Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 618/750 | < Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >

• How to structure the tables of a very simple blog in MySQL?

  - by Programmer

  I want to add a very simple blog feature on one of my existing LAMP sites. It would be tied to a user's existing profile, and they would be able to simply input a title and a body for each post in their blog, and the date would be automatically set upon submission. They would be allowed to edit and delete any blog post and title at any time. The blog would be displayed from most recent to oldest, perhaps 20 posts to a page, with proper pagination above that. Other users would be able to leave comments on each post, which the blog owner would be allowed to delete, but not pre-moderate. That's basically it. Like I said, very simple. How should I structure the MySQL tables for this? I'm assuming that since there will be blog posts and comments, I would need a separate table for each, is that correct? But then what columns would I need in each table, what data structures should I use, and how should I link the two tables together (e.g. any foreign keys)? I could not find any tutorials for something like this, and what I'm looking to do is really offer my users the simplest version of a blog possible. No tags, no moderation, no images, no fancy formatting, etc. Just a simple diary-type, pure-text blog with commenting by other users.

  Read the article

• apache proxy module gives 403 forbidden error

  - by naiquevin

  I am trying to use the apache's proxy module for working with xmpp on ubuntu desktop. For this i did the following things - 1) enabled mod_proxy by creating a symlink of proxy.conf, proxy.load and proxy_http.load from /etc/apache2/mods-available/ in the mods-enabled directory. 2) Added the following lines to the vhost <Proxy http://mydomain.com/httpbind> Order allow,deny Allow from all </Proxy> ProxyPass /httpbind http://mydomain.com:7070/http-bind/ ProxyPassReverse /httpbind http://mydomain.com:7070/http-bind/ I am new to using the proxy module but what i can make from the above lines is that requests to http://mydomain.com/httpbind will be forwarded to http://mydomain.com:7070/http-bind/. Kindly correct if wrong. 3) added rule Allow from .mydomain.com in /mods-available/proxy.conf Now i try to access http://mydomain.com/httpbind and it shows 403 Forbidden error.. What am i missing here ? Please help. thanks Edit : The problem got solved when i changed the following code in mods_available/proxy.conf <Proxy *> AddDefaultCharset off Order deny,allow Deny from all Allow from mydomain.com </Proxy> to <Proxy *> AddDefaultCharset off Order deny,allow #Deny from all Allow from all </Proxy> Didnt get what was wrong with the initial code though

  Read the article

• Help me clean up this crazy lambda with the out keyword

  - by Sarah Vessels

  My code looks ugly, and I know there's got to be a better way of doing what I'm doing: private delegate string doStuff( PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt ); private bool tryEncryptPassword( doStuff encryptPassword, out string errorMessage ) { ...get some variables... string encryptedPassword = encryptPassword(encrypter, publicKey, privateKey, out salt); ... } This stuff so far doesn't bother me. It's how I'm calling tryEncryptPassword that looks so ugly, and has duplication because I call it from two methods: public bool method1(out string errorMessage) { string rawPassword = "foo"; return tryEncryptPassword( (PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt) => encrypter.EncryptPasswordAndDoStuff( // Overload 1 rawPassword, publicKey, privateKey, out salt ), out errorMessage ); } public bool method2(SecureString unencryptedPassword, out string errorMessage) { return tryEncryptPassword( (PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt) => encrypter.EncryptPasswordAndDoStuff( // Overload 2 unencryptedPassword, publicKey, privateKey, out salt ), out errorMessage ); } Two parts to the ugliness: I have to explicitly list all the parameter types in the lambda expression because of the single out parameter. The two overloads of EncryptPasswordAndDoStuff take all the same parameters except for the first parameter, which can either be a string or a SecureString. So method1 and method2 are pretty much identical, they just call different overloads of EncryptPasswordAndDoStuff. Any suggestions? Edit: if I apply Jeff's suggestions, I do the following call in method1: return tryEncryptPassword( (encrypter, publicKey, privateKey) => { var result = new EncryptionResult(); string salt; result.EncryptedValue = encrypter.EncryptPasswordAndDoStuff( rawPassword, publicKey, privateKey, out salt ); result.Salt = salt; return result; }, out errorMessage ); Much the same call is made in method2, just with a different first value to EncryptPasswordAndDoStuff. This is an improvement, but it still seems like a lot of duplicated code.

  Read the article

• LINQ-SQL Updating Multiple Rows in a single transaction

  - by RPM1984

  Hi guys, I need help re-factoring this legacy LINQ-SQL code which is generating around 100 update statements. I'll keep playing around with the best solution, but would appreciate some ideas/past experience with this issue. Here's my code: List<Foo> foos; int userId = 123; using (DataClassesDataContext db = new FooDatabase()) { foos = (from f in db.FooBars where f.UserId = userId select f).ToList(); foreach (FooBar fooBar in foos) { fooBar.IsFoo = false; } db.SubmitChanges() } Essentially i want to update the IsFoo field to false for all records that have a particular UserId value. Whats happening is the .ToList() is firing off a query to get all the FooBars for a particular user, then for each Foo object, its executing an UPDATE statement updating the IsFoo property. Can the above code be re-factored to one single UPDATE statement? Ideally, the only SQL i want fired is the below: UPDATE FooBars SET IsFoo = FALSE WHERE UserId = 123 EDIT Ok so looks like it cant be done without using db.ExecuteCommand. Grr...! What i'll probably end up doing is creating another extension method for the DLINQ namespace. Still require some hardcoding (ie writing "WHERE" and "UPDATE"), but at least it hides most of the implementation details away from the actual LINQ query syntax.

  Read the article

• Problems updating a textBox ASP.NET

  - by Roger Filipe

  Hello, I'm starting in asp.net and am having some problems that I do not understand. The problem is this, I am building a site for news. Every news has a title and body. I have a page where I can insert news, this page uses a textbox for each of the fields (title and body), after clicking the submit button everything goes ok and saves the values in the database. And o have another page where I can read the news, I use labels for each of the camps, these labels are defined in the Page_Load. Now I'm having problems on the page where I can edit the news. I am loading two textboxes (title and body) in the Page_Load, so far so good, but then when I change the text and I click the submit button, it ignores the changes that I made in the text and saves the text loaded in Page_Load. This code doesn't show any database connection but you can understand what i'm talking about. protected void Page_Load(object sender, EventArgs e) { textboxTitle.Text = "This is the title of the news"; textboxBody.Text = "This is the body of the news "; } I load the page, make the changes in the text , and then click submit. protected void btnSubmit_Click(object sender, EventArgs e) { String title = textboxTitle.Text; String body = textboxBody.Text; Response.Write("Title: " + title + " || "); Response.Write("Body: " + body ); } Nothing happens, the text in the textboxes is always the one I loaded in the page_load, how do I update the Text in the textboxes?

  Read the article

• Compact data structure for storing a large set of integral values

  - by Odrade

  I'm working on an application that needs to pass around large sets of Int32 values. The sets are expected to contain ~1,000,000-50,000,000 items, where each item is a database key in the range 0-50,000,000. I expect distribution of ids in any given set to be effectively random over this range. The operations I need on the set are dirt simple: Add a new value Iterate over all of the values. There is a serious concern about the memory usage of these sets, so I'm looking for a data structure that can store the ids more efficiently than a simple List<int>or HashSet<int>. I've looked at BitArray, but that can be wasteful depending on how sparse the ids are. I've also considered a bitwise trie, but I'm unsure how to calculate the space efficiency of that solution for the expected data. A Bloom Filter would be great, if only I could tolerate the false negatives. I would appreciate any suggestions of data structures suitable for this purpose. I'm interested in both out-of-the-box and custom solutions. EDIT: To answer your questions: No, the items don't need to be sorted By "pass around" I mean both pass between methods and serialize and send over the wire. I clearly should have mentioned this. There could be a decent number of these sets in memory at once (~100).

  Read the article

• Given a typical Rails 3 environment, why am I unable to execute any tests?

  - by Tom

  I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

  Read the article

• How are you using C++0x today? [closed]

  - by Roger Pate

  This is a question in two parts, the first is the most important and concerns now: Are you following the design and evolution of C++0x? What blogs, newsgroups, committee papers, and other resources do you follow? Even where you're not using any new features, how have they affected your current choices? What new features are you using now, either in production or otherwise? The second part is a follow-up, concerning the new standard once it is final: Do you expect to use it immediately? What are you doing to prepare for C++0x, other than as listed for the previous questions? Obviously, compiler support must be there, but there's still co-workers, ancillary tools, and other factors to consider. What will most affect your adoption? Edit: The original really was too argumentative; however, I'm still interested in the underlying question, so I've tried to clean it up and hopefully make it acceptable. This seems a much better avenue than duplicating—even though some answers responded to the argumentative tone, they still apply to the extent that they addressed the questions, and all answers are community property to be cleaned up as appropriate, too.

  Read the article

• Castle, sharing a transient component between a decorator and a decorated component

  - by Marius

  Consider the following example: public interface ITask { void Execute(); } public class LoggingTaskRunner : ITask { private readonly ITask _taskToDecorate; private readonly MessageBuffer _messageBuffer; public LoggingTaskRunner(ITask taskToDecorate, MessageBuffer messageBuffer) { _taskToDecorate = taskToDecorate; _messageBuffer = messageBuffer; } public void Execute() { _taskToDecorate.Execute(); Log(_messageBuffer); } private void Log(MessageBuffer messageBuffer) {} } public class TaskRunner : ITask { public TaskRunner(MessageBuffer messageBuffer) { } public void Execute() { } } public class MessageBuffer { } public class Configuration { public void Configure() { IWindsorContainer container = null; container.Register( Component.For<MessageBuffer>() .LifeStyle.Transient); container.Register( Component.For<ITask>() .ImplementedBy<LoggingTaskRunner>() .ServiceOverrides(ServiceOverride.ForKey("taskToDecorate").Eq("task.to.decorate"))); container.Register( Component.For<ITask>() .ImplementedBy<TaskRunner>() .Named("task.to.decorate")); } } How can I make Windsor instantiate the "shared" transient component so that both "Decorator" and "Decorated" gets the same instance? Edit: since the design is being critiqued I am posting something closer to what is being done in the app. Maybe someone can suggest a better solution (if sharing the transient resource between a logger and the true task is considered a bad design)

  Read the article

• WF -- how do I use a custom activity without creating it in a separate Workflow Activity Library?

  - by Kevin Craft

  I am trying to accomplish something that seems like it should be very simple. I have a State Machine Workflow Console Application with a workflow in it. I have created a custom activity for it. This activity will NEVER be used ANYWHERE ELSE. I just want to use this activity on my workflow, but: It does not appear in the toolbox. I cannot drag it from the Solution Explorer onto the workflow designer. I absolutely do not want to create a separate State Machine Workflow Activity Library, since that will just clutter my solution. Like I said, I will never use this activity in any other project, so I would like to keep it confined to this one...but I just can't figure out how to get it onto the designer! Am I going crazy!? Here is the code for the activity: public partial class GameSearchActivity: Activity { public GameSearchActivity() { InitializeComponent(); } public static DependencyProperty QueryProperty = System.Workflow.ComponentModel.DependencyProperty.Register("Query", typeof(string), typeof(GameSearchActivity)); [Description("Query")] [Category("Dependency Properties")] [Browsable(true)] [DesignerSerializationVisibility(DesignerSerializationVisibility.Visible)] public string Query { get { return ((string)(base.GetValue(GameSearchActivity.QueryProperty))); } set { base.SetValue(GameSearchActivity.QueryProperty, value); } } public static DependencyProperty ResultsProperty = System.Workflow.ComponentModel.DependencyProperty.Register("Results", typeof(string), typeof(GameSearchActivity)); [Description("Results")] [Category("Dependency Properties")] [Browsable(true)] [DesignerSerializationVisibility(DesignerSerializationVisibility.Visible)] public IEnumerable<Game_GamePlatform> Results { get { return ((IEnumerable<Game_GamePlatform>)(base.GetValue(GameSearchActivity.ResultsProperty))); } set { base.SetValue(GameSearchActivity.ResultsProperty, value); } } protected override ActivityExecutionStatus Execute(ActivityExecutionContext executionContext) { IDataService ds = executionContext.GetService<IDataService>(); Results = ds.SearchGames(Query); return ActivityExecutionStatus.Closed; } } Thanks. EDIT: OK, so I've discovered that if I change the project type from Console Application to Class Library, the custom activity appears in the toolbox. However, this is not acceptable. It needs to be a Console/Windows Application. Anyone know a way around this?

  Read the article

• curl_multi_exec stops if one url is 404, how can I change that?

  - by Rob

  Currently, my cURL multi exec stops if one url it connects to doesn't work, so a few questions: 1: Why does it stop? That doesn't make sense to me. 2: How can I make it continue? EDIT: Here is my code: $SQL = mysql_query("SELECT url FROM shells") ; $mh = curl_multi_init(); $handles = array(); while($resultSet = mysql_fetch_array($SQL)){ //load the urls and send GET data $ch = curl_init($resultSet['url'] . $fullcurl); //Only load it for two seconds (Long enough to send the data) curl_setopt($ch, CURLOPT_TIMEOUT, 5); curl_multi_add_handle($mh, $ch); $handles[] = $ch; } // Create a status variable so we know when exec is done. $running = null; //execute the handles do { // Call exec. This call is non-blocking, meaning it works in the background. curl_multi_exec($mh,$running); // Sleep while it's executing. You could do other work here, if you have any. sleep(2); // Keep going until it's done. } while ($running > 0); // For loop to remove (close) the regular handles. foreach($handles as $ch) { // Remove the current array handle. curl_multi_remove_handle($mh, $ch); } // Close the multi handle curl_multi_close($mh);

  Read the article

• methods of metaclasses on class instances.

  - by Stefano Borini

  I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

  Read the article

• Optimizing an embedded SELECT query in mySQL

  - by Crazy Serb

  Ok, here's a query that I am running right now on a table that has 45,000 records and is 65MB in size... and is just about to get bigger and bigger (so I gotta think of the future performance as well here): SELECT count(payment_id) as signup_count, sum(amount) as signup_amount FROM payments p WHERE tm_completed BETWEEN '2009-05-01' AND '2009-05-30' AND completed > 0 AND tm_completed IS NOT NULL AND member_id NOT IN (SELECT p2.member_id FROM payments p2 WHERE p2.completed=1 AND p2.tm_completed < '2009-05-01' AND p2.tm_completed IS NOT NULL GROUP BY p2.member_id) And as you might or might not imagine - it chokes the mysql server to a standstill... What it does is - it simply pulls the number of new users who signed up, have at least one "completed" payment, tm_completed is not empty (as it is only populated for completed payments), and (the embedded Select) that member has never had a "completed" payment before - meaning he's a new member (just because the system does rebills and whatnot, and this is the only way to sort of differentiate between an existing member who just got rebilled and a new member who got billed for the first time). Now, is there any possible way to optimize this query to use less resources or something, and to stop taking my mysql resources down on their knees...? Am I missing any info to clarify this any further? Let me know... EDIT: Here are the indexes already on that table: PRIMARY PRIMARY 46757 payment_id member_id INDEX 23378 member_id payer_id INDEX 11689 payer_id coupon_id INDEX 1 coupon_id tm_added INDEX 46757 tm_added, product_id tm_completed INDEX 46757 tm_completed, product_id

  Read the article

• Using a "take-home" coding component in interview process

  - by Jeff Sargent

  In recent interviews I have been asking candidates to code through some questions on the whiteboard. I don't feel I'm getting a clear enough picture of the candidates technical ability with this approach. Granted, the questions might not be good enough, maybe the interview needs to be longer, etc, but I'm wondering if a different approach would be better. What I'd like to try is to create a simple, working project in Visual Studio and have it checked into source control. The candidate can check that code out from home/wherever and then check back in work representing their response to the assignment that I'll provide. I'm thinking that if the window of time is short enough and the assignment clear enough then the solution will be safe enough from all-out Googling (i.e. they couldn't search for and find the entire solution online). I would then be able to review the candidates work. Has enough worked with something like this before, either to vet a candidate or as a candidate yourself? Any thoughts in general? P.S. my first StackOverflow question - hi guys and gals. EDIT: I've seen comments about asking someone to work for free - I wouldn't mind paying the person for their time.

  Read the article

• Reporting Services "cannot connect to the report server database"

  - by Dano

  We have Reporting Services running, and twice in the past 6 months it has been down for 1-3 days, and suddenly it will start working again. The errors range from not being able to view the tree root in a browser, down to being able to insert parameters on a report, but crashing before the report can generate. Looking at the logs, there is 1 error and 1 warning which seem to correspond somewhat. ERROR:Event Type: Error Event Source: Report Server (SQL2K5) Event Category: Management Event ID: 107 Date: 2/13/2009 Time: 11:17:19 AM User: N/A Computer: ******** Description: Report Server (SQL2K5) cannot connect to the report server database. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. WARNING: always comes before the previous error Event code: 3005 Event message: An unhandled exception has occurred. Event time: 2/13/2009 11:06:48 AM Event time (UTC): 2/13/2009 5:06:48 PM Event ID: 2efdff9e05b14f4fb8dda5ebf16d6772 Event sequence: 550 Event occurrence: 5 Event detail code: 0 Process information: Process ID: 5368 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ReportServerException Exception message: For more information about this error navigate to the report server on the local server machine, or enable remote errors. During the downtime we tried restarting everything from the server RS runs on, to the database it calls to fill reports with no success. When I came in monday morning it was working again. Anyone out there have any ideas on what could be causing these issues? Edit Tried both suggestions below several months ago to no avail. This issue hasn't arisen since, maybe something out of my control has changed....

  Read the article

• Building a custom Linux Live CD

  - by Mike Heinz

  Can anyone point me to a good tutorial on creating a bootable Linux CD from scratch? I need help with a fairly specialized problem: my firm sells an expansion card that requires custom firmware. Currently we use an extremely old live CD image of RH7.2 that we update with current firmware. Manufacturing puts the cards in a machine, boots off the CD, the CD writes the firmware, they power off and pull the cards. Because of this cycle, it's essential that the CD boot and shut down as quickly as possible. The problem is that with the next generation of cards, I have to update the CD to a 2.6 kernel. It's easy enough to acquire a pre-existing live CD - but those all are designed for showing off Linux on the desktop - which means they take forever to boot. Can anyone fix me up with a current How-To? Update: So, just as a final update for anyone reading this later - the tool I ended up using was "livecd-creator". My reason for choosing this tool was that it is available for RedHat-based distributions like CentOs, Fedora and RHEL - which are all distributions that my company supports already. In addition, while the project is very poorly documented it is extremely customizable. I was able to create a minimal LiveCD and edit the boot sequence so that it booted directly into the firmware updater instead of a bash shell. The whole job would have only taken an hour or two if there had been a README explaining the configuration file!

  Read the article

• How to send Event signal through Processes - C

  - by Jamie Keeling

  Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. I'm trying to work out how the other process will know of the event being fired so it can do the tasks it needs to do, I don't understand how one process that is separate from another can tell what the states the events are in especially as it needs to act as soon as the event has changed state. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

  Read the article

• SSIS - Skip Missing Files

  - by Greg

  I have a SSIS 2008 package that calls about 10 other SSIS packages (legacy issues, don't ask). Each of those child packages loads a specific file into a table. But sometimes one or more of these input files will be missing. How can I let a child package fail (because a file is missing) but let the rest of the parent package keep on running? I've tried increasing the maximum error count on the parent package, the tasks in the parent package that call each child, and in the child package itself. None of that seemed to make any difference. I still get this error when I run it with a file missing: SSIS Warning Code DTS_W_MAXIMUMERRORCOUNTREACHED. The Execution method succeeded, but the number of errors raised (2) reached the maximum allowed (1); resulting in failure. This occurs when the number of errors reaches the number specified in MaximumErrorCount. Change the MaximumErrorCount or fix the errors. Edit: failpackageonfailure and faulparentonfailure are already all set to false everywhere.

  Read the article

• OptimisticLockException in inner transaction ruins outer transaction

  - by Pace

  I have the following code (OLE = OptimisticLockException)... public void outer() { try { middle() } catch (OLE) { updateEntities(); outer(); } } @Transactional public void middle() { try { inner() } catch (OLE) { updateEntities(); middle(); } @Transactional public void inner() { //Do DB operation } inner() is called by other non-transactional methods which is why both middle() and inner() are transactional. As you can see, I deal with OLEs by updating the entities and retrying the operation. The problem I'm having is that when I designed things this way I was assuming that the only time one could get an OLE was when a transaction closed. This is apparently not the case as the call to inner() is throwing an OLE even when the stack is outer()->middle()->inner(). Now, middle() is properly handling the OLE and the retry succeeds but when it comes time to close the transaction it has been marked rollbackOnly by Spring. When the middle() method call finally returns the closing aspect throws an exception because it can't commit a transaction marked rollbackOnly. I'm uncertain what to do here. I can't clear the rollbackOnly state. I don't want to force create a transaction on every call to inner because that kills my performance. Am I missing something or can anyone see a way I can structure this differently? EDIT: To clarify what I'm asking, let me explain my main question. Is it possible to catch and handle OLE if you are inside of an @Transactional method? FYI: The transaction manager is a JpaTransactionManager and the JPA provider is Hibernate.

  Read the article

• iOS - Passing variable to view controller

  - by gj15987

  I have a view with a view controller and when I show this view on screen, I want to be able to pass variables to it from the calling class, so that I can set the values of labels etc. First, I just tried creating a property for one of the labels, and calling that from the calling class. For example: SetTeamsViewController *vc = [[SetTeamsViewController alloc] init]; vc.myLabel.text = self.teamCount; [self presentModalViewController:vc animated:YES]; [vc release]; However, this didn't work. So I tried creating a convenience initializer. SetTeamsViewController *vc = [[SetTeamsViewController alloc] initWithTeamCount:self.teamCount]; And then in the SetTeamsViewController I had - (id)initWithTeamCount:(int)teamCount { self = [super initWithNibName:nil bundle:nil]; if (self) { // Custom initialization self.teamCountLabel.text = [NSString stringWithFormat:@"%d",teamCount]; } return self; } However, this didn't work either. It's just loading whatever value I've given the label in the nib file. I've littered the code with NSLog()s and it is passing the correct variable values around, it's just not setting the label. Any help would be greatly appreciated. EDIT: I've just tried setting an instance variable in my designated initializer, and then setting the label in viewDidLoad and that works! Is this the best way to do this? Also, when dismissing this modal view controller, I update the text of a button in the view of the calling ViewController too. However, if I press this button again (to show the modal view again) whilst the other view is animating on screen, the button temporarily has it's original value again (from the nib). Does anyone know why this is?

  Read the article

• UnicodeEncodeError: 'ascii' codec can't encode character [...]

  - by user1461135

  I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

  Read the article

• Rails can't find my route but it exists!

  - by DJTripleThreat

  Ok I have events that I want to publish/unpublish with an extra action (nonRESTful) I watched Ryan Bates' railscast on this: http://railscasts.com/episodes/35-custom-rest-actions and it got me most of the way. I think the problem is that my route is nested in an /admin section so even though when I run rake routes and get: publish_admin_event PUT /admin/events/:id/publish(.:format) {:controller=>"event_services", :action=>"publish"} This won't work in my /views/admin/index.html.erb file: <%= link_to 'Publish', publish_admin_event(event), :method => :put %> because it claims that path doesn't exist! And neither will this: <%= link_to 'Publish', {:controller => :event_services, :action => :publish}, {:method => :put, :id => event} %> and says that "No route matches {:controller=>"event_services", :action=>"publish"}" so what gives? (And I've tried restarting my server so that isn't it.) EDIT: This DOES work: <%= link_to 'Publish', "/admin/events/" + event.id.to_s + "/publish", :method => :put %> But I'd rather NOT do this.

  Read the article

• "variable tracking" is eating my compile time!

  - by wowus

  I have an auto-generated file which looks something like this... static void do_SomeFunc1(void* parameter) { // Do stuff. } // Continues on for another 4000 functions... void dispatch(int id, void* parameter) { switch(id) { case ::SomeClass1::id: return do_SomeFunc1(parameter); case ::SomeClass2::id: return do_SomeFunc2(parameter); // This continues for the next 4000 cases... } } When I build it like this, the build time is enormous. If I inline all the functions automagically into their respective cases using my script, the build time is cut in half. GCC 4.5.0 says ~50% of the build time is being taken up by "variable tracking" when I use -ftime-report. What does this mean and how can I speed compilation while still maintaining the superior cache locality of pulling out the functions from the switch? EDIT: Interestingly enough, the build time has exploded only on debug builds, as per the following profiling information of the whole project (which isn't just the file in question, but still a good metric; the file in question takes the most time to build): Debug: 8 minutes 50 seconds Release: 4 minutes, 25 seconds

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• C# class can not disguise to be another class because GetType method cannot be override

  - by zinking

  there is a statement in the CLR via C# saying in C#, one class cannot disguise to be another, because GetType is virutal and thus it cannot be override but I think in C# we can still hide the parent implementation of GetType. I must missed something if I hide the base GetType implementation then I can disguise my class to be another class, is that correct? The key here is not whether GetType is virutal or not, the question is can we disguise one class to be another in C# Following is the NO.4 answer from the possible duplicate, so My question is more on this. is this kind of disguise possible, if so, how can we say that we can prevent class type disguise in C# ? regardless of the GetType is virtual or not While its true that you cannot override the object.GetType() method, you can use "new" to overload it completely, thereby spoofing another known type. This is interesting, however, I haven't figured out how to create an instance of the "Type" object from scratch, so the example below pretends to be another type. public class NotAString { private string m_RealString = string.Empty; public new Type GetType() { return m_RealString.GetType(); } } After creating an instance of this, (new NotAString()).GetType(), will indeed return the type for a string. share|edit|flag answered Mar 15 at 18:39 Dr Snooze 213 By almost anything that looks at GetType has an instance of object, or at the very least some base type that they control or can reason about. If you already have an instance of the most derived type then there is no need to call GetType on it. The point is as long as someone uses GetType on an object they can be sure it's the system's implementation, not any other custom definition. – Servy Mar 15 at 18:54 add comment

  Read the article

< Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >