Search Results

Search found 23427 results on 938 pages for 'christopher done'.

Page 609/938 | < Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >

• VS2010 (older) installer project - two or more objects have the same target location.

  - by Hamish Grubijan

  This installer project was created back in 2004 and upgraded ever since. There are two offending dll files, which produce a total of 4 errors. I have searched online for this warning message and did not find a permanent fix (I did manage to make it go away once until I have done something like a clean, or built in Release, and then in Debug). I also tried cleaning, and then refreshing the dependencies. The duplicated entries are still in there. I also did not find a good explanation for what this error means. Additional warnings are of this nature: Warning 36 The version of the .NET Framework launch condition '.NET Framework 4' does not match the selected .NET Framework bootstrapper package. Update the .NET Framework launch condition to match the version of the .NET Framework selected in the Prerequisites Dialog Box. So, where is this prerequisites box? I want to make both things agree on .Net 4.0, just having a hard time locating both of them.

  Read the article

• Steps to take for figuring out the delay when calling service and loading data with the result?

  - by VoodooChild

  Hello, In a client server app, where client front end is done in silverlight using C# and the services are the WCF services. If I am to hit the service and do a query and bring back a result and I notice that it is taking a relatively long time to load my page which is just loading the grid with the data, what things should I look at fix this issue or how would I fix this issue? What steps could I take to determine the problem? where is the bottle-neck, can anyone know from the little information provided here? Does this have anything to do with serialization? Any insight on what could be causing this delay? My service calls are made async. I hope this question makes sense :) Thanks

  Read the article

• Creating problem-sets with answers in Latex

  - by ARV

  Hello everyone. I want to typeset Mathematical problem-sets in Latex. My requirements are as follows: When I type them in, I want the questions and the answers to be next to each other in the source-code so that fixing errors, etc. can be done easily. However, when the document is typeset, I want the answers to appear in a separate "Answers" section just the way they do in textbooks. Does anyone know of a way to do this? Many thanks in advance!

  Read the article

• ASP.NET MVC vs. Jquery/AJAX (Where to draw the dividing line?)

  - by punkouter

  I am learning MVC and I understand the basics now. It is very good for CRUD pages and has built in HTTP methods to post/get edits/updates. That is nice. This is all very testable by just creating a new controller and testing it. But I was thinking about other web page scenerios when using MVC. What about a page that has 2 listboxes that you add/remove users with. (A button will move the user from one listbox to another) This would be done using Jquery/Javascript... But then what happens to testing? How do you test adding/removing users from a listbox like that example? It seems to me the more jquery you use the less testable the page becomes right? When you get beyond basic forms being filled out then you need to use something more than the standard MVC pages. What is the correct philosophy on this on when am I not understanding ?

  Read the article

• Would it be possible for web browsers to automatically update rendering engines?

  - by unknowing

  As a way to prevent the major annoyances of browser segmentation and older versions. This way the code would only need to be done for the latest version of the browser, but users could still have the functionality of the older version and not be forced to do major updates? I am sure there will be some major flaws in this, and I would like you to tell me what they are! -Obviously, people may not want this as often auto-updating is frowned upon, however Chrome does it (or at least, they used to); Without a manual check, Chrome will update itself automatically, Google said. "Google Chrome will automatically checks for updates approximately every five hours. If an update is available, it will be downloaded and applied at the next browser restart," Google said. -there is still the problem of getting users from the really old ones onto the any new browsers that have this functionality -To prevent exploits in terms of updates, maybe they could have a 7 day opt-in period before being pushed out to everyone?

  Read the article

• In Ruby, how do I make a hash from an array?

  - by Wizzlewott

  I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

  Read the article

• How do i find dynamic average for not the 20 input boxes

  - by alpho07

  How do i find dynamic average for not the 20 input boxes with ".num" class but even just five out of 20. I have done it as below but it won't work $.fn.sumValues = function() { var sum = 0; this.each(function() { if ( $(this).is(':input') ) { var val = $(this).val(); } else { var val = $(this).text(); } sum += parseFloat( ('0' + val).replace(/[^0-9-\.]/g, ''), 10 ); }); return sum.toFixed(2); }; $(document).ready(function() { $('input.price').bind('keyup', function() { $('span.total').html( $('input.price').sumValues()/$('.num').length ); }); });

  Read the article

• How to return settings from an object

  - by Rockbot

  i have done something like this: myProject = settings: duration: 500 value: 'aValue' aFunction: -> myElement.fadeOut myProject.settings.duration This is just a sample but my project is like that. A lot of times i have to reference to the settings to get a certain value, and i always have to write myProject.settings.value, and it doesn´t look good. My question is, can I call a function that returns the wanted value? Something like this? aFunction -> myElement.fadeOut getSetting(duration) I tried with getSetting: (param) -> myProject.settings.param but failed? Why is that? Thank you!

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• 'Loading' web page for async call

  - by Sieg

  I have a simple web page in ASP.NET / C#. Currently to fully render the data I require calling a block of code that runs on background threads and can take multiple minutes to complete. I've got it to the point (using the async attribute on the page declaration) to execute and return fine with the html once it's done. What I'd like it to do is allow me to return immediately with a 'loading page' of some sort and then have that page be updated when the background work has been completed. Right now I get nothing on the page while the background work is being processed. Any ideas on the best way or clever way to do that would greatly be appreciated! Thanks, Sieg

  Read the article

• Capture subprocess output

  - by schneck

  Hi there, I learned that when executing commands in Python, I should use subprocess. What I'm trying to achieve is to encode a file via ffmpeg and observe the program output until the file is done. Ffmpeg logs the progress to stderr. If I try something like this: child = subprocess.Popen(command, shell=True, stderr=subprocess.PIPE) complete = False while not complete: stderr = child.communicate() # Get progress print "Progress here later" if child.poll() is not None: complete = True time.sleep(2) the programm does not continue after calling child.communicate() and waits for the command to complete. Is there any other way to follow the output?

  Read the article

• Codeigniter: State Machine how to

  - by Kevin Brown

  I created a db row called "activity_state" to denote which things a user has and hasn't completed. The problem is, I don't know how to use it... How can I use this single row to determine what a user has done? ie. have they completed their profile?, have they completed an assignment? Someone mentioned using it as a bitfield, but I'm unfamiliar with that. Is that a good idea? Any ideas?

  Read the article

• Getting one line in a huge file with PHP

  - by JavaRocky

  How can i get a particular line in a 3 gig text file. The lines are delimited by \n. And i need to be able to get any line on demand. How can this be done? Only one line need be returned. And i would not like to use any system calls. Note: There is the same question elsewhere regarding how to do this in bash. I would like to compare it with the PHP equiv.

  Read the article

• MySql paging; "Showing result-set" of "total found" help

  - by Camran

  I need a formula for showing results on my classifieds website. I am now done with the paging of records, but this formula for showing results remains. I want it like this: Showing 1-50 of 123 found. Now what is the formula for this? I have these variables which should be enough I think: $results_per_page = 50; //results per page $page = 1; //current page Also a variable called $num_total contains the total nr of hits, in this case 123. Thanks

  Read the article

• Rails 2.3.5: How to handle this type of validation

  - by randombits

  The use case is simple. I allow users to enter in an expiration field which needs to be between 1 and 15 into a form. The model takes that number and converts it into a datetime (such as adding 15 days from today) and stores it in the database. What's the correct way to actually validate that though? Do I validate against the datetime format that gets persisted in the database or the select box (1..15) that the user gets to pick through the form? I want to be able to validate that the user is putting in 1..15.. How is this done with ActiveRecord validation in Rails 2.3.5?

  Read the article

• string update in sqlserver

  - by Thiyaneshwaran S

  Currently i have varchar field. The delimiter is "$P$P$". The delimiter will appear atleast once and atmost twice in the varchar data. Eg. Sample Heading$P$P$Sample description$P$P$Sample conclusion Sample Heading$P$P$Sample Description If the delimiter appears twice, i need to insert a text before the second occurance of the delimiter. Eg: Sample Heading$P$P$Sample DescriptionINSERT TEXT HERE$P$P$Sample Conclusion If the delimiter occurs only once, then i need to insert a text at the end of the field. Eg: Sample Heading$P$P$Sample DescriptionAPPEND TEXT HERE How this can be done in sql query?

  Read the article

• How can i check if user entering correct form of email

  - by deerox

  Well i am not using email verification so i am facing problem in checking correct form of email address suppose if user enter support or support@ it accept it as well. So i atleast want them to enter there email or at least they enter email form correctly Here is my code: <?php require_once 'global.php'; if (!isset($_SESSION['logged_in'])) { header("Location: login.php"); } $user = unserialize($_SESSION['user']); $email = $user->email; $message = ""; if (isset($_POST['submit-settings'])) { $email = $_POST['email']; $user->email = $email; $user->save(); $msg = "Done!<br/>"; } ?>

  Read the article

• Shell Sort problem

  - by user191603

  Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

  Read the article

• Bash file descriptor leak

  - by Charles Duffy

  I get a file descriptor leak when running the following code: function get_fd_count() { local fds cd /proc/$$/fd; fds=( * ) # avoid a StackOverflow source colorizer bug echo "${#fds[@]}" } function fd_leak_func() { echo ">> Current FDs: $(get_fd_count)" read retval new_state < <(set +e; new_state=$(echo foo); retval=$?; printf "%d %s\n" $retval $new_state) } function parent_func() { while fd_leak_func; do :; done } parent_func Tested on both 3.2.25 and 4.0.28. Taking the while loop out of parent_func and running it at top level makes the problem go away. What's going on here? More to the point, are workarounds available?

  Read the article

• Knowledge mining using Hadoop.

  - by Anurag

  Hello there, I want to do a project Hadoop and map reduce and present it as my graduation project. To this, I've given some thought,searched over the internet and came up with the idea of implementing some basic knowledge mining algorithms say on a social websites like Facebook or may stckoverflow, Quora etc and draw some statistical graphs, comparisons frequency distributions and other sort of important values.For searching purpose would it be wise to use Apache Solr ? I want know If such thing is feasible using the above mentioned tools, if so how should I build up on this little idea? Where can I learn about knowledge mining algorithms which are easy to implement using java and map reduce techniques? In case this is a wrong idea please suggest what else can otherwise be done on using Hadoop and other related sub-projects? Thank you

  Read the article

• Strings - Filling In Leading Zeros Wtih A Zero

  - by headscratch

  I'm reading an array of hard-coded strings of numeric characters - all positions are filled with a character, even for the leading zeros. Thus, can confidently parse it using substring(start, end) to convert to numeric. Example: "0123 0456 0789" However, a string coming from a database does not fill in the leading zero with a 'zero character', it simply fetches the '123 456 789', which is correct for an arithmetic number but not for my needs and makes for parsing trouble. Before writing conditionals to check for leading zeros and adding them to the string if needed, is there a simple way of specifying they be filled with a character ? I'm not finding this in my Java book... I could have done the three conditionals in the time it took to post this but, this is more about 'education'... Thanks

  Read the article

• absolutely positioned divs that don't move when page is scrolled...

  - by Kyle

  I've done this in the past using a method similar to this: http://javascriptkit.com/javatutors/static3.shtml but I don't like the "flicker" effect as the page is scrolled and the div needs to move with the scrolling. Lately I've seen a lot of site that have an element (a div or the like I presume) that don't move when the page is scrolled but it's seemless...they're just there and it's a beautiful thing. Unfortunately I can't seem to recall where I've seen it lately to view the source and try to figure it out so I figured I'd turn here and see what all of you experts can provide as far as assistance / suggestions. TIA

  Read the article

• Return color on hover

  - by alonblack

  Here i created 3 images that goes from color to grayscale and i want to show the color on hover what i'v done wrong? here is the fiddle link: http://jsfiddle.net/4tHWg/6/ css code: .box { float: left; position: relative; width: 14.285714286%; } .boxInner img { width: 100%; display: block; } .boxInner img:hover { -webkit-filter: grayscale(0%); } @-webkit-keyframes toGrayScale { to { -webkit-filter: grayscale(100%); } } .box:nth-child(1) img { -webkit-animation: toGrayScale 1s 0.5s forwards; } .box:nth-child(2) img { -webkit-animation: toGrayScale 2s 1s forwards; } .box:nth-child(3) img { -webkit-animation: toGrayScale 3s 1.5s forwards; }

  Read the article

• Updating Versioned .NET Assembly References

  - by ryrich

  I have a C++/CLI project that needs to reference a .NET assembly. I've done so by going into the project properties and clicking "Add New Reference", and browsing to the assembly location (it's not part of the solution, so I cannot create a project-to-project reference, and the .NET assembly is not in the GAC so it isn't in the .NET tab when viewing the references to add) When the .NET assembly is updated (that is, since it is versioned, it will increment its version number daily), the C++/CLI project fails to compile because it is still referencing the older version. The workaround I've been doing is deleting the .NET reference and adding it back in, but this is not feasible. How do I have it recognize the newer assembly?? Note: The older assembly is replaced with the newer one, so it is in the same location, but doesn't know that it should use the newer version.

  Read the article

• how to deal with async calls in Ajax 4.0(using jquery?)

  - by dexter

  in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

  Read the article

< Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >