Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 618/750 | < Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >

  • Compact data structure for storing a large set of integral values

    - by Odrade
    I'm working on an application that needs to pass around large sets of Int32 values. The sets are expected to contain ~1,000,000-50,000,000 items, where each item is a database key in the range 0-50,000,000. I expect distribution of ids in any given set to be effectively random over this range. The operations I need on the set are dirt simple: Add a new value Iterate over all of the values. There is a serious concern about the memory usage of these sets, so I'm looking for a data structure that can store the ids more efficiently than a simple List<int>or HashSet<int>. I've looked at BitArray, but that can be wasteful depending on how sparse the ids are. I've also considered a bitwise trie, but I'm unsure how to calculate the space efficiency of that solution for the expected data. A Bloom Filter would be great, if only I could tolerate the false negatives. I would appreciate any suggestions of data structures suitable for this purpose. I'm interested in both out-of-the-box and custom solutions. EDIT: To answer your questions: No, the items don't need to be sorted By "pass around" I mean both pass between methods and serialize and send over the wire. I clearly should have mentioned this. There could be a decent number of these sets in memory at once (~100).

    Read the article

  • How to keep activity on Force Close?

    - by SushiRoll
    I have this piece of code that's really prone to errors so I wrapped it with try{}catch statement. I don't want to go back to the previous activity, I just want it to stay on the current activity so that the user can edit whatever is wrong with them. How do I implement this? try{ orgi.insertOrThrow(tableName, null, values); Toast.makeText(this, "You have successfully created a new profile!", 2).show(); gotoProfileList(); Log.e(getClass().getSimpleName(),"Successfully added to database"); }catch(SQLiteException se){ Log.e(getClass().getSimpleName(), "Database connection failed!" + se); //Stay in this activity... }finally{ if (orgi != null){ orgi.close(); } } Forget it, I was able to solve my own problem by showing up an alertDialog that tells the user about the error. Thanks anyways. :) try{ orgi.insertOrThrow(tableName, null, values); Toast.makeText(this, "You have successfully created a new profile!", 2).show(); gotoProfileList(); Log.e(getClass().getSimpleName(),"Successfully added to database"); }catch(SQLiteException se){ Log.e(getClass().getSimpleName(), "Database connection failed!" + se); displayError(); //stayInThisActivity(); }finally{ if (orgi != null){ orgi.close(); } public void displayError(){ AlertDialog.Builder error = new AlertDialog.Builder(this); error.setMessage("That profile name already exists, try another one.").setCancelable(false).setPositiveButton("Yes",new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { dialog.cancel(); } }); AlertDialog alert = error.create(); alert.setTitle("Error"); alert.show(); }

    Read the article

  • Help me clean up this crazy lambda with the out keyword

    - by Sarah Vessels
    My code looks ugly, and I know there's got to be a better way of doing what I'm doing: private delegate string doStuff( PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt ); private bool tryEncryptPassword( doStuff encryptPassword, out string errorMessage ) { ...get some variables... string encryptedPassword = encryptPassword(encrypter, publicKey, privateKey, out salt); ... } This stuff so far doesn't bother me. It's how I'm calling tryEncryptPassword that looks so ugly, and has duplication because I call it from two methods: public bool method1(out string errorMessage) { string rawPassword = "foo"; return tryEncryptPassword( (PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt) => encrypter.EncryptPasswordAndDoStuff( // Overload 1 rawPassword, publicKey, privateKey, out salt ), out errorMessage ); } public bool method2(SecureString unencryptedPassword, out string errorMessage) { return tryEncryptPassword( (PasswordEncrypter encrypter, RSAPublicKey publicKey, string privateKey, out string salt) => encrypter.EncryptPasswordAndDoStuff( // Overload 2 unencryptedPassword, publicKey, privateKey, out salt ), out errorMessage ); } Two parts to the ugliness: I have to explicitly list all the parameter types in the lambda expression because of the single out parameter. The two overloads of EncryptPasswordAndDoStuff take all the same parameters except for the first parameter, which can either be a string or a SecureString. So method1 and method2 are pretty much identical, they just call different overloads of EncryptPasswordAndDoStuff. Any suggestions? Edit: if I apply Jeff's suggestions, I do the following call in method1: return tryEncryptPassword( (encrypter, publicKey, privateKey) => { var result = new EncryptionResult(); string salt; result.EncryptedValue = encrypter.EncryptPasswordAndDoStuff( rawPassword, publicKey, privateKey, out salt ); result.Salt = salt; return result; }, out errorMessage ); Much the same call is made in method2, just with a different first value to EncryptPasswordAndDoStuff. This is an improvement, but it still seems like a lot of duplicated code.

    Read the article

  • How can I receive mouse events when a wrapped control has set capture?

    - by Greg
    My WndProc isn't seeing mouse-up notifications when I click with a modifier key (shift or control) pressed. I see them without the modifier key, and I see mouse-down notifications with the modifier keys. I'm trying to track user actions in a component I didn't write, so I'm using the Windows Forms NativeWindow wrapper (wrapping the component) to get Windows messages from the WndProc() method. I've tried tracking the notifications I do get, and I the only clue I see is WM_CAPTURECHANGED. I've tried calling SetCapture when I receive the WM_LBUTTONDOWN message, but it doesn't help. Without modifier (skipping paint, timer and NCHITTEST messages): WM_PARENTNOTIFY WM_MOUSEACTIVATE WM_MOUSEACTIVATE WM_SETCURSOR WM_LBUTTONDOWN WM_SETCURSOR WM_MOUSEMOVE WM_SETCURSOR WM_LBUTTONUP With modifier (skipping paint, timer and NCHITTEST messages): WM_KEYDOWN WM_PARENTNOTIFY WM_MOUSEACTIVATE WM_MOUSEACTIVATE WM_SETCURSOR WM_LBUTTONDOWN WM_SETCURSOR (repeats) WM_KEYDOWN (repeats) WM_KEYUP If I hold the mouse button down for a long time, I can usually get a WM_LBUTTONUP notification, but it should be possible to make it more responsive.. Edit: I've tried control-clicking outside of the component of interest and moving the cursor into it before releasing the mouse button, and then I do get a WM_LBUTTONUP notification, so it looks like the component is capturing the mouse on mouse-down. Is there any way to receive that notification when another window has captured the mouse? Thanks.

    Read the article

  • apache proxy module gives 403 forbidden error

    - by naiquevin
    I am trying to use the apache's proxy module for working with xmpp on ubuntu desktop. For this i did the following things - 1) enabled mod_proxy by creating a symlink of proxy.conf, proxy.load and proxy_http.load from /etc/apache2/mods-available/ in the mods-enabled directory. 2) Added the following lines to the vhost <Proxy http://mydomain.com/httpbind> Order allow,deny Allow from all </Proxy> ProxyPass /httpbind http://mydomain.com:7070/http-bind/ ProxyPassReverse /httpbind http://mydomain.com:7070/http-bind/ I am new to using the proxy module but what i can make from the above lines is that requests to http://mydomain.com/httpbind will be forwarded to http://mydomain.com:7070/http-bind/. Kindly correct if wrong. 3) added rule Allow from .mydomain.com in /mods-available/proxy.conf Now i try to access http://mydomain.com/httpbind and it shows 403 Forbidden error.. What am i missing here ? Please help. thanks Edit : The problem got solved when i changed the following code in mods_available/proxy.conf <Proxy *> AddDefaultCharset off Order deny,allow Deny from all Allow from mydomain.com </Proxy> to <Proxy *> AddDefaultCharset off Order deny,allow #Deny from all Allow from all </Proxy> Didnt get what was wrong with the initial code though

    Read the article

  • How to structure the tables of a very simple blog in MySQL?

    - by Programmer
    I want to add a very simple blog feature on one of my existing LAMP sites. It would be tied to a user's existing profile, and they would be able to simply input a title and a body for each post in their blog, and the date would be automatically set upon submission. They would be allowed to edit and delete any blog post and title at any time. The blog would be displayed from most recent to oldest, perhaps 20 posts to a page, with proper pagination above that. Other users would be able to leave comments on each post, which the blog owner would be allowed to delete, but not pre-moderate. That's basically it. Like I said, very simple. How should I structure the MySQL tables for this? I'm assuming that since there will be blog posts and comments, I would need a separate table for each, is that correct? But then what columns would I need in each table, what data structures should I use, and how should I link the two tables together (e.g. any foreign keys)? I could not find any tutorials for something like this, and what I'm looking to do is really offer my users the simplest version of a blog possible. No tags, no moderation, no images, no fancy formatting, etc. Just a simple diary-type, pure-text blog with commenting by other users.

    Read the article

  • How are you using C++0x today? [closed]

    - by Roger Pate
    This is a question in two parts, the first is the most important and concerns now: Are you following the design and evolution of C++0x? What blogs, newsgroups, committee papers, and other resources do you follow? Even where you're not using any new features, how have they affected your current choices? What new features are you using now, either in production or otherwise? The second part is a follow-up, concerning the new standard once it is final: Do you expect to use it immediately? What are you doing to prepare for C++0x, other than as listed for the previous questions? Obviously, compiler support must be there, but there's still co-workers, ancillary tools, and other factors to consider. What will most affect your adoption? Edit: The original really was too argumentative; however, I'm still interested in the underlying question, so I've tried to clean it up and hopefully make it acceptable. This seems a much better avenue than duplicating—even though some answers responded to the argumentative tone, they still apply to the extent that they addressed the questions, and all answers are community property to be cleaned up as appropriate, too.

    Read the article

  • Castle, sharing a transient component between a decorator and a decorated component

    - by Marius
    Consider the following example: public interface ITask { void Execute(); } public class LoggingTaskRunner : ITask { private readonly ITask _taskToDecorate; private readonly MessageBuffer _messageBuffer; public LoggingTaskRunner(ITask taskToDecorate, MessageBuffer messageBuffer) { _taskToDecorate = taskToDecorate; _messageBuffer = messageBuffer; } public void Execute() { _taskToDecorate.Execute(); Log(_messageBuffer); } private void Log(MessageBuffer messageBuffer) {} } public class TaskRunner : ITask { public TaskRunner(MessageBuffer messageBuffer) { } public void Execute() { } } public class MessageBuffer { } public class Configuration { public void Configure() { IWindsorContainer container = null; container.Register( Component.For<MessageBuffer>() .LifeStyle.Transient); container.Register( Component.For<ITask>() .ImplementedBy<LoggingTaskRunner>() .ServiceOverrides(ServiceOverride.ForKey("taskToDecorate").Eq("task.to.decorate"))); container.Register( Component.For<ITask>() .ImplementedBy<TaskRunner>() .Named("task.to.decorate")); } } How can I make Windsor instantiate the "shared" transient component so that both "Decorator" and "Decorated" gets the same instance? Edit: since the design is being critiqued I am posting something closer to what is being done in the app. Maybe someone can suggest a better solution (if sharing the transient resource between a logger and the true task is considered a bad design)

    Read the article

  • Using a "take-home" coding component in interview process

    - by Jeff Sargent
    In recent interviews I have been asking candidates to code through some questions on the whiteboard. I don't feel I'm getting a clear enough picture of the candidates technical ability with this approach. Granted, the questions might not be good enough, maybe the interview needs to be longer, etc, but I'm wondering if a different approach would be better. What I'd like to try is to create a simple, working project in Visual Studio and have it checked into source control. The candidate can check that code out from home/wherever and then check back in work representing their response to the assignment that I'll provide. I'm thinking that if the window of time is short enough and the assignment clear enough then the solution will be safe enough from all-out Googling (i.e. they couldn't search for and find the entire solution online). I would then be able to review the candidates work. Has enough worked with something like this before, either to vet a candidate or as a candidate yourself? Any thoughts in general? P.S. my first StackOverflow question - hi guys and gals. EDIT: I've seen comments about asking someone to work for free - I wouldn't mind paying the person for their time.

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Reporting Services "cannot connect to the report server database"

    - by Dano
    We have Reporting Services running, and twice in the past 6 months it has been down for 1-3 days, and suddenly it will start working again. The errors range from not being able to view the tree root in a browser, down to being able to insert parameters on a report, but crashing before the report can generate. Looking at the logs, there is 1 error and 1 warning which seem to correspond somewhat. ERROR:Event Type: Error Event Source: Report Server (SQL2K5) Event Category: Management Event ID: 107 Date: 2/13/2009 Time: 11:17:19 AM User: N/A Computer: ******** Description: Report Server (SQL2K5) cannot connect to the report server database. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. WARNING: always comes before the previous error Event code: 3005 Event message: An unhandled exception has occurred. Event time: 2/13/2009 11:06:48 AM Event time (UTC): 2/13/2009 5:06:48 PM Event ID: 2efdff9e05b14f4fb8dda5ebf16d6772 Event sequence: 550 Event occurrence: 5 Event detail code: 0 Process information: Process ID: 5368 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ReportServerException Exception message: For more information about this error navigate to the report server on the local server machine, or enable remote errors. During the downtime we tried restarting everything from the server RS runs on, to the database it calls to fill reports with no success. When I came in monday morning it was working again. Anyone out there have any ideas on what could be causing these issues? Edit Tried both suggestions below several months ago to no avail. This issue hasn't arisen since, maybe something out of my control has changed....

    Read the article

  • Optimizing an embedded SELECT query in mySQL

    - by Crazy Serb
    Ok, here's a query that I am running right now on a table that has 45,000 records and is 65MB in size... and is just about to get bigger and bigger (so I gotta think of the future performance as well here): SELECT count(payment_id) as signup_count, sum(amount) as signup_amount FROM payments p WHERE tm_completed BETWEEN '2009-05-01' AND '2009-05-30' AND completed > 0 AND tm_completed IS NOT NULL AND member_id NOT IN (SELECT p2.member_id FROM payments p2 WHERE p2.completed=1 AND p2.tm_completed < '2009-05-01' AND p2.tm_completed IS NOT NULL GROUP BY p2.member_id) And as you might or might not imagine - it chokes the mysql server to a standstill... What it does is - it simply pulls the number of new users who signed up, have at least one "completed" payment, tm_completed is not empty (as it is only populated for completed payments), and (the embedded Select) that member has never had a "completed" payment before - meaning he's a new member (just because the system does rebills and whatnot, and this is the only way to sort of differentiate between an existing member who just got rebilled and a new member who got billed for the first time). Now, is there any possible way to optimize this query to use less resources or something, and to stop taking my mysql resources down on their knees...? Am I missing any info to clarify this any further? Let me know... EDIT: Here are the indexes already on that table: PRIMARY PRIMARY 46757 payment_id member_id INDEX 23378 member_id payer_id INDEX 11689 payer_id coupon_id INDEX 1 coupon_id tm_added INDEX 46757 tm_added, product_id tm_completed INDEX 46757 tm_completed, product_id

    Read the article

  • WF -- how do I use a custom activity without creating it in a separate Workflow Activity Library?

    - by Kevin Craft
    I am trying to accomplish something that seems like it should be very simple. I have a State Machine Workflow Console Application with a workflow in it. I have created a custom activity for it. This activity will NEVER be used ANYWHERE ELSE. I just want to use this activity on my workflow, but: It does not appear in the toolbox. I cannot drag it from the Solution Explorer onto the workflow designer. I absolutely do not want to create a separate State Machine Workflow Activity Library, since that will just clutter my solution. Like I said, I will never use this activity in any other project, so I would like to keep it confined to this one...but I just can't figure out how to get it onto the designer! Am I going crazy!? Here is the code for the activity: public partial class GameSearchActivity: Activity { public GameSearchActivity() { InitializeComponent(); } public static DependencyProperty QueryProperty = System.Workflow.ComponentModel.DependencyProperty.Register("Query", typeof(string), typeof(GameSearchActivity)); [Description("Query")] [Category("Dependency Properties")] [Browsable(true)] [DesignerSerializationVisibility(DesignerSerializationVisibility.Visible)] public string Query { get { return ((string)(base.GetValue(GameSearchActivity.QueryProperty))); } set { base.SetValue(GameSearchActivity.QueryProperty, value); } } public static DependencyProperty ResultsProperty = System.Workflow.ComponentModel.DependencyProperty.Register("Results", typeof(string), typeof(GameSearchActivity)); [Description("Results")] [Category("Dependency Properties")] [Browsable(true)] [DesignerSerializationVisibility(DesignerSerializationVisibility.Visible)] public IEnumerable<Game_GamePlatform> Results { get { return ((IEnumerable<Game_GamePlatform>)(base.GetValue(GameSearchActivity.ResultsProperty))); } set { base.SetValue(GameSearchActivity.ResultsProperty, value); } } protected override ActivityExecutionStatus Execute(ActivityExecutionContext executionContext) { IDataService ds = executionContext.GetService<IDataService>(); Results = ds.SearchGames(Query); return ActivityExecutionStatus.Closed; } } Thanks. EDIT: OK, so I've discovered that if I change the project type from Console Application to Class Library, the custom activity appears in the toolbox. However, this is not acceptable. It needs to be a Console/Windows Application. Anyone know a way around this?

    Read the article

  • SSIS - Skip Missing Files

    - by Greg
    I have a SSIS 2008 package that calls about 10 other SSIS packages (legacy issues, don't ask). Each of those child packages loads a specific file into a table. But sometimes one or more of these input files will be missing. How can I let a child package fail (because a file is missing) but let the rest of the parent package keep on running? I've tried increasing the maximum error count on the parent package, the tasks in the parent package that call each child, and in the child package itself. None of that seemed to make any difference. I still get this error when I run it with a file missing: SSIS Warning Code DTS_W_MAXIMUMERRORCOUNTREACHED. The Execution method succeeded, but the number of errors raised (2) reached the maximum allowed (1); resulting in failure. This occurs when the number of errors reaches the number specified in MaximumErrorCount. Change the MaximumErrorCount or fix the errors. Edit: failpackageonfailure and faulparentonfailure are already all set to false everywhere.

    Read the article

  • Building a custom Linux Live CD

    - by Mike Heinz
    Can anyone point me to a good tutorial on creating a bootable Linux CD from scratch? I need help with a fairly specialized problem: my firm sells an expansion card that requires custom firmware. Currently we use an extremely old live CD image of RH7.2 that we update with current firmware. Manufacturing puts the cards in a machine, boots off the CD, the CD writes the firmware, they power off and pull the cards. Because of this cycle, it's essential that the CD boot and shut down as quickly as possible. The problem is that with the next generation of cards, I have to update the CD to a 2.6 kernel. It's easy enough to acquire a pre-existing live CD - but those all are designed for showing off Linux on the desktop - which means they take forever to boot. Can anyone fix me up with a current How-To? Update: So, just as a final update for anyone reading this later - the tool I ended up using was "livecd-creator". My reason for choosing this tool was that it is available for RedHat-based distributions like CentOs, Fedora and RHEL - which are all distributions that my company supports already. In addition, while the project is very poorly documented it is extremely customizable. I was able to create a minimal LiveCD and edit the boot sequence so that it booted directly into the firmware updater instead of a bash shell. The whole job would have only taken an hour or two if there had been a README explaining the configuration file!

    Read the article

  • curl_multi_exec stops if one url is 404, how can I change that?

    - by Rob
    Currently, my cURL multi exec stops if one url it connects to doesn't work, so a few questions: 1: Why does it stop? That doesn't make sense to me. 2: How can I make it continue? EDIT: Here is my code: $SQL = mysql_query("SELECT url FROM shells") ; $mh = curl_multi_init(); $handles = array(); while($resultSet = mysql_fetch_array($SQL)){ //load the urls and send GET data $ch = curl_init($resultSet['url'] . $fullcurl); //Only load it for two seconds (Long enough to send the data) curl_setopt($ch, CURLOPT_TIMEOUT, 5); curl_multi_add_handle($mh, $ch); $handles[] = $ch; } // Create a status variable so we know when exec is done. $running = null; //execute the handles do { // Call exec. This call is non-blocking, meaning it works in the background. curl_multi_exec($mh,$running); // Sleep while it's executing. You could do other work here, if you have any. sleep(2); // Keep going until it's done. } while ($running > 0); // For loop to remove (close) the regular handles. foreach($handles as $ch) { // Remove the current array handle. curl_multi_remove_handle($mh, $ch); } // Close the multi handle curl_multi_close($mh);

    Read the article

  • How to send Event signal through Processes - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. I'm trying to work out how the other process will know of the event being fired so it can do the tasks it needs to do, I don't understand how one process that is separate from another can tell what the states the events are in especially as it needs to act as soon as the event has changed state. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • OptimisticLockException in inner transaction ruins outer transaction

    - by Pace
    I have the following code (OLE = OptimisticLockException)... public void outer() { try { middle() } catch (OLE) { updateEntities(); outer(); } } @Transactional public void middle() { try { inner() } catch (OLE) { updateEntities(); middle(); } @Transactional public void inner() { //Do DB operation } inner() is called by other non-transactional methods which is why both middle() and inner() are transactional. As you can see, I deal with OLEs by updating the entities and retrying the operation. The problem I'm having is that when I designed things this way I was assuming that the only time one could get an OLE was when a transaction closed. This is apparently not the case as the call to inner() is throwing an OLE even when the stack is outer()->middle()->inner(). Now, middle() is properly handling the OLE and the retry succeeds but when it comes time to close the transaction it has been marked rollbackOnly by Spring. When the middle() method call finally returns the closing aspect throws an exception because it can't commit a transaction marked rollbackOnly. I'm uncertain what to do here. I can't clear the rollbackOnly state. I don't want to force create a transaction on every call to inner because that kills my performance. Am I missing something or can anyone see a way I can structure this differently? EDIT: To clarify what I'm asking, let me explain my main question. Is it possible to catch and handle OLE if you are inside of an @Transactional method? FYI: The transaction manager is a JpaTransactionManager and the JPA provider is Hibernate.

    Read the article

  • Rails can't find my route but it exists!

    - by DJTripleThreat
    Ok I have events that I want to publish/unpublish with an extra action (nonRESTful) I watched Ryan Bates' railscast on this: http://railscasts.com/episodes/35-custom-rest-actions and it got me most of the way. I think the problem is that my route is nested in an /admin section so even though when I run rake routes and get: publish_admin_event PUT /admin/events/:id/publish(.:format) {:controller=>"event_services", :action=>"publish"} This won't work in my /views/admin/index.html.erb file: <%= link_to 'Publish', publish_admin_event(event), :method => :put %> because it claims that path doesn't exist! And neither will this: <%= link_to 'Publish', {:controller => :event_services, :action => :publish}, {:method => :put, :id => event} %> and says that "No route matches {:controller=>"event_services", :action=>"publish"}" so what gives? (And I've tried restarting my server so that isn't it.) EDIT: This DOES work: <%= link_to 'Publish', "/admin/events/" + event.id.to_s + "/publish", :method => :put %> But I'd rather NOT do this.

    Read the article

  • Need help implementing this algorithm with map Hadoop MapReduce

    - by Julia
    Hi all! i have algorithm that will go through a large data set read some text files and search for specific terms in those lines. I have it implemented in Java, but I didnt want to post code so that it doesnt look i am searching for someone to implement it for me, but it is true i really need a lot of help!!! This was not planned for my project, but data set turned out to be huge, so teacher told me I have to do it like this. EDIT(i did not clarified i previos version)The data set I have is on a Hadoop cluster, and I should make its MapReduce implementation I was reading about MapReduce and thaught that i first do the standard implementation and then it will be more/less easier to do it with mapreduce. But didnt happen, since algorithm is quite stupid and nothing special, and map reduce...i cant wrap my mind around it. So here is shortly pseudo code of my algorithm LIST termList (there is method that creates this list from lucene index) FOLDER topFolder INPUT topFolder IF it is folder and not empty list files (there are 30 sub folders inside) FOR EACH sub folder GET file "CheckedFile.txt" analyze(CheckedFile) ENDFOR END IF Method ANALYZE(CheckedFile) read CheckedFile WHILE CheckedFile has next line GET line FOR(loops through termList) GET third word from line IF third word = term from list append whole line to string buffer ENDIF ENDFOR END WHILE OUTPUT string buffer to file Also, as you can see, each time when "analyze" is called, new file has to be created, i understood that map reduce is difficult to write to many outputs??? I understand mapreduce intuition, and my example seems perfectly suited for mapreduce, but when it comes to do this, obviously I do not know enough and i am STUCK! Please please help.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Threshold of blurry image - part 2

    - by 1''
    How can I threshold this blurry image to make the digits as clear as possible? In a previous post, I tried adaptively thresholding a blurry image (left), which resulted in distorted and disconnected digits (right): Since then, I've tried using a morphological closing operation as described in this post to make the brightness of the image uniform: If I adaptively threshold this image, I don't get significantly better results. However, because the brightness is approximately uniform, I can now use an ordinary threshold: This is a lot better than before, but I have two problems: I had to manually choose the threshold value. Although the closing operation results in uniform brightness, the level of brightness might be different for other images. Different parts of the image would do better with slight variations in the threshold level. For instance, the 9 and 7 in the top left come out partially faded and should have a lower threshold, while some of the 6s have fused into 8s and should have a higher threshold. I thought that going back to an adaptive threshold, but with a very large block size (1/9th of the image) would solve both problems. Instead, I end up with a weird "halo effect" where the centre of the image is a lot brighter, but the edges are about the same as the normally-thresholded image: Edit: remi suggested morphologically opening the thresholded image at the top right of this post. This doesn't work too well. Using elliptical kernels, only a 3x3 is small enough to avoid obliterating the image entirely, and even then there are significant breakages in the digits:

    Read the article

  • How can I load combo box's data when it has been defined in DataTemplate codebehind ?

    - by Naseem
    Hi, In my silverlight application,I need to have dynamic columns in my DataGrid . So I had to create all the columns and their DataTemplate dynamically .When user wants to edit the column , a combo box will be displayed which has different values based on selected column. For creating each column I have wrote : foreach (var itemFilter in ProductFilterCollection) { DataGridTemplateColumn templateColumn = new DataGridTemplateColumn(); templateColumn.Header = itemFilter.Description.ToString(); templateColumn.CellTemplate = CreateCellTemplate(typeof(TextBlock), itemFilter.Description.ToString()); templateColumn.CellEditingTemplate = CreateEditingTemplate(typeof(ComboBox), itemFilter.Description.ToString()); grdTest.Columns.Add(templateColumn); } Here is the code for creating DataTemplate dynamically. public DataTemplate CreateCellTemplate(Type type, string strBinding) { return (DataTemplate)XamlReader.Load(@"<DataTemplate xmlns=""http://schemas.microsoft.com/client/2007""> <" + type.Name + @" Text=""{Binding " + strBinding + @"}""/> </DataTemplate>"); } public DataTemplate CreateEditingTemplate(Type type, string strBinding) { return (DataTemplate)XamlReader.Load(@"<DataTemplate xmlns=""http://schemas.microsoft.com/client/2007""> <" + type.Name + @" Loaded=""ddlTest_Loaded"" Tag=""{Binding " + strBinding + @"}""/> </DataTemplate>"); } I need to use Loaded="ddlTest_Loaded" in CreateEditingTemplate() ,in order to load the combo box . However it causes exception . When I remove Loaded event it's fine however the combo box is empty. How can I load the combo box when I define it in DataTemplate codebehind.

    Read the article

  • Jquery click event propagation

    - by ozsenegal
    I've a table with click events bind to it rows (tr). Also,there're A elements with it owns click events assigned inside those rows. Problem is when i click on A element,it also fires click event from TD.And Im dont want this behavior,i just want to fire A click's event. Code: //Event row TR $("tr:not(:first)").click(function(){ $(".window,.backFundo,.close").remove(); var position = $(this).offset().top; position = position < 0 ? 20 : position; $("body").append($("<div></div>").addClass("backFundo")); $("body").append($("<div></div>").addClass("window").html("<span class=close><img src=Images/close.png id=fechar /></span>").append("<span class=titulo>O que deseja fazer?</span><span class=crud><a href=# id=edit>Editar</a></span><span class=crud><a href=# id=delete codigo=" + $(this).children("td:first").html() + ">Excluir</a></span>").css({top:"20px"}).fadeIn("slow")); $(document).scrollTop(0); }); //Element event $("a").live("click",function(){alert("clicked!");}); Whenever you click the anchor it fires event from it parent row.Any ideas?

    Read the article

< Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >