entity all throughout, the only difference being that it goes from persistent to detached to persistent again. The problem occurs when I'm using a web service and a browser, sending over JSON data. In this case, the data that comes back is no longer a detached entity, but rather a transient one that just happens to have the same ID as the persistent one. If I use this entity to update, it will wipe out the relationship to B and D unless I sent the entire object graph over to the UI and got it back in one piece. Question: My question is, how do I serialize detached entities over the web, receive them back, and save them, while preserving any relationships that I didn't explicitly change? I know about ISession.SaveOrUpdateCopy and ISession.Merge() (they seem to do the same thing?), but this will still wipe out the relationships if I don't explicitly set them. I could copy the fields from the transient entity to the persistent entity one by one, but this doesn't work too well when it comes to relationships and I'd have to handle version comparisons manually.

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • Intent filter for browsing XML (specifically rss) in android

    - by Leif Andersen
    I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

    Read the article

  • Rails 3 Atom Feed

    - by scud bomb
    Trying to create an atom feed in Rails 3. When i refresh my browser i see basic XML, not the Atom feed im looking for. class PostsController < ApplicationController # GET /posts # GET /posts.xml def index @posts = Post.all respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.atom end end index.atom.builder atom_feed do |feed| feed.title "twoconsortium feed" @posts.each do |post| feed.entry(post) do |entry| entry.title post.title entry.content post.text end end end localhost:3000/posts.atom looks like this: <?xml version="1.0" encoding="UTF-8"?> <feed xml:lang="en-US" xmlns="http://www.w3.org/2005/Atom"> <id>tag:localhost,2005:/posts</id> <link rel="alternate" type="text/html" href="http://localhost:3000"/> <link rel="self" type="application/atom+xml" href="http://localhost:3000/posts.atom"/> <title>my feed</title> <entry> <id>tag:localhost,2005:Post/1</id> <published>2012-03-27T18:26:13Z</published> <updated>2012-03-27T18:26:13Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/1"/> <title>First post</title> <content>good stuff</content> </entry> <entry> <id>tag:localhost,2005:Post/2</id> <published>2012-03-27T19:51:18Z</published> <updated>2012-03-27T19:51:18Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/2"/> <title>Second post</title> <content>its that second post type stuff</content> </entry> </feed>

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Trouble passing a string as a SQLite ExecSQL command

    - by Hackbrew
    I keep getting the ERROR: near "PassWord": syntax error when trying to execute the ExecSQL() statement. The command looks good in the output of the text file. In fact, I copied & pasted the command directly into SQLite Database Browser and the commend executed properly. Here's the code that's producing the error: procedure TForm1.Button1Click(Sender: TObject); var i, iFieldSize: integer; sFieldName, sFieldType, sFieldList, sExecSQL: String; names: TStringList; f1: Textfile; begin //Open Source table - Table1 has 8 fields but has only two different field types ftString and Boolean Table1.TableName:= 'PWFile'; Table1.Open; //FDConnection1.ExecSQL('drop table PWFile'); sFieldList := ''; names := TStringList.Create; for i := 0 to Table1.FieldCount - 1 do begin sFieldName := Table1.FieldDefList.FieldDefs[i].Name; sFieldType := GetEnumName(TypeInfo(TFieldType),ord(Table1.FieldDefList.FieldDefs[i].DataType)); iFieldSize := Table1.FieldDefList.FieldDefs[i].Size; if sFieldType = 'ftString' then sFieldType := 'NVARCHAR' + '(' + IntToStr(iFieldSize) + ')'; if sFieldType = 'ftBoolean' then sFieldType := 'INTEGER'; names.Add(sFieldName + ' ' + sFieldType); if sFieldList = '' then sFieldList := sFieldName + ' ' + sFieldType else sFieldList := sFieldList + ', ' + sFieldName + ' ' + sFieldType; end; ListBox1.Items.Add(sFieldList); sExecSQL := 'create table IF NOT EXISTS PWFile (' + sFieldList + ')'; // 08/18/2014 - Entered this to log the SQLite FDConnection1.ExecSQL Command to a file AssignFile(f1, 'C:\Users\Test User\Documents\SQLite_Command.txt'); Rewrite(f1); Writeln(f1, sExecSQL); { insert code here that would require a Flush before closing the file } Flush(f1); { ensures that the text was actually written to file } CloseFile(f1); FDConnection1.ExecSQL(sFieldList); Table1.Close; end; Here's the actual command that gets executed: create table IF NOT EXISTS PWFile (PassWord NVARCHAR(10), PassName NVARCHAR(10), Dept NVARCHAR(10), Active NVARCHAR(1), Admin INTEGER, Shred INTEGER, Reports INTEGER, Maintain INTEGER)

    Read the article

< Previous Page | 581 582 583 584 585 586 587 588 589 590 591 592  | Next Page >