Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 620/750 | < Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >

  • Mootools Javascript can't push to array

    - by nona
    I have an array set with the heights of each hidden div, but when I use it, the div instantly jumps down, rather than slowly sliding as when there is a literal number. EDIT: testing seems to reveal that it's a problem with the push method, as content_height.push(item.getElement('.moreInfo').offsetHeight);alert(content_height[i]);gives undefined, but alert(item.getElement('.moreInfo').offsetHeight); gives the correct values Javascript: window.addEvent('domready', function(){ var content_height = [];i=0; $$( '.bio_accordion' ).each(function(item){ i++; content_height.push( item.getElement('.moreInfo').offsetHeight); var thisSlider = new Fx.Slide( item.getElement( '.moreInfo' ), { mode: 'horizontal' } ); thisSlider.hide(); item.getElement('.moreInfo').set('tween').tween('height', '0px'); var morph = new Fx.Morph(item.getElement( '.divToggle' )); var selected = 0; item.getElement( '.divToggle' ).addEvents({ 'mouseenter': function(){ if(!selected) this.morph('.div_highlight'); }, 'mouseleave': function(){ if(!selected) { this.morph('.divToggle'); } }, 'click': function(){ if (!selected){ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; item.getElement('.moreInfo').set('tween', { duration: 1500, transition: Fx.Transitions.Bounce.easeOut }).tween('height', content_height[i]); //replacing this with '650' keeps it smooth selected = 1; thisSlider.slideIn(); } else{ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; thisSlider.slideOut(); item.getElement('.moreInfo').set('tween', { duration: 1000, transition: Fx.Transitions.Bounce.easeOut }).tween('height', '0px'); selected = 0; } } }); } ); }); Why could this be? Thanks so much!

    Read the article

  • Why are compilers so stupid?

    - by martinus
    I always wonder why compilers can't figure out simple things that are obvious to the human eye. They do lots of simple optimizations, but never something even a little bit complex. For example, this code takes about 6 seconds on my computer to print the value zero (using java 1.6): int x = 0; for (int i = 0; i < 100 * 1000 * 1000 * 1000; ++i) { x += x + x + x + x + x; } System.out.println(x); It is totally obvious that x is never changed so no matter how often you add 0 to itself it stays zero. So the compiler could in theory replace this with System.out.println(0). Or even better, this takes 23 seconds: public int slow() { String s = "x"; for (int i = 0; i < 100000; ++i) { s += "x"; } return 10; } First the compiler could notice that I am actually creating a string s of 100000 "x" so it could automatically use s StringBuilder instead, or even better directly replace it with the resulting string as it is always the same. Second, It does not recognize that I do not actually use the string at all, so the whole loop could be discarded! Why, after so much manpower is going into fast compilers, are they still so relatively dumb? EDIT: Of course these are stupid examples that should never be used anywhere. But whenever I have to rewrite a beautiful and very readable code into something unreadable so that the compiler is happy and produces fast code, I wonder why compilers or some other automated tool can't do this work for me.

    Read the article

  • Problem with Boost::Asio for C++

    - by Martin Lauridsen
    Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

    Read the article

  • Returning HTML in the JS portion of a respond_to block throws errors in IE

    - by Horace Loeb
    Here's a common pattern in my controller actions: respond_to do |format| format.html {} format.js { render :layout => false } end I.e., if the request is non-AJAX, I'll send the HTML content in a layout on a brand new page. If the request is AJAX, I'll send down the same content, but without a layout (so that it can be inserted into the existing page or put into a lightbox or whatever). So I'm always returning HTML in the format.js portion, yet Rails sets the Content-Type response header to text/javascript. This causes IE to throw this fun little error message: Of course I could set the content-type of the response every time I did this (or use an after_filter or whatever), but it seems like I'm trying to do something relatively standard and I don't want to add additional boilerplate code. How do I fix this problem? Alternatively, if the only way to fix the problem is to change the content-type of the response, what's the best way to achieve the behavior I want (i.e., sending down content with layout for non-AJAX and the same content without a layout for AJAX) without having to deal with these errors? Edit: This blog post has some more info

    Read the article

  • Way to store a large dictionary with low memory footprint + fast lookups (on Android)

    - by BobbyJim
    I'm developing an android word game app that needs a large (~250,000 word dictionary) available. I need: reasonably fast look ups e.g. constant time preferable, need to do maybe 200 lookups a second on occasion to solve a word puzzle and maybe 20 lookups within 0.2 second more often to check words the user just spelled. EDIT: Lookups are typically asking "Is in the dictionary?". I'd like to support up to two wildcards in the word as well, but this is easy enough by just generating all possible letters the wildcards could have been and checking the generated words (i.e. 26 * 26 lookups for a word with two wildcards). as it's a mobile app, using as little memory as possible and requiring only a small initial download for the dictionary data is top priority. My first naive attempts used Java's HashMap class, which caused an out of memory exception. I've looked into using the SQL lite databases available on android, but this seems like overkill. What's a good way to do what I need?

    Read the article

  • PHP URL parameters append return special character

    - by Alexandre Lavoie
    I'm programming a function to build an URL, here it is : public static function requestContent($p_lParameters) { $sParameters = "?key=TEST&format=json&jsoncallback=none"; foreach($p_lParameters as $sParameterName => $sParameterValue) { $sParameters .= "&$sParameterName=$sParameterValue"; } echo "<span style='font-size: 16px;'>URL : http://api.oodle.com/api/v2/listings" . $sParameters . "</span><br />"; $aXMLData = file_get_contents("http://api.oodle.com/api/v2/listings" . $sParameters); return json_decode($aXMLData,true); } And I am calling this function with this array list : print_r() result : Array ( [region] => canada [category] => housing/sale/home ) But this is very strange I get an unexpected character (note the special character none*®*ion) : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home For information I use this header : <meta http-equiv="Content-Type" content="text/html;charset=UTF-8" /> <?php header('Content-Type: text/html;charset=UTF-8'); ?> EDIT : $sRequest = "http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none&region=canada&category=housing/sale/home"; echo "<span style='font-size: 16px;'>URL : " . $sRequest . "</span><br />"; return the exact URL with problem : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home Thank you for your help!

    Read the article

  • How to properly load HTML data from third party website using MVC+AJAX?

    - by Dmitry
    I'm building ASP.NET MVC2 website that lets users store and analyze data about goods found on various online trade sites. When user is filling a form to create or edit an item, he should have a button "Import data" that automatically fills some fields based on data from third party website. The question is: what should this button do under the hood? I see at least 2 possible solutions. First. Do the import on client side using AJAX+jQuery load method. I tried it in IE8 and received browser warning popup about insecure script actions. Of course, it is completely unacceptable. Second. Add method ImportData(string URL) to ItemController class. It is called via AJAX, does the import + data processing server-side and returns JSON-d result to client. I tried it and received server exception (503) Server unavailable when loading HTML data into XMLDocument. Also I have a feeling that dealing with not well-formed HTML (missing closing tags, etc.) will be a huge pain. Any ideas how to parse such HTML documents?

    Read the article

  • rails not recognizing project

    - by tipu
    I can create a new project using rails and I can use stuff like rails migration ... and i (correctly) get a error because the sqlite gem is missing. but when i try using rails migration ... with a project i checked out from github, it doesn't recognize that it is a rails project i get: Usage: rails new APP_PATH [options] Options: -d, [--database=DATABASE] # Preconfigure for selected database (options: mysql/oracle/postgresql/sqlite3/frontbase/ibm_db) # Default: sqlite3 -O, [--skip-active-record] # Skip Active Record files [--dev] # Setup the application with Gemfile pointing to your Rails checkout -J, [--skip-prototype] # Skip Prototype files -T, [--skip-test-unit] # Skip Test::Unit files -G, [--skip-git] # Skip Git ignores and keeps -b, [--builder=BUILDER] # Path to an application builder (can be a filesystem path or URL) [--edge] # Setup the application with Gemfile pointing to Rails repository -m, [--template=TEMPLATE] # Path to an application template (can be a filesystem path or URL) -r, [--ruby=PATH] # Path to the Ruby binary of your choice # Default: /usr/bin/ruby1.8 [--skip-gemfile] # Don't create a Gemfile and it goes on. any ideas? edit: it's probably an important detail that earlier my rails wasn't working at all. i had to cp /usr/bin/ruby to /usr/bin/local/ruby

    Read the article

  • 60K+ Sprites on the 360?

    - by Jeffrey Kern
    Hey everyone, Just wondering - throwing ideas in my head - about starting a new XNA project for the 360. I would like it to be retro-old school, and emulating scanlines and color palettes and such. As part of this idea, what I would ideally like to do is manually draw each and every pixel of the screen. So, worst-case scenario I would have to draw about 60K sprites on a 252x240 resolution (I think thats correct). 60K sprites on the screen at a time. So, before I even attempt to code this - would the XBOX 360 be able to keep up with this even? That is a lot of sprites, but they aren't big sprites, and the texture data needed would be non-existant. However, I guess how this project would be implemented would make it or break it, but all I was thinking was coming up with a 2D array and mapping which color value would need to be drawn at that point. Of course, this is watered down talk right now. But what you all suggest? EDIT: Each sprite would represent one pixel. E.g., a sprite at 0,0. Another at 0,1. etc.

    Read the article

  • Get subdomain of XML page from XSL

    - by fudgey
    I am working with a guild hosting site that provides an XML/XSL transformation widget where all I need to do is enter the URL for the XML and XSL and it does the rest. I have written an XSL transform to display a World of Warcraft armory page: Here is an example XML page (view source to see it) of the group I'm trying to help now. So, the user is entering their own XML page url (which has an eu subdomain in this case, but it is not within the XML itself). So when I make links to the character url, I need to add the entire url <a target="_blank" href="http://eu.wowarmory.com/character-sheet.xml?{@url}"> <xsl:value-of select="@name"/> </a> But I can't just set the domain to eu since there are multiple regions. Here are the possibilities: us = www, europe = eu, korea = kr, china = cn and taiwan = tw. Here is a snippet of the XML which shows the url parameters: <character achPoints="4275" classId="3" genderId="0" level="80" name="Virtex" raceId="4" rank="2" url="r=Drek%27Thar&amp;cn=Virtex"/> I guess I could just have the user add a small bit of HTML with their region in another part of their page, something like <div id="region">eu</div>, but I'm trying to make this work without any extra coding on their part. Edit: Ok, my question explicitly stated: How do I get the URL subdomain using XSL?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to debug an external library (OpenCV) in Visual C++?

    - by neuviemeporte
    I am developing a project in VC++2008. The project uses the OpenCV library (but I guess this applies to any other library). I am working with the Debug configuration, the linker properties include the debug versions of the library .lib's as additional dependencies. In VC++ Directories under Tools|Options i set up the include directory, the .lib directory, the source directories for the library as well. I get an error while calling one of the functions from the library and I'd like to see exactly what that function is doing. The line that produces the error is: double error = cvStereoCalibrate(&calObjPointsM, &img1PointsM, &img2PointsM, &pointCountsM, &cam1M, &dist1M, &cam2M, &dist2M, imgSize, &rotM, &transM, NULL, NULL, cvTermCriteria(CV_TERMCRIT_ITER + CV_TERMCRIT_EPS, 100, 1e-5)); I set up a breakpoint at this line to see how the cvStereoCalibrate() function fails. Unfortunately the debugger won't show the source code for this function when I hit "Step into". It skips immediately to the cvTermCriteria() (which is a simple inline, macro-kinda function) and show its contents. Is there anything else I need to do to be able to enter the external library functions in the debugger? EDIT: I think the cvTermCriteria() function shows in the debugger, because it's defined in a header file, therefore immediately accesible to the project.

    Read the article

  • Rails can't find my route but it exists!

    - by DJTripleThreat
    Ok I have events that I want to publish/unpublish with an extra action (nonRESTful) I watched Ryan Bates' railscast on this: http://railscasts.com/episodes/35-custom-rest-actions and it got me most of the way. I think the problem is that my route is nested in an /admin section so even though when I run rake routes and get: publish_admin_event PUT /admin/events/:id/publish(.:format) {:controller=>"event_services", :action=>"publish"} This won't work in my /views/admin/index.html.erb file: <%= link_to 'Publish', publish_admin_event(event), :method => :put %> because it claims that path doesn't exist! And neither will this: <%= link_to 'Publish', {:controller => :event_services, :action => :publish}, {:method => :put, :id => event} %> and says that "No route matches {:controller=>"event_services", :action=>"publish"}" so what gives? (And I've tried restarting my server so that isn't it.) EDIT: This DOES work: <%= link_to 'Publish', "/admin/events/" + event.id.to_s + "/publish", :method => :put %> But I'd rather NOT do this.

    Read the article

  • How do I get Asp.net MVC BeginForm to add closing tag correctly?

    - by Matt
    I seem to be missing something obvious here, but cannot see what it is. My problem is that the closing form tag for BeginForm is not being added to my markup. I am looping through a collection and creating a form for each item, but the forms arent closing properly. Any suggestions please? Thanks <% foreach (var item in Model) { %> <% using (Html.BeginForm("EditUser","Users")) { %> <tr> <td> <input id="contactID" type="hidden" value="<%= item.ContactID %>" /> <%=item.Email %> </td> <td> <%=item.Market.MarketName%> </td> <td> <%=item.ContactType.ContactTypeName%> </td> <td> <input type="submit" value="Edit" /> </td> </tr> <%} %> <% } %>

    Read the article

  • How do I make JPA POJO classes + Netbeans forms play well together?

    - by Zak
    I started using netbeans to design forms to edit the instances of various classes I have made in a small app I am writing. Basically, the app starts, an initial set of objects is selected from the DB and presented in a list, then an item in the list can be selected for editing. When the editor comes up it has form fields for many of the data fields in the class. The problem I run into is that I have to create a controller that maps each of the data elements to the correct form element, and create an inordinate number of small conversion mapping lines of code to convert numbers into strings and set the correct element in a dropdown, then another inordinate amount of code to go back and update the underlying object with all the values from the form when the save button is clicked. My question is; is there a more directly way to make the editing of the form directly modify the contents of my class instance? I would like to be able to have a default mapping "controller" that I can configure, then override the getter/setter for a particular field if needed. Ideally, there would be standard field validation for things like phone numbers, integers, floats, zip codes, etc... I'm not averse to writing this myself, I would just like to see if it is already out there and use the right tool for the right job.

    Read the article

  • How to reload a tableView i.e call the viewDidLoad method if a condition is met

    - by Kquane Ingram
    The problem is this i need a way to basically erase all the entry data a user placed into my arrays if a condition is met. Im new to Objective-C and iOS programming, but i believed the solution might be in calling the viewDidLoad method, thus it would virtually refresh the applications with the values of the array reset to default. If there is any other logical way of doing this i would appreciate the help. In short i need to refresh the arrays as they were when the application first launched and the user did not select anything. This is the part where i need it to refresh. if ([gradeRecieved objectAtIndex:i]==nil) { break; // if this condition is met the program must begin anew. Edit* I need to recall the - (void)viewDidLoad method here is more of the code. -(IBAction)button:(id)sender{ int i = 0; int sum = 0; int gradeEarned; int creditHours = 3; for ( i=0;i<8 ; i++) { if ([[points objectAtIndex:i] tag]==GradeA.intValue) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeA]; } if ([[points objectAtIndex:i]tag]==GradeB.intValue) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeB]; } if ([[points objectAtIndex:i]tag]==GradeC.intValue){ [gradeRecieved replaceObjectAtIndex:i withObject:GradeC]; } if ([gradeRecieved objectAtIndex:i]==nil) { break; // if this condition is met the program must restart. } } while ( i<[gradeRecieved count]) { if ([gradeRecieved objectAtIndex:i] == GradeA ) { [finArray replaceObjectAtIndex:i withObject:GradeA]; i++; continue; } if ([gradeRecieved objectAtIndex:i] == GradeB ) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeB]; i++; continue; } if ([gradeRecieved objectAtIndex:i] == GradeC ) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeC]; i++; continue; } }

    Read the article

  • pushing view controller inside a tab bar from app delegate, after a notification.

    - by shani
    hi i have an app with tab bar and a navigation controller inside every tab. i have set a notification that when it lunches the user can get lunch the app by pressing the action on the alert. i want to redirect the user to one of the views inside one of the controllers. i have tried this: (void)application:(UIApplication *)app didReceiveLocalNotification:(UILocalNotification *)notif { NSArray *data = [notif.userInfo objectForKey:@"todoDate"]; NSInteger ind = [[data objectAtIndex:2] integerValue]; QuickViewController *detailViewController ; detailViewController = [[QuickViewController alloc] initWithNibName:@"QuickViewController" bundle:nil]; detailViewController.title = @"Edit"; detailViewController.personName = [data objectAtIndex:0]; detailViewController.DelitionDate=[data objectAtIndex:1]; detailViewController.personCategory=@"NO Category"; detailViewController.personID = ind r ; rootControler.selectedIndex = 1; [rootControler.tabBarController.selectedViewController.navigationController pushViewController:detailViewController animated:YES]; } but nothing is happening (no crashing) except of the :rootControler.selectedIndex = 1; when i tried : presentModalViewController i got the view perfectly but without the navigation controller. thanks shani

    Read the article

  • Entity Framework and associations between string keys

    - by fredrik
    Hi, I am new to Entity Framework, and ORM's for that mather. In the project that I'm involed in we have a legacy database, with all its keys as strings, case-insensitive. We are converting to MSSQL and want to use EF as ORM, but have run in to a problem. Here is an example that illustrates our problem: TableA has a primary string key, TableB has a reference to this primary key. In LINQ we write something like: var result = from t in context.TableB select t.TableA; foreach( var r in result ) Console.WriteLine( r.someFieldInTableA ); if TableA contains a primary key that reads "A", and TableB contains two rows that references TableA but with different cases in the referenceing field, "a" and "A". In our project we want both of the rows to endup in the result, but only the one with the matching case will end up there. Using the SQL Profiler, I have noticed that both of the rows are selected. Is there a way to tell Entity Framework that the keys are case insensitive? Edit:We have now tested this with NHibernate and come to the conclution that NHibernate works with case-insensitive keys. So NHibernate might be a better choice for us.I am however still interested in finding out if there is any way to change the behaviour of Entity Framework.

    Read the article

  • Extracting function declarations from a PHP file

    - by byronh
    I'm looking to create an on-site API reference for my framework and application. Basically, say I have a class file model.class.php: class Model extends Object { ... code here ... // Separates results into pages. // Returns Paginator object. final public function paginate($perpage = 10) { ... more code here ... } } and I want to be able to generate a reference that my developers can refer to quickly in order to know which functions are available to be called. They only need to see the comments directly above each function and the declaration line. Something like this (similar to a C++ header file): // Separates results into pages. // Returns Paginator object. final public function paginate($perpage = 10); I've done some research and this answer looked pretty good (using Reflection classes), however, I'm not sure how I can keep the comments in. Any ideas? EDIT: Sorry, but I want to keep the current comment formatting. Myself and the people who are working on the code hate the verbosity associated with PHPDocumentor. Not to mention a comment-rewrite of the entire project would take years, so I want to preserve just the // comments in plaintext.

    Read the article

  • UITableView superClass for delegate?

    - by fuzzygoat
    A quick question, I am setting a delegate for UITableView and I have a question regarding setting the delegate and dataSource properties. I have noticed that the properties for delegate and dataSource are not available, I was thinking that adopting the protocols would make them available. But I am now thinking that I maybe have the superclass for my delegate class wrong. Currently I have: -(void)viewDidLoad { TestDelegate *tempDelegate = [[TestDelegate alloc] init]; [self setMyDelegate:tempDelegate]; // setDelegate // setDataSource [tempDelegate release]; [super viewDidLoad]; } My interface for TestDelegate looks like: @interface TestDelegate : NSObject <UITableViewDelegate, UITableViewDataSource> { NSArray *listData; int myCounter; } Can I ask if the above should be: @interface TestDelegate : UITableView <UITableViewDelegate, UITableViewDataSource> { NSArray *listData; int myCounter; } gary EDIT: I think it might be right as NSObject, I have a viewtableView in IB, thats what I will need to connect my delegate class to. I added to tableView in IB so maybe I just need to make it available in Xcode.

    Read the article

  • Efficient algorithm for Next button on a MySQL result set

    - by David Grayson
    I have a website that lets people view rows in a table (each row is a picture). There are more than 100,000 rows. You can view different subsets of the rows, and you can view them with different sort orders. While you are viewing one of the rows, you can click the "Next" or "Previous" buttons to go the next/previous row in the list. How would you implement the "Next" and "Previous" features of the website? More specifically, if you have an arbitrary query that returns a list of up to 100,000+ rows, and you know some information about the current row someone is viewing, how do you determine the NEXT row efficiently? Here is the pseudo-code of the solution I came up with when the website was young, and it worked well when there were only 1000 rows, but now that there are 100,000 rows I think it is eating up too much memory. int nextRowId(string query, int currentRowId) { array allRowIds = mysql_query(query); // Takes up a lot of memory! int currentIndex = (index of currentRowId in allRowIds); // Takes time! return allRowIds[currentIndex+1]; } While you are thinking about this problem, remember that the website can store more information about the current row than just its ID (for example, the position of the current row in the result set), and this information can be used as a hint to help determine the ID of the next row. Edit: Sorry for not mentioning this earlier, but this isn't just a static website: rows can often be added to the list, and rows can be re-ordered in the list. (Much rarer, rows can be removed from the list.) I think that I should worry about that kind of thing, but maybe you can convince me otherwise.

    Read the article

  • Where to store site settings: DB? XML? CONFIG? CLASS FILES?

    - by Emin
    I am re-building a news portal of which already have a large number of visits every day. One of the major concerns when re-building this site was to maximize performance and speed. Having said this, we have done many things from caching, to all sort of other measures to ensure speed. Now towards the end of the project, I am having a dilemma of where to store my site settings that would least affect performance. The site settings will include things such as: Domain, DefaultImgPath, Google Analytics code, default emails of editors as well as more dynamic design/display feature settings such as the background color of specific DIVs and default color for links etc.. As far as I know, I have 4 choices in storing all these info. Database: Storing general settings in the DB and caching them may be a solution however, I want to limit the access to the database for only necessary and essential functions of the project which generally are insert/update/delete news items, author articles etc.. XML: I can store these settings in an XML file but I have not done this sort of thing before so I don't know what kind of problems -if any- I might face in the future. CONFIG: I can also store these settings in web.config CLASS FILE: I can hard code all these settings in a SiteSettings class, but since the site admin himself will be able to edit these settings, It may not be the best solution. Currently, I am more close to choosing web.config but letting people fiddle with it too often is something I do not want. E.g. if somehow, I miss out a validation for something and it breaks the web.config, the whole site will go down. My concern basically is that, I cannot forsee any possible consequences of using any of the methods above (or is there any other?), I was hoping to get this question over to more experienced people out here who hopefully help make my decision.

    Read the article

  • Should I use IDisposable for purely managed resources?

    - by John Gietzen
    Here is the scenario: I have an object called a Transaction that needs to make sure that only one entity has permission to edit it at any given time. In order to facilitate a long-lived lock, I have the class generating a token object that can be used to make the edits. You would use it like this: var transaction = new Transaction(); using (var tlock = transaction.Lock()) { transaction.Update(data, tlock); } Now, I want the TransactionLock class to implement IDisposable so that its usage can be clear. But, I don't have any unmanaged resources to dispose. however, the TransctionLock object itself is a sort of "unmanaged resource" in the sense that the CLR doesn't know how to properly finalize it. All of this would be fine and dandy, I would just use IDisposable and be done with it. However, my issue comes when I try to do this in the finalizer: ~TransactionLock() { this.Dispose(false); } I want the finalizer to release the transaction from the lock, if possible. How, in the finalizer, do I detect if the parent transaction (this.transaction) has already been finalized? Is there a better pattern I should be using? The Transaction class looks something like this: public sealed class Transaction { private readonly object lockMutex = new object(); private TransactionLock currentLock; public TransactionLock Lock() { lock (this.lockMutex) { if (this.currentLock != null) throw new InvalidOperationException(/* ... */); this.currentLock = new TransactionLock(this); return this.currentLock; } } public void Update(object data, TransactionLock tlock) { lock (this.lockMutex) { this.ValidateLock(tlock); // ... } } internal void ValidateLock(TransactionLock tlock) { if (this.currentLock == null) throw new InvalidOperationException(/* ... */); if (this.currentLock != tlock) throw new InvalidOperationException(/* ... */); } internal void Unlock(TransactionLock tlock) { lock (this.lockMutex) { this.ValidateLock(tlock); this.currentLock = null; } } }

    Read the article

  • How can I execute an ANTLR parser action for each item in a rule that can match more than one item?

    - by Chris Farmer
    I am trying to write an ANTLR parser rule that matches a list of things, and I want to write a parser action that can deal with each item in the list independently. Some example input for these rules is: $(A1 A2 A3) I'd like this to result in an evaluator that contains a list of three MyIdentEvaluator objects -- one for each of A1, A2, and A3. Here's a snippet of my grammar: my_list returns [IEvaluator e] : { $e = new MyListEvaluator(); } '$' LPAREN op=my_ident+ { /* want to do something here for each 'my_ident'. */ /* the following seems to see only the 'A3' my_ident */ $e.Add($op.e); } RPAREN ; my_ident returns [IEvaluator e] : IDENT { $e = new MyIdentEvaluator($IDENT.text); } ; I think my_ident is defined correctly, because I can see the three MyIdentEvaluators getting created as expected for my input string, but only the last my_ident ever gets added to the list (A3 in my example input). How can I best treat each of these elements independently, either through a grammar change or a parser action change? It also occurred to me that my vocabulary for these concepts is not what it should be, so if it looks like I'm misusing a term, I probably am. EDIT in response to Wayne's comment: I tried to use op+=my_ident+. In that case, the $op in my action becomes an IList (in C#) that contains Antlr.Runtime.Tree.CommonTree instances. It does give me one entry per matched token in $op, so I see my three matches, but I don't have the MyIdentEvaluator instances that I really want. I was hoping I could then find a rule attribute in the ANTLR docs that might help with this, but nothing seemed to help me get rid of this IList. Result... Based on chollida's answer, I ended up with this which works well: my_list returns [IEvaluator e] : { $e = new MyListEvaluator(); } '$' LPAREN (op=my_ident { $e.Add($op.e); } )+ RPAREN ; The Add method gets called for each match of my_ident.

    Read the article

  • When an NSWindow object has a delegate that is a NSWindow subclass, who is responsible to act on received events?

    - by spade78
    So I'm building a program that features the use of the IKImageBrowserView component as a subview in an NSWindow. As a side note, I have a controller object called ImageBrowserController which subclasses NSWindow and is set as the delegate of the NSWindow object of my app. I have sent IKImageBrowserView the message setCanControlQuickLookPanel:YES to enable it to automatically use the QuickLook functionality to preview image files when the IKImageBrowserView is a first responder to receive key events. Then it took me a while to figure out how to make the IKImageBrowserView a first responder which I finally got working by overriding acceptsFirstResponder inside my ImageBrowserController. Now I understand that as the delegate to the NSWindow, ImageBrowserController has a place in the responder chain after the event gets triggered on NSWindow. And I understand that as a subview of NSWindow, IKImageBrowserView is in line to be passed events for event handling. What I don't get is where the connection is between the ImageBrowserController being a first responder and the event somehow making it to the IKImageBrowserView. I didn't set NSWindow or IKImageBrowserView as first responders explicitly. So why isn't it necessary for me to implement event handling inside my ImageBrowserController? EDIT: So after reading the accepted answer and going back to my code I tried removing the acceptsFirstResponder override in my ImageBrowserController and the QuickLook functionality still triggered just like the accepted answer said it would. Commenting out the setCanControlQuickLookPanel:YES made the app beep at me when I tried to invoke QuickLook functionality via the spacebar. I'm getting the feeling that my troubles were caused by user error of XCode in hitting the RUN button instead of the BUILD button after making changes to my code (sigh).

    Read the article

< Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >