Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 620/750 | < Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >

  • rails not recognizing project

    - by tipu
    I can create a new project using rails and I can use stuff like rails migration ... and i (correctly) get a error because the sqlite gem is missing. but when i try using rails migration ... with a project i checked out from github, it doesn't recognize that it is a rails project i get: Usage: rails new APP_PATH [options] Options: -d, [--database=DATABASE] # Preconfigure for selected database (options: mysql/oracle/postgresql/sqlite3/frontbase/ibm_db) # Default: sqlite3 -O, [--skip-active-record] # Skip Active Record files [--dev] # Setup the application with Gemfile pointing to your Rails checkout -J, [--skip-prototype] # Skip Prototype files -T, [--skip-test-unit] # Skip Test::Unit files -G, [--skip-git] # Skip Git ignores and keeps -b, [--builder=BUILDER] # Path to an application builder (can be a filesystem path or URL) [--edge] # Setup the application with Gemfile pointing to Rails repository -m, [--template=TEMPLATE] # Path to an application template (can be a filesystem path or URL) -r, [--ruby=PATH] # Path to the Ruby binary of your choice # Default: /usr/bin/ruby1.8 [--skip-gemfile] # Don't create a Gemfile and it goes on. any ideas? edit: it's probably an important detail that earlier my rails wasn't working at all. i had to cp /usr/bin/ruby to /usr/bin/local/ruby

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • UITableView superClass for delegate?

    - by fuzzygoat
    A quick question, I am setting a delegate for UITableView and I have a question regarding setting the delegate and dataSource properties. I have noticed that the properties for delegate and dataSource are not available, I was thinking that adopting the protocols would make them available. But I am now thinking that I maybe have the superclass for my delegate class wrong. Currently I have: -(void)viewDidLoad { TestDelegate *tempDelegate = [[TestDelegate alloc] init]; [self setMyDelegate:tempDelegate]; // setDelegate // setDataSource [tempDelegate release]; [super viewDidLoad]; } My interface for TestDelegate looks like: @interface TestDelegate : NSObject <UITableViewDelegate, UITableViewDataSource> { NSArray *listData; int myCounter; } Can I ask if the above should be: @interface TestDelegate : UITableView <UITableViewDelegate, UITableViewDataSource> { NSArray *listData; int myCounter; } gary EDIT: I think it might be right as NSObject, I have a viewtableView in IB, thats what I will need to connect my delegate class to. I added to tableView in IB so maybe I just need to make it available in Xcode.

    Read the article

  • Two part question about submitting bluetooth-enabled apps for the iPhone

    - by Kyle
    I have a couple questions about submitting blue-tooth enabled apps on the iPhone. I want to first say that bluetooth is merely an option in the application. The application does not completely rely on bluetooth as there are many modes the user can go in. First, do they require you to have the "peer-peer" key set in UIRequiredDeviceCapabilities even if bluetooth interface options can be disabled or hidden for non-bluetooth enabled devices? Basically, it's just an OPTION in the game and there are many other modes the player can play.. Does Apple not allow you to do that? I'm just curious, because it seems like something they would do. Adding to that, how do you check for it's functionality at runtime? In essence, how do you check UIRequiredDeviceCapabilities at runtime. I'm aware of checking iPhone device types, so would that be a proper way of going about it? I'm also sort of unaware which devices can run bluetooth gamekit, there doesn't seem to be a proper reference at the SDK site, or I'm unable to find it. Thanks for reading! [edit] I can confirm the existance of somebody rejected for submitting a bluetooth enabled app which didn't work on a iPhone 2G.. Of course, they didn't say if that was the MAIN function of the app, though.

    Read the article

  • pushing view controller inside a tab bar from app delegate, after a notification.

    - by shani
    hi i have an app with tab bar and a navigation controller inside every tab. i have set a notification that when it lunches the user can get lunch the app by pressing the action on the alert. i want to redirect the user to one of the views inside one of the controllers. i have tried this: (void)application:(UIApplication *)app didReceiveLocalNotification:(UILocalNotification *)notif { NSArray *data = [notif.userInfo objectForKey:@"todoDate"]; NSInteger ind = [[data objectAtIndex:2] integerValue]; QuickViewController *detailViewController ; detailViewController = [[QuickViewController alloc] initWithNibName:@"QuickViewController" bundle:nil]; detailViewController.title = @"Edit"; detailViewController.personName = [data objectAtIndex:0]; detailViewController.DelitionDate=[data objectAtIndex:1]; detailViewController.personCategory=@"NO Category"; detailViewController.personID = ind r ; rootControler.selectedIndex = 1; [rootControler.tabBarController.selectedViewController.navigationController pushViewController:detailViewController animated:YES]; } but nothing is happening (no crashing) except of the :rootControler.selectedIndex = 1; when i tried : presentModalViewController i got the view perfectly but without the navigation controller. thanks shani

    Read the article

  • Catching specific vs. generic exceptions in c#

    - by Scott Vercuski
    This question comes from a code analysis run against an object I've created. The analysis says that I should catch a more specific exception type than just the basic Exception. Do you find yourself using just catching the generic Exception or attempting to catch a specific Exception and defaulting to a generic Exception using multiple catch blocks? One of the code chunks in question is below: internal static bool ClearFlags(string connectionString, Guid ID) { bool returnValue = false; SqlConnection dbEngine = new SqlConnection(connectionString); SqlCommand dbCmd = new SqlCommand("ClearFlags", dbEngine); SqlDataAdapter dataAdapter = new SqlDataAdapter(dbCmd); dbCmd.CommandType = CommandType.StoredProcedure; try { dbCmd.Parameters.AddWithValue("@ID", ID.ToString()); dbEngine.Open(); dbCmd.ExecuteNonQuery(); dbEngine.Close(); returnValue = true; } catch (Exception ex) { ErrorHandler(ex); } return returnValue; } Thank you for your advice EDIT: Here is the warning from the code analysis Warning 351 CA1031 : Microsoft.Design : Modify 'ClearFlags(string, Guid)' to catch a more specific exception than 'Exception' or rethrow the exception

    Read the article

  • problem with enable/disable button using javascript

    - by LiveEn
    Im am trying to add a check box that will enable/disable the edit button. Im retrieving a price list and displaying it inside a table. When i add the javascript into the php code it doesn't work. Below is my code <table border="1"> <tr> <td width="100">Fee % </td> <td width="100">Price</td> <td width="100">Total</td> <td width="102">&nbsp;</td> </tr> <tr> <?php $sql1="select * from pricelist"; $result1=mysql_query($sql1) or die(mysql_error()); while ($row=mysql_fetch_array($result1)) { $id=$row['id']; $price=$row['h_price']; $a=0; print "<form id='form1' name='$a+' method='post' action=''>"; print "<td><input name='fees' value ='$fees' type='text' size='4' /></td>"; print "<td><input name='price' value ='$price' type='text' size='15' /></td>"; echo "<td><input type='checkbox' onclick='this.$a+.disabled = !this.checked;'><td>"; print"<td><input type='submit' name='$a+' value='Submit' disabled='disabled' /></td>"; print "</tr>"; print "</form>"; } ?> </table> Can someone please tell me what am i doing wrong? Thanks

    Read the article

  • Synchronizing one or more databases with a master database - Foreign keys

    - by Ikke
    I'm using Google Gears to be able to use an application offline (I know Gears is deprecated). The problem I am facing is the synchronization with the database on the server. The specific problem is the primary keys or more exactly, the foreign keys. When sending the information to the server, I could easily ignore the primary keys, and generate new ones. But then how would I know what the relations are. I had one sollution in mind, bet the I would need to save all the pk for every client. What is the best way to synchronize multiple client with one server db. Edit: I've been thinking about it, and I guess seqential primary keys are not the best solution, but what other possibilities are there? Time based doesn't seem right because of collisions which could happen. A GUID comes to mind, is that an option? It looks like generating a GUID in javascript is not that easy. I can do something with natural keys or composite keys. As I'm thinking about it, that looks like the best solution. Can I expect any problems with that?

    Read the article

  • NetBeans Platform - how to refresh the property sheet view of a node?

    - by I82Much
    Hi all, I am using the PropertySheetView component to visualize and edit the properties of a node. This view should always reflect the most recent properties of the object; if there is a change to the object in another process, I want to somehow refresh the view and see the updated properties. The best way I was able to do this is something like the following (making use of EventBus library to publish and subscribe to changes in objects): public DomainObjectWrapperNode(DomainObject obj) { super (Children.LEAF, Lookups.singleton(obj)); EventBus.subscribe(DomainObject.class, this); } public void onEvent(DomainObject event) { // Do a check to determine if the updated object is the one wrapped by this node; // if so fire a property sets change firePropertySetsChange(null, this.getPropertySets()); } This works, but my place in the scrollpane is lost when the sheet refreshes; it resets the view to the top of the list and I have to scroll back down to where I was before the refresh action. So my question is, is there a better way to refresh the property sheet view of a node, specifically so my place in the property list is not lost upon refresh?

    Read the article

  • CakePHP Routes: Messing With The MVC

    - by thesunneversets
    So we have a real-estate-related site that has controller/action pairs like "homes/view", "realtors/edit", and so forth. From on high it has been deemed a good idea to refactor the site so that URLS are now in the format "/realtorname/homes/view/id", and perhaps also "/admin/homes/view/id" and/or "/region/..." As a mere CakePHP novice I'm finding it difficult to achieve this in routes.php. I can do the likes of: Router::connect('/:filter/h/:id', array('controller'=>'homes','action'=>'view')); Router::connect('/admin/:controller/:action/:id'); But I'm finding that the id is no longer being passed simply and elegantly to the actions, now that controller and action do not directly follow the domain. Therefore, questions: Is it a stupid idea to play fast and loose with the /controller/action format in this way? Is there a better way of stating these routes so that things don't break egregiously? Would we be better off going back to subdomains (the initial method of achieving this type of functionality, shot down on potentially spurious SEO-related grounds)? Many thanks for any advice! I'm sorry that I'm such a newbie that I don't know whether I'm asking stupid questions or not....

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Entity Framework and associations between string keys

    - by fredrik
    Hi, I am new to Entity Framework, and ORM's for that mather. In the project that I'm involed in we have a legacy database, with all its keys as strings, case-insensitive. We are converting to MSSQL and want to use EF as ORM, but have run in to a problem. Here is an example that illustrates our problem: TableA has a primary string key, TableB has a reference to this primary key. In LINQ we write something like: var result = from t in context.TableB select t.TableA; foreach( var r in result ) Console.WriteLine( r.someFieldInTableA ); if TableA contains a primary key that reads "A", and TableB contains two rows that references TableA but with different cases in the referenceing field, "a" and "A". In our project we want both of the rows to endup in the result, but only the one with the matching case will end up there. Using the SQL Profiler, I have noticed that both of the rows are selected. Is there a way to tell Entity Framework that the keys are case insensitive? Edit:We have now tested this with NHibernate and come to the conclution that NHibernate works with case-insensitive keys. So NHibernate might be a better choice for us.I am however still interested in finding out if there is any way to change the behaviour of Entity Framework.

    Read the article

  • Replacing a unicode character in UTF-8 file using delphi 2010

    - by Jake Snake
    I am trying to replace character (decimal value 197) in a UTF-8 file with character (decimal value 65) I can load the file and put it in a string (may not need to do that though) SS := TStringStream.Create(ParamStr1, TEncoding.UTF8); SS.LoadFromFile(ParamStr1); //S:= SS.DataString; //ShowMessage(S); However, how do i replace all 197's with a 65, and save it back out as UTF-8? SS.SaveToFile(ParamStr2); SS.Free; -------------- EDIT ---------------- reader:= TStreamReader.Create(ParamStr1, TEncoding.UTF8); writer:= TStreamWriter.Create(ParamStr2, False, TEncoding.UTF8); while not Reader.EndOfStream do begin S:= reader.ReadLine; for I:= 1 to Length(S) do begin if Ord(S[I]) = 350 then begin Delete(S,I,1); Insert('A',S,I); end; end; writer.Write(S + #13#10); end; writer.Free; reader.Free;

    Read the article

  • C# class can not disguise to be another class because GetType method cannot be override

    - by zinking
    there is a statement in the CLR via C# saying in C#, one class cannot disguise to be another, because GetType is virutal and thus it cannot be override but I think in C# we can still hide the parent implementation of GetType. I must missed something if I hide the base GetType implementation then I can disguise my class to be another class, is that correct? The key here is not whether GetType is virutal or not, the question is can we disguise one class to be another in C# Following is the NO.4 answer from the possible duplicate, so My question is more on this. is this kind of disguise possible, if so, how can we say that we can prevent class type disguise in C# ? regardless of the GetType is virtual or not While its true that you cannot override the object.GetType() method, you can use "new" to overload it completely, thereby spoofing another known type. This is interesting, however, I haven't figured out how to create an instance of the "Type" object from scratch, so the example below pretends to be another type. public class NotAString { private string m_RealString = string.Empty; public new Type GetType() { return m_RealString.GetType(); } } After creating an instance of this, (new NotAString()).GetType(), will indeed return the type for a string. share|edit|flag answered Mar 15 at 18:39 Dr Snooze 213 By almost anything that looks at GetType has an instance of object, or at the very least some base type that they control or can reason about. If you already have an instance of the most derived type then there is no need to call GetType on it. The point is as long as someone uses GetType on an object they can be sure it's the system's implementation, not any other custom definition. – Servy Mar 15 at 18:54 add comment

    Read the article

  • Is C++ (one of) the best language to learn at first

    - by AlexV
    C++ is one of the most used programming language in the world since like 25+ years. My first job as programmer was in C++ and I coded in C++ everyday for nearly 4 years. Now I do mostly PHP, but I will forever cherish this C++ background. C++ has helped me understand many "under the hood" features/behaviors/restrictions of many other (and different) programming languages like PHP and Delphi. I'm a full time programmer for 6+ years now and since I have a quite varied programming background I often get questions by "newbies" as where to start to become a "good" programmer. I think C++ is one of the best language to start with because it gives you a real usefull experience that will last and will teach you how things work under the hood. It's not the easier one to learn for a newbie, but in my opinion it's one that will reward in the long term. I would like to know your opinion on this matter to add to my arguments when I guide "newbies". After this introduction, here's my question : Is C++ (one of) the best language to learn at first for you. Since it's subjective, I've marked this question as community wiki. EDIT: This question is not about why Java (or C# or any other language) is better than C++ to start with, it's about what's make C++ a good choice or not a good choice to learn as one of your firsts languages. For example, for me C++ made me understand how the memory works. Now today in many languages everything is managed by the garbadge collector and some people don't even know that. I'm glad I know how it works underneath and I think it can help you to write better code.

    Read the article

  • Developing on a windows machine that interacts with a linux system

    - by Jamie
    Sorry for the bad title (couldn't think of a better way to describe it) I have a windows machine which I do development on. However, I have a new project which needs to interact with a linux system (executing linux commands etc.). So, obviously I can't do development on my windows machine..and I don't wish to code on the dev machine, svn commit and then svn update it on the linux machine. Is there a way where any changes I make on my dev machine will be quickly mirrored to the linux machine? SVN is not a very quick alternative and of course some changes will be very minor. Any ideas? A network share I guess....but that's not very pretty (bit slow too). As fellow developers I would like to know if you've been in a similar situation and how you've resolved it. On a furthernote, I can't just install Ubuntu as my development machine and mirror the commands, applications etc. from the linux machine because it's a cluster 'master' machine and so therefore it has quite a special configuration. Thanks guys! EDIT: I've also thought about having web services on the linux machine and then just calling them from code thus seperating platform development dependency. What do you think about that too? thanks

    Read the article

  • Vim: Making Auto-Completion Smarter

    - by Rafid K. Abdullah
    I use ctags, taglist, etc., to have auto completion in Vim. However, it is very limited compared to Visual Studio intellisense or Eclipse auto-completion. I am wondering whether it is possible to tune Vim to: Show auto-completion whenever . or - are typed. But only after some text that might be a variable (e.g. avoid showing auto completion after a number). Show function parameters when ( is typed. Stop removing the auto completion list when some delete all characters after . or -: When I enter a variable name, then press . or - to search for a certain member, I frequently have to delete all the characters I type after the . or -, but this makes Vim hide the auto completion list. I would like to keep it visible unless I press Esc. Showing related auto completion: When I type a variable and press ^X ^O, it usually shows me all the tags in the ctags file. I would like to have it showing only the tags related to the variable. Thanks for the help. EDIT: Some people are voting for this question, but no body seems to know the answer. So just wanted to mention that you don't have to provide a complete answer; partial answers to any of the mentioned points would be good also.

    Read the article

  • Regarding some Update Stored procedure

    - by Serenity
    I have two Tables as follows:- Table1:- ------------------------------------- PageID|Content|TitleID(FK)|LanguageID ------------------------------------- 1 |abc |101 |1 2 |xyz |102 |1 -------------------------------------- Table2:- ------------------------- TitleID|Title |LanguageID ------------------------- 101 |Title1|1 102 |Title2|1 ------------------------ I don't want to add duplicates in my Table1(Content Table). Like..there can be no two Pages with the same Title. What check do I need to add in my Insert/Update Stored Procedure ? How do I make sure duplicates are never added. I have tried as follows:- CREATE PROC InsertUpdatePageContent ( @PageID int, @Content nvarchar(2000), @TitleID int ) AS BEGIN IF(@PageID=-1) BEGIN IF(NOT EXISTS(SELECT TitleID FROM Table1 WHERE LANGUAGEID=@LANGUAGEID)) BEGIN INSERT INTO Table1(Content,TitleID) VALUES(@Content,@TitleID) END END ELSE BEGIN IF(NOT EXISTS(SELECT TitleID FROM Table1 WHERE LANGUAGEID=@LANGUAGEID)) BEGIN UPDATE Table1 SET Content=@Content,TitleID=@TitleID WHERE PAGEID=@PAGEID END END END Now what is happening is that it is inserting new records alright and won't allow duplicates to be added but when I update its giving me problem. On my aspx Page I have a drop down list control that is bound to DataSource that returns Table 2(Title Table) and I have a text box in which user types Page's content to be stored. When I update, like lets say I have a row in my Table 1 as shown above with PageID=1. Now when I am updating this row, like I didn't change the Title from the drop down and only changed Content in the text box, its not updating the record ..and when Stored procedure's Update Query does not execute it displays a Label that says "Page with this title exists already." So whenever I am updating an existing record that label is displayed on screen.How do I change that IF condition in my Update Stored procedure?? EDIT:- @gbn :: Will that IF condition work in case of update? I mean lets say I am updating the Page with TitleID=1, I changed its content, then when I update, it's gonna execute that IF condition and it still won't update coz TitleID=1 already exits!It will only update if TitleID=1 is not there in Table1. Isn't it? Guess I am getting confused. Please answer.Thanks.

    Read the article

  • How do I stop js files being cached in IE?

    - by DoctaJonez
    Hello stackers! I've created a page that uses the CKEditor javascript rich edit control. It's a pretty neat control, especially seeing as it's free, but I'm having serious issues with the way it allows you to add templates. To add a template you need to modify the templates js file in the CKEditor templates folder. The documentation page describing it is here. This works fine until I want to update a template or add a new one (or anything else that requires me to modify the js file). Internet Explorer caches the js file and doesn't pick up the update. Emptying the cache allows the update to be picked up, but this isn't an acceptable solution. Whenever I update a template I do not want to tell all of the users across the organisation to empty their IE cache. There must be a better way! Is there a way to stop IE caching the js file? Or is there another solution to this problem?

    Read the article

  • Extract history from Korn shell

    - by Luc
    I am not happy about the history file in binary format of the Korn shell. I like to "collect" some of my command lines, many of them actually, and for a long time. I'm talking about years. That doesn't seem easy in Korn because the history file is not plain text so I can't edit it, and a lot of junk is piling up in it. By "junk" I mean lines that I don'twant to keep, like 'cat' or 'man'. So I added these lines to my .profile: fc -ln 1 9999 ~/khistory.txt source ~/loghistory.sh ~/khistory.txt loghistory.sh contains a handful of sed and sort commands that gets rid of a lot of the junk. But apparently it is forbidden to run fc in the .profile file. I can't login whenever I do, the shell exits right away with signal 11. So I removed that 'fc -l' line from my .profile file and added it to the loghistory.sh script, but the shell still crashes. I also tried this line in my .profile: strings ~/.sh_history ~/khistory.txt source ~/loghistory.sh That doesn't crash, but the output is printed with an additional, random character in the beginning of many lines. I can run 'fc -l' on the command line, but that's no good. I need to automate that. But how? How can I extract my ksh history as plain text? TIA

    Read the article

  • F# numeric associations

    - by b1g3ar5
    I have a numeric association for a custom type as follows: let DiffNumerics = { new INumeric<Diff> with member op.Zero = C 0.0 member op.One = C 1.0 member op.Add(a,b) = a + b member op.Subtract(a,b) = a - b member op.Multiply(a,b) = a * b member ops.Negate(a) = Diff.negate a member ops.Abs(a) = Diff.abs a member ops.Equals(a, b) = ((=) a b) member ops.Compare(a, b) = Diff.compare a b member ops.Sign(a) = int (Diff.sign a).Val member ops.ToString(x,fmt,fmtprovider) = failwith "not implemented" member ops.Parse(s,numstyle,fmtprovider) = failwith "not implemented" } GlobalAssociations.RegisterNumericAssociation(DiffNumerics) It works fine in f# interactive, but crashes when I run, because .ElementOps is not filled correctly for a matrix of these types. Any ideas why this might be? EDIT: In fsi, the code let A = dmatrix [[Diff.C 1.;Diff.C 2.;Diff.C 3.];[Diff.C 4.;Diff.C 5.;Diff.C 6.]] let B = matrix [[1.;2.;3.];[4.;5.;6.]] gives: > A.ElementOps;; val it : INumeric<Diff> = FSI_0003.NewAD+DiffNumerics@258 > B.ElementOps;; val it : INumeric<float> = Microsoft.FSharp.Math.Instances+FloatNumerics@115 > in the debugger A.ElementOps shows: '(A).ElementOps' threw an exception of type 'System.NotSupportedException' and, for the B matrix: Microsoft.FSharp.Math.Instances+FloatNumerics@115 So somehow the DiffNumerics isn't making it to the compiled program.

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • How do I make a serialization class for this?

    - by chobo2
    I have something like this (sorry for the bad names) <root xmlns="http://www.domain.com" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.Domain.com Schema.xsd> <product></product> <SomeHighLevelElement> <anotherElment> <lowestElement> </lowestElement> </anotherElment> </SomeHighLevelElement> </root> I have something like this for my class public class MyClass { public MyClass() { ListWrapper= new List<UserInfo>(); } public string product{ get; set; } public List<SomeHighLevelElement> ListWrapper{ get; set; } } public class SomeHighLevelElement { public string lowestElement{ get; set; } } But I don't know how to write the code for the "anotherElement" not sure if I have to make another wrapper around it. Edit I know get a error in my actual xml file. I have this in my tag xmlns="http://www.domain.com" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.Domain.com Schema.xsd Throws an exception on the root line saying there was a error with this stuff. So I don't know if it is mad at the schemaLocation since I am using local host right now or what.

    Read the article

  • PendingIntent sent from a notication.

    - by totem
    Hi, What im trying to accomplish is to send a notification through the notification manager that once clicked will do something in the application only if its currently running. i have tried to use: notification.contentIntent = PendingIntent.getActivity(this, nNotificationCounter, Someintent, PendingIntent.FLAG_NO_CREATE) Which allways caused an exception once trying to use the notify. I switched to: Notification notification = new Notification(icon, tickerText, when); RemoteViews contentView = new RemoteViews(getPackageName(), R.layout.some_notification); contentView.setTextViewText(R.id.title, sTitle); contentView.setTextViewText(R.id.text, sText); notification.contentView = contentView; notification.defaults |= Notification.DEFAULT_SOUND; notification.number = nNotificationCounter; Intent notificationIntent = new Intent(this, MainWindow.class).setAction(ACTION_RESET_MESSGE_COUNTER); notification.contentIntent = PendingIntent.getBroadcast(this, nNotificationCounter, notificationIntent, 0); and although this code doesn't cause an exception. it doesnt call my BroadcastReceiver which is defined as follows: public class IncomingReceiver extends BroadcastReceiver { @Override public void onReceive(Context context, Intent intent) { if (intent.getAction().equals(ACTION_RESET_MESSGE_COUNTER)) { System.out.println("GOT THE INTENT"); return; } } } and set in the onCreate: IntentFilter filter = new IntentFilter(ACTION_RESET_MESSGE_COUNTER); IncomingReceiver receiver = new IncomingReceiver(); context.registerReceiver(receiver, filter); Does anyone see something wrong with the code? Or how would i go about to get messages when the notification is clicked, but not create any activity if it isn't already created. edit: added the intent creation and notification creation. Thanks, Tom

    Read the article

  • Why doesn't java.util.Set have get(int index)?

    - by Marty Pitt
    I'm sure there's a good reason, but could someone please explain why the java.util.Set interface lacks get(int Index), or any similar get() method? It seems that sets are great for putting things into, but I can't find an elegant way of retrieving a single item from it. If I know I want the first item, I can use set.iterator().next(), but otherwise it seems I have to cast to an Array to retrieve an item at a specific index? What are the appropriate ways of retrieving data from a set? (other than using an iterator) I'm sure the fact that it's excluded from the API means there's a good reason for not doing this -- could someone please enlighten me? EDIT: Some extremely great answers here, and a few saying "more context". The specific scneario was a dbUnit test, where I could reasonalby assert that the returned set from a query had only 1 item, and I was trying to access that item. However, the question is more valid without the scenario, as it remains more focussed : What's the difference between set & list. Thanks to all for the fantastic answers below.

    Read the article

< Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >