Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 620/750 | < Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >

  • Problem with Boost::Asio for C++

    - by Martin Lauridsen
    Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

    Read the article

  • apache proxy module gives 403 forbidden error

    - by naiquevin
    I am trying to use the apache's proxy module for working with xmpp on ubuntu desktop. For this i did the following things - 1) enabled mod_proxy by creating a symlink of proxy.conf, proxy.load and proxy_http.load from /etc/apache2/mods-available/ in the mods-enabled directory. 2) Added the following lines to the vhost <Proxy http://mydomain.com/httpbind> Order allow,deny Allow from all </Proxy> ProxyPass /httpbind http://mydomain.com:7070/http-bind/ ProxyPassReverse /httpbind http://mydomain.com:7070/http-bind/ I am new to using the proxy module but what i can make from the above lines is that requests to http://mydomain.com/httpbind will be forwarded to http://mydomain.com:7070/http-bind/. Kindly correct if wrong. 3) added rule Allow from .mydomain.com in /mods-available/proxy.conf Now i try to access http://mydomain.com/httpbind and it shows 403 Forbidden error.. What am i missing here ? Please help. thanks Edit : The problem got solved when i changed the following code in mods_available/proxy.conf <Proxy *> AddDefaultCharset off Order deny,allow Deny from all Allow from mydomain.com </Proxy> to <Proxy *> AddDefaultCharset off Order deny,allow #Deny from all Allow from all </Proxy> Didnt get what was wrong with the initial code though

    Read the article

  • Why doesn't java.util.Set have get(int index)?

    - by Marty Pitt
    I'm sure there's a good reason, but could someone please explain why the java.util.Set interface lacks get(int Index), or any similar get() method? It seems that sets are great for putting things into, but I can't find an elegant way of retrieving a single item from it. If I know I want the first item, I can use set.iterator().next(), but otherwise it seems I have to cast to an Array to retrieve an item at a specific index? What are the appropriate ways of retrieving data from a set? (other than using an iterator) I'm sure the fact that it's excluded from the API means there's a good reason for not doing this -- could someone please enlighten me? EDIT: Some extremely great answers here, and a few saying "more context". The specific scneario was a dbUnit test, where I could reasonalby assert that the returned set from a query had only 1 item, and I was trying to access that item. However, the question is more valid without the scenario, as it remains more focussed : What's the difference between set & list. Thanks to all for the fantastic answers below.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • What can i use to journal writes to file system

    - by Dmitry
    Hello, all I need to track all writes to files in order to have synchronized version of files on different place (server or just other directory, not considerable). Let it: all files located in same directory feel free to create some system files (e.g. SomeFileName.Ext~temp-data) no one have concurrent access to synced directory; nobody spoil ours meta-files or change real-files before we do postponed writes (like a commits) do not to care recovering "local" changes in case of crash; system can just rolled back to state of "server" by simple copy from it significant to have it transparent to use (so programmer must just call ordinary fopen(), read(), write()) It must be guaranteed that copy of files which "server" have is consistent. That is whole files scope existed in some moment of time. They may be sufficiently outdated but it must be fair snapshot of all files at some time. As i understand i should overload writing logic to collect data in order sent changes to "server". For example writing to temporary File~tmp. And so i have to overload reads in order program could read actual data of file. It would be great if you suggest some existing library (java or c++, it is unimportant) or solution (VCS customizing?). Or give hints how should i write it by myself. edit: After some reading i have more precision requirements: I need COW (Copy-on-write) wrapper for fopen(),fwrite(),.. or interceptor (hook) WriteFile() and other FS api system calls. Log-structured file system in userspace would be a alternative too.

    Read the article

  • function returns after an XMLHttpRequest

    - by ashays
    Alright, I know questions like this have probably been asked dozens of times, but I can't seem to find a working solution for my project. Recently, while using jQuery for a lot of AJAX calls, I've found myself in a form of callback hell. Whether or not jQuery is too powerful for this project is beyond the scope of this question. So basically here's some code that shows what's going on: function check_form(table) { var file = "/models/"+table+".json"; var errs = {}; var xhr = $.getJSON(file, function(json) { for (key in json) { var k = key; var r = json[k]; $.extend(errs, check_item("#"+k,r)); } }); return errs; } And... as you can probably guess, I get an empty object returned. My original idea was to use some sort of onReadyStateChange idea that would return whenever the readyState had finally hit 4. This causes my application to hang indefinitely, though. I need these errors to decide whether or not the form is allowed to submit or not (as well as to tell the user where the errors are in the application. Any ideas? Edit. It's not the prettiest solution, but I've managed to get it to work. Basically, check_form has the json passed to it from another function, instead of loading it. I was already loading it there, too, so it's probably best that I don't continue to load the same file over and over again anyways. I was just worried about overloading memory. These files aren't absolutely huge, though, so I guess it's probably okay.

    Read the article

  • What would be the best way to install (distribute) dynamic libraries in Mac OSX using CMake/Cpack ?

    - by YuppieNetworking
    Hello all, I have a project whose artifacts are two dynamic libraries, let's say libX.dylib and libY.dylib (or .so for linux distributions). There are no executables. Now I would like to distribute these libraries. Since I already use CMake to compile it, I looked at CPack and successfully generated .tgz and .deb packages for Linux. However, for Mac OSX I have no idea and the CPack Wiki about its generators did not help me much. I managed to generate a PackageMaker package, but as clearly stated at this packagemaker howto, there is no uninstall option when using this util. I then read a bit about Bundles, but I feel lost specially since I have no executable. Question: What is the correct way to generate a package for Mac OSX using CPack? My ideal scenario would be either something that installs as easily as a bundle or as a deb file in debian/ubuntu. Thanks for your help Edit One more detail: the code to one of these libraries is not open, so I can't expect the users to do a cmake; make; make install That's why I want a .deb, .tar.gz, bundle or whatsoever.

    Read the article

  • C# class can not disguise to be another class because GetType method cannot be override

    - by zinking
    there is a statement in the CLR via C# saying in C#, one class cannot disguise to be another, because GetType is virutal and thus it cannot be override but I think in C# we can still hide the parent implementation of GetType. I must missed something if I hide the base GetType implementation then I can disguise my class to be another class, is that correct? The key here is not whether GetType is virutal or not, the question is can we disguise one class to be another in C# Following is the NO.4 answer from the possible duplicate, so My question is more on this. is this kind of disguise possible, if so, how can we say that we can prevent class type disguise in C# ? regardless of the GetType is virtual or not While its true that you cannot override the object.GetType() method, you can use "new" to overload it completely, thereby spoofing another known type. This is interesting, however, I haven't figured out how to create an instance of the "Type" object from scratch, so the example below pretends to be another type. public class NotAString { private string m_RealString = string.Empty; public new Type GetType() { return m_RealString.GetType(); } } After creating an instance of this, (new NotAString()).GetType(), will indeed return the type for a string. share|edit|flag answered Mar 15 at 18:39 Dr Snooze 213 By almost anything that looks at GetType has an instance of object, or at the very least some base type that they control or can reason about. If you already have an instance of the most derived type then there is no need to call GetType on it. The point is as long as someone uses GetType on an object they can be sure it's the system's implementation, not any other custom definition. – Servy Mar 15 at 18:54 add comment

    Read the article

  • How to properly load HTML data from third party website using MVC+AJAX?

    - by Dmitry
    I'm building ASP.NET MVC2 website that lets users store and analyze data about goods found on various online trade sites. When user is filling a form to create or edit an item, he should have a button "Import data" that automatically fills some fields based on data from third party website. The question is: what should this button do under the hood? I see at least 2 possible solutions. First. Do the import on client side using AJAX+jQuery load method. I tried it in IE8 and received browser warning popup about insecure script actions. Of course, it is completely unacceptable. Second. Add method ImportData(string URL) to ItemController class. It is called via AJAX, does the import + data processing server-side and returns JSON-d result to client. I tried it and received server exception (503) Server unavailable when loading HTML data into XMLDocument. Also I have a feeling that dealing with not well-formed HTML (missing closing tags, etc.) will be a huge pain. Any ideas how to parse such HTML documents?

    Read the article

  • Semantically correct XHTML markup

    - by Dori
    Hello all. Just trying to get the hang of using the semantically correct XHTML markup. Just writing the code for a small navigation item. Where each button has effectivly a title and a descrption. I thought a definition list would therefore be great so i wrote the following <dl> <dt>Import images</dt> <dd>Read in new image names to database</dd> <dt>Exhibition Management</dt> <dd>Create / Delete an exhibition </dd> <dt>Image Management</dt> <dd>Edit name, medium and exhibition data </dd> </dl> But...I want the above to be 3 buttons, each button containing the dt and dd text. How can i do this with the correct code? Normally i would make each button a div and use that for the visual button behaviour (onHover and current page selection stuff). Any advice please Thanks

    Read the article

  • PHP URL parameters append return special character

    - by Alexandre Lavoie
    I'm programming a function to build an URL, here it is : public static function requestContent($p_lParameters) { $sParameters = "?key=TEST&format=json&jsoncallback=none"; foreach($p_lParameters as $sParameterName => $sParameterValue) { $sParameters .= "&$sParameterName=$sParameterValue"; } echo "<span style='font-size: 16px;'>URL : http://api.oodle.com/api/v2/listings" . $sParameters . "</span><br />"; $aXMLData = file_get_contents("http://api.oodle.com/api/v2/listings" . $sParameters); return json_decode($aXMLData,true); } And I am calling this function with this array list : print_r() result : Array ( [region] => canada [category] => housing/sale/home ) But this is very strange I get an unexpected character (note the special character none*®*ion) : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home For information I use this header : <meta http-equiv="Content-Type" content="text/html;charset=UTF-8" /> <?php header('Content-Type: text/html;charset=UTF-8'); ?> EDIT : $sRequest = "http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none&region=canada&category=housing/sale/home"; echo "<span style='font-size: 16px;'>URL : " . $sRequest . "</span><br />"; return the exact URL with problem : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home Thank you for your help!

    Read the article

  • Subset and lagging list data structure R

    - by user1234440
    I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

    Read the article

  • Reporting Services "cannot connect to the report server database"

    - by Dano
    We have Reporting Services running, and twice in the past 6 months it has been down for 1-3 days, and suddenly it will start working again. The errors range from not being able to view the tree root in a browser, down to being able to insert parameters on a report, but crashing before the report can generate. Looking at the logs, there is 1 error and 1 warning which seem to correspond somewhat. ERROR:Event Type: Error Event Source: Report Server (SQL2K5) Event Category: Management Event ID: 107 Date: 2/13/2009 Time: 11:17:19 AM User: N/A Computer: ******** Description: Report Server (SQL2K5) cannot connect to the report server database. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. WARNING: always comes before the previous error Event code: 3005 Event message: An unhandled exception has occurred. Event time: 2/13/2009 11:06:48 AM Event time (UTC): 2/13/2009 5:06:48 PM Event ID: 2efdff9e05b14f4fb8dda5ebf16d6772 Event sequence: 550 Event occurrence: 5 Event detail code: 0 Process information: Process ID: 5368 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ReportServerException Exception message: For more information about this error navigate to the report server on the local server machine, or enable remote errors. During the downtime we tried restarting everything from the server RS runs on, to the database it calls to fill reports with no success. When I came in monday morning it was working again. Anyone out there have any ideas on what could be causing these issues? Edit Tried both suggestions below several months ago to no avail. This issue hasn't arisen since, maybe something out of my control has changed....

    Read the article

  • Efficient algorithm for Next button on a MySQL result set

    - by David Grayson
    I have a website that lets people view rows in a table (each row is a picture). There are more than 100,000 rows. You can view different subsets of the rows, and you can view them with different sort orders. While you are viewing one of the rows, you can click the "Next" or "Previous" buttons to go the next/previous row in the list. How would you implement the "Next" and "Previous" features of the website? More specifically, if you have an arbitrary query that returns a list of up to 100,000+ rows, and you know some information about the current row someone is viewing, how do you determine the NEXT row efficiently? Here is the pseudo-code of the solution I came up with when the website was young, and it worked well when there were only 1000 rows, but now that there are 100,000 rows I think it is eating up too much memory. int nextRowId(string query, int currentRowId) { array allRowIds = mysql_query(query); // Takes up a lot of memory! int currentIndex = (index of currentRowId in allRowIds); // Takes time! return allRowIds[currentIndex+1]; } While you are thinking about this problem, remember that the website can store more information about the current row than just its ID (for example, the position of the current row in the result set), and this information can be used as a hint to help determine the ID of the next row. Edit: Sorry for not mentioning this earlier, but this isn't just a static website: rows can often be added to the list, and rows can be re-ordered in the list. (Much rarer, rows can be removed from the list.) I think that I should worry about that kind of thing, but maybe you can convince me otherwise.

    Read the article

  • MySQL "OR MATCH" hangs (very slow) on multiple tables

    - by Kerry
    After learning how to do MySQL Full-Text search, the recommended solution for multiple tables was OR MATCH and then do the other database call. You can see that in my query below. When I do this, it just gets stuck in a "busy" state, and I can't access the MySQL database. SELECT a.`product_id`, a.`name`, a.`slug`, a.`description`, b.`list_price`, b.`price`, c.`image`, c.`swatch`, e.`name` AS industry, MATCH( a.`name`, a.`sku`, a.`description` ) AGAINST ( '%s' IN BOOLEAN MODE ) AS relevance FROM `products` AS a LEFT JOIN `website_products` AS b ON (a.`product_id` = b.`product_id`) LEFT JOIN ( SELECT `product_id`, `image`, `swatch` FROM `product_images` WHERE `sequence` = 0) AS c ON (a.`product_id` = c.`product_id`) LEFT JOIN `brands` AS d ON (a.`brand_id` = d.`brand_id`) INNER JOIN `industries` AS e ON (a.`industry_id` = e.`industry_id`) WHERE b.`website_id` = %d AND b.`status` = %d AND b.`active` = %d AND MATCH( a.`name`, a.`sku`, a.`description` ) AGAINST ( '%s' IN BOOLEAN MODE ) OR MATCH ( d.`name` ) AGAINST ( '%s' IN BOOLEAN MODE ) GROUP BY a.`product_id` ORDER BY relevance DESC LIMIT 0, 9 Any help would be greatly appreciated. EDIT All the tables involved are MyISAM, utf8_general_ci. Here's the EXPLAIN SELECT statement: id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY a ALL NULL NULL NULL NULL 16076 Using temporary; Using filesort 1 PRIMARY b ref product_id product_id 4 database.a.product_id 2 1 PRIMARY e eq_ref PRIMARY PRIMARY 4 database.a.industry_id 1 1 PRIMARY <derived2> ALL NULL NULL NULL NULL 23261 1 PRIMARY d eq_ref PRIMARY PRIMARY 4 database.a.brand_id 1 Using where 2 DERIVED product_images ALL NULL NULL NULL NULL 25933 Using where I don't know how to make that look neater -- sorry about that UPDATE it returns the query after 196 seconds (I think correctly). The query without multiple tables takes about .56 seconds (which I know is really slow, we plan on changing to solr or sphinx soon), but 196 seconds?? If we could add a number to the relevance if it was in the brand name ( d.name ), that would also work

    Read the article

  • How to structure the tables of a very simple blog in MySQL?

    - by Programmer
    I want to add a very simple blog feature on one of my existing LAMP sites. It would be tied to a user's existing profile, and they would be able to simply input a title and a body for each post in their blog, and the date would be automatically set upon submission. They would be allowed to edit and delete any blog post and title at any time. The blog would be displayed from most recent to oldest, perhaps 20 posts to a page, with proper pagination above that. Other users would be able to leave comments on each post, which the blog owner would be allowed to delete, but not pre-moderate. That's basically it. Like I said, very simple. How should I structure the MySQL tables for this? I'm assuming that since there will be blog posts and comments, I would need a separate table for each, is that correct? But then what columns would I need in each table, what data structures should I use, and how should I link the two tables together (e.g. any foreign keys)? I could not find any tutorials for something like this, and what I'm looking to do is really offer my users the simplest version of a blog possible. No tags, no moderation, no images, no fancy formatting, etc. Just a simple diary-type, pure-text blog with commenting by other users.

    Read the article

  • Get subdomain of XML page from XSL

    - by fudgey
    I am working with a guild hosting site that provides an XML/XSL transformation widget where all I need to do is enter the URL for the XML and XSL and it does the rest. I have written an XSL transform to display a World of Warcraft armory page: Here is an example XML page (view source to see it) of the group I'm trying to help now. So, the user is entering their own XML page url (which has an eu subdomain in this case, but it is not within the XML itself). So when I make links to the character url, I need to add the entire url <a target="_blank" href="http://eu.wowarmory.com/character-sheet.xml?{@url}"> <xsl:value-of select="@name"/> </a> But I can't just set the domain to eu since there are multiple regions. Here are the possibilities: us = www, europe = eu, korea = kr, china = cn and taiwan = tw. Here is a snippet of the XML which shows the url parameters: <character achPoints="4275" classId="3" genderId="0" level="80" name="Virtex" raceId="4" rank="2" url="r=Drek%27Thar&amp;cn=Virtex"/> I guess I could just have the user add a small bit of HTML with their region in another part of their page, something like <div id="region">eu</div>, but I'm trying to make this work without any extra coding on their part. Edit: Ok, my question explicitly stated: How do I get the URL subdomain using XSL?

    Read the article

  • When an NSWindow object has a delegate that is a NSWindow subclass, who is responsible to act on received events?

    - by spade78
    So I'm building a program that features the use of the IKImageBrowserView component as a subview in an NSWindow. As a side note, I have a controller object called ImageBrowserController which subclasses NSWindow and is set as the delegate of the NSWindow object of my app. I have sent IKImageBrowserView the message setCanControlQuickLookPanel:YES to enable it to automatically use the QuickLook functionality to preview image files when the IKImageBrowserView is a first responder to receive key events. Then it took me a while to figure out how to make the IKImageBrowserView a first responder which I finally got working by overriding acceptsFirstResponder inside my ImageBrowserController. Now I understand that as the delegate to the NSWindow, ImageBrowserController has a place in the responder chain after the event gets triggered on NSWindow. And I understand that as a subview of NSWindow, IKImageBrowserView is in line to be passed events for event handling. What I don't get is where the connection is between the ImageBrowserController being a first responder and the event somehow making it to the IKImageBrowserView. I didn't set NSWindow or IKImageBrowserView as first responders explicitly. So why isn't it necessary for me to implement event handling inside my ImageBrowserController? EDIT: So after reading the accepted answer and going back to my code I tried removing the acceptsFirstResponder override in my ImageBrowserController and the QuickLook functionality still triggered just like the accepted answer said it would. Commenting out the setCanControlQuickLookPanel:YES made the app beep at me when I tried to invoke QuickLook functionality via the spacebar. I'm getting the feeling that my troubles were caused by user error of XCode in hitting the RUN button instead of the BUILD button after making changes to my code (sigh).

    Read the article

  • using libcurl to check if a file exists on a SFTP site

    - by Snazzer
    I'm using C++ with libcurl to do SFTP/FTPS transfers. Before uploading a file, I need to check if the file exists without actually downloading it. If the file doesn't exist, I run into the following problems: //set up curlhandle for the public/private keys and whatever else first. curl_easy_setopt(CurlHandle, CURLOPT_URL, "sftp://user@pass:host/nonexistent-file"); curl_easy_setopt(CurlHandle, CURLOPT_NOBODY, 1); curl_easy_setopt(CurlHandle, CURLOPT_FILETIME, 1); int result = curl_easy_perform(CurlHandle); //result is CURLE_OK, not CURLE_REMOTE_FILE_NOT_FOUND //using curl_easy_getinfo to get the file time will return -1 for filetime, regardless //if the file is there or not. If I don't use CURLOPT_NOBODY, it works, I get CURLE_REMOTE_FILE_NOT_FOUND. However, if the file does exist, it gets downloaded, which wastes time for me, since I just want to know if it's there or not. Any other techniques/options I'm missing? Note that it should work for ftps as well. Edit: This error occurs with sftp. With FTPS/FTP I get CURLE_FTP_COULDNT_RETR_FILE, which I can work with.

    Read the article

  • How can I execute an ANTLR parser action for each item in a rule that can match more than one item?

    - by Chris Farmer
    I am trying to write an ANTLR parser rule that matches a list of things, and I want to write a parser action that can deal with each item in the list independently. Some example input for these rules is: $(A1 A2 A3) I'd like this to result in an evaluator that contains a list of three MyIdentEvaluator objects -- one for each of A1, A2, and A3. Here's a snippet of my grammar: my_list returns [IEvaluator e] : { $e = new MyListEvaluator(); } '$' LPAREN op=my_ident+ { /* want to do something here for each 'my_ident'. */ /* the following seems to see only the 'A3' my_ident */ $e.Add($op.e); } RPAREN ; my_ident returns [IEvaluator e] : IDENT { $e = new MyIdentEvaluator($IDENT.text); } ; I think my_ident is defined correctly, because I can see the three MyIdentEvaluators getting created as expected for my input string, but only the last my_ident ever gets added to the list (A3 in my example input). How can I best treat each of these elements independently, either through a grammar change or a parser action change? It also occurred to me that my vocabulary for these concepts is not what it should be, so if it looks like I'm misusing a term, I probably am. EDIT in response to Wayne's comment: I tried to use op+=my_ident+. In that case, the $op in my action becomes an IList (in C#) that contains Antlr.Runtime.Tree.CommonTree instances. It does give me one entry per matched token in $op, so I see my three matches, but I don't have the MyIdentEvaluator instances that I really want. I was hoping I could then find a rule attribute in the ANTLR docs that might help with this, but nothing seemed to help me get rid of this IList. Result... Based on chollida's answer, I ended up with this which works well: my_list returns [IEvaluator e] : { $e = new MyListEvaluator(); } '$' LPAREN (op=my_ident { $e.Add($op.e); } )+ RPAREN ; The Add method gets called for each match of my_ident.

    Read the article

  • TEXTAREAs scroll by themselves (on IE8) every time you type one character

    - by Justin Grant
    IE8 has a known bug (per connect.microsoft.com) where typing or pasting text into a TEXTAREA element will cause the textarea to scroll by itself. This is hugely annoying and shows up in many community sites, including Wikipedia. The repro is this: open the HTML below with IE8 (or use any long page on wikipedia which will exhibit the same problem until they fix it) size the browser full-screen paste a few pages of text into the TEXTAREA move the scrollbar to the middle position now type one character into the textarea Expected: nothing happens Actual: scrossing happens on its own, and the insertion point ends up near the bottom of the textarea! Below is repro HTML (can also see this live on the web here: http://en.wikipedia.org/w/index.php?title=Text_box&action=edit) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <body> <div style="width: 80%"> <textarea rows="20" cols="80" style="width:100%;" ></textarea> </div> </body> </html>

    Read the article

  • Access 2007 not allowing user to delete record in subform

    - by Todd McDermid
    Good day... The root of my issue is that there's no context menu allowing the user to delete a row from a form. The "delete" button on the ribbon is also disabled. In Access 2003, apparently this function was available, but since our recent "upgrade" to 2007 (file is still in MDB format) it's no longer there. Please keep in mind I'm not an Access dev, nor did I create this app - I inherited support for it. ;) Now for the details, and what I've tried. The form in question is a subform on a larger form. I've tried turning "AllowDeletes" on on both forms. I've checked the toolbar and ribbon properties on the forms to see if they loaded some custom stuff, but no. I've tried changing the "record locks" to "on edit", no joy. I examined the query to see if it was "too complicated" to permit a delete - as far as I can tell, it's a very simple two (linked) table join. Compared to another form in this app that does permit row deletes, it has a much more complicated (multi-join, built on queries) query. Is there a resource that would describe the required conditions for allowing deletes? Thanks in advance...

    Read the article

  • ROR accepts_nested_attributes_for one to many relationship with selection

    - by bilash.saha
    I have two models Doctors and Questions like the follwong: Doctor Model class Doctor < ActiveRecord::Base has_many :questions has_many :brands accepts_nested_attributes_for :questions end Question model class Question < ActiveRecord::Base belongs_to :discipline belongs_to :doctor belongs_to :brand end Now you can clearly see that Doctor has many questions and brands and question belongs to doctor and brand.I want to add previously saved question to a doctor from doctors edit page. I want to remove them as well.How can I proceed ? I tried like : <%= form.fields_for :questions, question,:child_index => (question.new_record? ? "index_to_replace_with_js" : nil) do |question_form| %> <table> <tr> <td> <div class="label">Select Question</div> <%= question_form.collection_select :id, Question.all, :id, :title ,{:include_blank => true } %> </td> </tr> </table> but this doesnot works for me.Can you give me a solution with proper example ?

    Read the article

  • Error in merging two sequences of timestamps to yield strings

    - by AruniRC
    The code sorts two input sequences - seq01 and seq02 - on the basis of their timestamp values and returns a sequence that denotes which sequence is to be read for the values to be in order. For cases where seq02's timestamp value is lesser than seq01's timestamp value we yield a "2" to the sequence being returned, else a "1". These denote whether at that point seq01 is to be taken or seq02 is to be taken for the data to be in order (by timestamp value). let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let _,_,time01 = iter01.Current let _,_,time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } To test it in the FSI created two sequences a and b, a={1;3;5;...} and b={0;2;4;...}. So the expected values for let c = mergeSeq a b would have been {"2","1","2","1"...}. However I am getting this error: error FS0001: The type ''a * 'b * 'c' does not match the type 'int' EDIT After correcting: let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let time01 = iter01.Current let time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } After running this, there's another error: call MoveNext. Somehow the iteration is not being performed.

    Read the article

  • ASP:DropDownList in ItemTemplate: Why is SelectedValue attribute allowed?

    - by recursive
    This piece of code <asp:DropDownList runat="server" ID="testdropdown" SelectedValue="2"> <asp:ListItem Text="1" Value="1"></asp:ListItem> <asp:ListItem Text="2" Value="2"></asp:ListItem> <asp:ListItem Text="3" Value="3"></asp:ListItem> </asp:DropDownList> yields this error: The 'SelectedValue' property cannot be set declaratively. Yet, this is a legal and commonly used edit template for databound GridViews. The SelectedValue attribute certainly appears to be declaratively set here. <EditItemTemplate> <asp:DropDownList runat="server" ID="GenreDropDownList" DataSourceID="GenreDataSource" DataValueField="GenreId" DataTextField="Name" SelectedValue='<%# Bind("Genre.GenreId") %>'> </asp:DropDownList> </EditItemTemplate> The question is: what is the difference between the cases when you are allowed to set it declaratively and those in which you are not? The error message implies that it's never allowed.

    Read the article

< Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >