Search Results

Search found 18729 results on 750 pages for 'edit'.

Page 619/750 | < Previous Page | 615 616 617 618 619 620 621 622 623 624 625 626  | Next Page >

  • How to add images while moving finger across UIView?

    - by Luke Irvin
    I am having issues adding an image across a view while moving finger across the screen. Currently it is adding the image multiple times but squeezing them too close together and not really following my touch. Here is what I am trying: -(void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch * touch = [touches anyObject]; touchPoint = [touch locationInView:imageView]; if (touchPoint.x > 0 && touchPoint.y > 0) { _aImageView = [[UIImageView alloc] initWithImage:aImage]; _aImageView.multipleTouchEnabled = YES; _aImageView.userInteractionEnabled = YES; [_aImageView setFrame:CGRectMake(touchPoint.x, touchPoint.y, 80.0, 80.0)]; [imageView addSubview:_aImageView]; [_aImageView release]; } } -(void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { [self touchesBegan:touches withEvent:event]; } Any suggestions is much appreciated. EDIT: What I want: After taking or choosing an image, the user can then select another image from a list. I want the user to touch and move their finger across the view and the selected image will appear where they drag their finger, without overlapping, in each location.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • UnicodeEncodeError: 'ascii' codec can't encode character [...]

    - by user1461135
    I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

    Read the article

  • Why is Firefox so bloated? [closed]

    - by bvandrunen
    First off I am a developer who loves firebug and other development tools (and no Chrome firebug lite does not cut it) and am just utterly frustrated when I have been using Firefox lately. It is at the point where I use Chrome for absolutely everything but web development but am still frustrated that I had to switch where half a year ago or more Firefox was fine. Why can't there be a Firefox lite? One that is free from all the bloat that has been plaguing Firefox recently. Also if there are any tools or tips that I can free up my Firefox that would be great. I am using the newest version + as few add-ons as possible. EDIT: I have tried Chrome Developer Tools and I do like them...but I can't get passed the firebug lite extension of Chrome. Some of the developer tools are great but sometimes they just have too much information. I extensively use Firebug/myphp admin. Both of these work much much better in Firefox then Chrome. But I hate that it takes me so much longer to load and use everything.

    Read the article

  • Convert SQL to LINQ in MVC3 with Ninject

    - by Jeff
    I'm using MVC3 and still learning LINQ. I'm having some trouble trying to convert a query to LINQ to Entities. I want to return an employee object. SELECT E.EmployeeID, E.FirstName, E.LastName, MAX(EO.EmployeeOperationDate) AS "Last Operation" FROM Employees E INNER JOIN EmployeeStatus ES ON E.EmployeeID = ES.EmployeeID INNER JOIN EmployeeOperations EO ON ES.EmployeeStatusID = EO.EmployeeStatusID INNER JOIN Teams T ON T.TeamID = ES.TeamID WHERE T.TeamName = 'MyTeam' GROUP BY E.EmployeeID, E.FirstName, E.LastName ORDER BY E.FirstName, E.LastName What I have is a few tables, but I need to get only the newest status based on the EmployeeOpertionDate. This seems to work fine in SQL. I'm also using Ninject and set my query to return Ienumerable. I played around with the group by option but it then returns IGroupable. Any guidance on converting and returning the property object type would be appreciated. Edit: I started writing this out in LINQ but I'm not sure how to properly return the correct type or cast this. public IQueryable<Employee> GetEmployeesByTeam(int teamID) { var q = from E in context.Employees join ES in context.EmployeeStatuses on E.EmployeeID equals ES.EmployeeID join EO in context.EmployeeOperations on ES.EmployeeStatusID equals EO.EmployeeStatusID join T in context.Teams on ES.TeamID equals T.TeamID where T.TeamName == "MyTeam" group E by E.EmployeeID into G select G; return q; } Edit2: This seems to work for me public IQueryable<Employee> GetEmployeesByTeam(int teamID) { var q = from E in context.Employees join ES in context.EmployeeStatuses on E.EmployeeID equals ES.EmployeeID join EO in context.EmployeeOperations.OrderByDescending(eo => eo.EmployeeOperationDate) on ES.EmployeeStatusID equals EO.EmployeeStatusID join T in context.Teams on ES.TeamID equals T.TeamID where T.TeamID == teamID group E by E.EmployeeID into G select G.FirstOrDefault(); return q; }

    Read the article

  • How do I run NUnit in debug mode from Visual Studio?

    - by Jon Cage
    I've recently been building a test framework for a bit of C# I've been working on. I have NUnit set up and a new project within my workspace to test the component. All works well if I load up my unit tests from Nunit (v2.4), but I've got to the point where it would be really useful to run in debug mode and set some break points. I've tried the suggestions from several guides which all suggest changing the 'Debug' properties of the test project: Start external program: C:\Program Files\NUnit 2.4.8\bin\nunit-console.exe Command line arguments: /assembly: <full-path-to-solution>\TestDSP\bin\Debug\TestDSP.dll I'm using the console version there, but have tried the calling the GUI as well. Both give me the same error when I try and start debugging: Cannot start test project 'TestDSP' because the project does not contain any tests. Is this because I normally load \DSP.nunit into the Nunit GUI and that's where the tests are held? I'm beginning to think the problem may be that VS wants to run it's own test framework and that's why it's failing to find the NUnit tests? [Edit] To those asking about test fixtures, one of my .cs files in the TestDSP project looks roughly like this: namespace Some.TestNamespace { // Testing framework includes using NUnit.Framework; [TestFixture] public class FirFilterTest { /// <summary> /// Tests that a FirFilter can be created /// </summary> [Test] public void Test01_ConstructorTest() { ...some tests... } } } ...I'm pretty new to C# and the Nunit test framework so it's entirely possible I've missed some crucial bit of information ;-) [FINAL SOLUTION] The big problem was the project I'd used. If you pick: Other Languages->Visual C#->Test->Test Project ...when you're choosing the project type, Visual Studio will try and use it's own testing framework as far as I can tell. You should pick a normal c# class library project instead and then the instructions in my selected answer will work.

    Read the article

  • Why are compilers so stupid?

    - by martinus
    I always wonder why compilers can't figure out simple things that are obvious to the human eye. They do lots of simple optimizations, but never something even a little bit complex. For example, this code takes about 6 seconds on my computer to print the value zero (using java 1.6): int x = 0; for (int i = 0; i < 100 * 1000 * 1000 * 1000; ++i) { x += x + x + x + x + x; } System.out.println(x); It is totally obvious that x is never changed so no matter how often you add 0 to itself it stays zero. So the compiler could in theory replace this with System.out.println(0). Or even better, this takes 23 seconds: public int slow() { String s = "x"; for (int i = 0; i < 100000; ++i) { s += "x"; } return 10; } First the compiler could notice that I am actually creating a string s of 100000 "x" so it could automatically use s StringBuilder instead, or even better directly replace it with the resulting string as it is always the same. Second, It does not recognize that I do not actually use the string at all, so the whole loop could be discarded! Why, after so much manpower is going into fast compilers, are they still so relatively dumb? EDIT: Of course these are stupid examples that should never be used anywhere. But whenever I have to rewrite a beautiful and very readable code into something unreadable so that the compiler is happy and produces fast code, I wonder why compilers or some other automated tool can't do this work for me.

    Read the article

  • Creating a RESTful service in CakePHP

    - by NathanGaskin
    I'm attempting to create a RESTful service in CakePHP but I've hit a bit of a brick wall. I've enabled the default RESTful routing using Router::mapResources('users') and Router::parseExtensions(). This works well if I make a GET request, and returns some nicely formatted XML. So far so good. The problem is if I want to make a POST or PUT request. CakePHP doesn't seem to be able to read the data from the request. At the moment my add(), edit() and delete() actions don't contain any logic, they're simply setting $this-data to the view. I'm testing with the following cURL command: curl -v -d "<user><username>blahblah</username><password>blahblah</password>" http://localhost/users.xml --header 'content-type: text/xml' Which only returns a 404 header. If I remove the --header parameter then it returns the view but no data is set. It feels like I'm missing something obvious here. Any ideas?

    Read the article

  • problem with enable/disable button using javascript

    - by LiveEn
    Im am trying to add a check box that will enable/disable the edit button. Im retrieving a price list and displaying it inside a table. When i add the javascript into the php code it doesn't work. Below is my code <table border="1"> <tr> <td width="100">Fee % </td> <td width="100">Price</td> <td width="100">Total</td> <td width="102">&nbsp;</td> </tr> <tr> <?php $sql1="select * from pricelist"; $result1=mysql_query($sql1) or die(mysql_error()); while ($row=mysql_fetch_array($result1)) { $id=$row['id']; $price=$row['h_price']; $a=0; print "<form id='form1' name='$a+' method='post' action=''>"; print "<td><input name='fees' value ='$fees' type='text' size='4' /></td>"; print "<td><input name='price' value ='$price' type='text' size='15' /></td>"; echo "<td><input type='checkbox' onclick='this.$a+.disabled = !this.checked;'><td>"; print"<td><input type='submit' name='$a+' value='Submit' disabled='disabled' /></td>"; print "</tr>"; print "</form>"; } ?> </table> Can someone please tell me what am i doing wrong? Thanks

    Read the article

  • WPF Usercontrol with textboxes

    - by benPearce
    I have a WPF user control with a number of textboxes, this is hosted on a WPF window. The textboxes are not currently bound but I cannot type into any of them. I have put a breakpoint in the KeyDown event of one of the textboxes and it hits it fine and I can see the key I pressed. The textboxes are declared as <TextBox Grid.Row="3" Grid.Column="4" x:Name="PostcodeSearch" Style="{StaticResource SearchTextBox}" KeyDown="PostcodeSearch_KeyDown"/> The style is implemented as <Style x:Key="SearchTextBox" TargetType="{x:Type TextBox}"> <Setter Property="Control.Margin" Value="2"/> <Setter Property="Height" Value="20"/> <Setter Property="Width" Value="140"/> <Setter Property="HorizontalAlignment" Value="Left"/> </Style> I am hoping I have overlooked something obvious. EDIT: I only added the KeyDown and KeyUp events just to prove that the keys presses were getting through. I do not have any custom functionality.

    Read the article

  • Parallel.Foreach loop creating multiple db connections throws connection errors?

    - by shawn.mek
    Login failed. The login is from an untrusted domain and cannot be used with Windows authentication I wanted to get my code running in parallel, so I changed my foreach loop to a parallel foreach loop. It seemed simple enough. Each loop connects to the database, looks up some stuff, performs some logic, adds some stuff, closes the connection. But I get the above error? I'm using my local sql server and entity framework (each loop uses it's own context). Is there some problem with connecting multiple times using the same local login or something? How did I get around this? I have (before trying to covert to a parallel.foreach loop) split my list of objects that I am foreach looping through into four groups (separate csv files) and run four concurrent instances of my program (which ran faster overall than just one, thus the idea for parallel). So it seems connecting to the db shouldn't be a problem? Any ideas? EDIT: Here's before var gtgGenerator = new CustomGtgGenerator(); var connectionString = ConfigurationManager.ConnectionStrings["BioEntities"].ConnectionString; var allAccessionsFromObs = _GetAccessionListFromDataFiles(collectionId); ForEach(cloneIdAndAccessions in allAccessionsFromObs) DoWork(gtgGenerator, taxonId, organismId, cloneIdAndAccessions, connectionString)); after var gtgGenerator = new CustomGtgGenerator(); var connectionString = ConfigurationManager.ConnectionStrings["BioEntities"].ConnectionString; var allAccessionsFromObs = _GetAccessionListFromDataFiles(collectionId); Parallel.ForEach(allAccessionsFromObs, cloneIdAndAccessions => DoWork(gtgGenerator, taxonId, organismId, cloneIdAndAccessions, connectionString)); Inside the DoWork I use the BioEntities using (var bioEntities = new BioEntities(connectionString)) {...}

    Read the article

  • Populate asp.net MVC Index page with data from the database

    - by Sunil Ramu
    I have a web application in which I need to fetch data from the database and display in the index page. As you know, asp.net mvc has given options to edit delete etc... I need to populate the page using the conventional DB way and it uses a stored procedure to retrieve results. I dont want to use LINQ. This is my model entity class using System; using System.Collections.Generic; using System.Linq; using System.Web; namespace LogMVCApp.Models { public class Property { public int Id { get; set; } public string LogInId { get; set; } public string Username { get; set; } public string Action { get; set; } public string Information { get; set; } public bool Passed{get; set; } public string LogType { get; set; } } } and I need to retrieve data using something like this... var conString = ConfigurationManager.ConnectionStrings["connection"].ToString(); var conn = new SqlConnection(conString); var command = new SqlCommand("LogInsert", conn){CommandType=CommandType.StoredProcedure};

    Read the article

  • Building a custom Linux Live CD

    - by Mike Heinz
    Can anyone point me to a good tutorial on creating a bootable Linux CD from scratch? I need help with a fairly specialized problem: my firm sells an expansion card that requires custom firmware. Currently we use an extremely old live CD image of RH7.2 that we update with current firmware. Manufacturing puts the cards in a machine, boots off the CD, the CD writes the firmware, they power off and pull the cards. Because of this cycle, it's essential that the CD boot and shut down as quickly as possible. The problem is that with the next generation of cards, I have to update the CD to a 2.6 kernel. It's easy enough to acquire a pre-existing live CD - but those all are designed for showing off Linux on the desktop - which means they take forever to boot. Can anyone fix me up with a current How-To? Update: So, just as a final update for anyone reading this later - the tool I ended up using was "livecd-creator". My reason for choosing this tool was that it is available for RedHat-based distributions like CentOs, Fedora and RHEL - which are all distributions that my company supports already. In addition, while the project is very poorly documented it is extremely customizable. I was able to create a minimal LiveCD and edit the boot sequence so that it booted directly into the firmware updater instead of a bash shell. The whole job would have only taken an hour or two if there had been a README explaining the configuration file!

    Read the article

  • Intel MKL memory management and exceptions

    - by Andrew
    Hello everyone, I am trying out Intel MKL and it appears that they have their own memory management (C-style). They suggest using their MKL_malloc/MKL_free pairs for vectors and matrices and I do not know what is a good way to handle it. One of the reasons for that is that memory-alignment is recommended to be at least 16-byte and with these routines it is specified explicitly. I used to rely on auto_ptr and boost::smart_ptr a lot to forget about memory clean-ups. How can I write an exception-safe program with MKL memory management or should I just use regular auto_ptr's and not bother? Thanks in advance. EDIT http://software.intel.com/sites/products/documentation/hpc/mkl/win/index.htm this link may explain why I brought up the question UPDATE I used an idea from the answer below for allocator. This is what I have now: template <typename T, size_t TALIGN=16, size_t TBLOCK=4> class aligned_allocator : public std::allocator<T> { public: pointer allocate(size_type n, const void *hint) { pointer p = NULL; size_t count = sizeof(T) * n; size_t count_left = count % TBLOCK; if( count_left != 0 ) count += TBLOCK - count_left; if ( !hint ) p = reinterpret_cast<pointer>(MKL_malloc (count,TALIGN)); else p = reinterpret_cast<pointer>(MKL_realloc((void*)hint,count,TALIGN)); return p; } void deallocate(pointer p, size_type n){ MKL_free(p); } }; If anybody has any suggestions, feel free to make it better.

    Read the article

  • Program to format every media in c++

    - by AtoMerZ
    Problem: I'm trying to write a program that formats any type of media. So far I've managed to format Hard disk partitions, flash memories, SDRAM, RDX. But there's this last type of media (DVD-RAM) I need to format. My program fails to format this media. I'm using the FormatEx function in fmifs.dll. I had absolutely no idea how to use this function Except for its name and that it resides in fmifs.dll. with the help of this I managed to find a simple program that uses this library. Yet still it doesn't give complete information about how to use it. What I've tried: I'm looking for a full documentation about FormatEx, its parameters, and exactly what values each parameter can take. I tried searching on google and MSDN. This is what I found. First of all this isn't the function I'm working with. But even putting that aside there's not enough information on how to use the function (Like which headers/libraries to use). EDIT: I don't have to use FormatEx if there's an alternative to use please tell.

    Read the article

  • git changes modification time of files

    - by tanascius
    In the GitFaq I can read, that Git sets the current time as the timestamp on every file it modifies, but only those. However, I tried this command sequence (EDIT: added complete command sequence) $ git init test && cd test Initialized empty Git repository in d:/test/.git/ exxxxxxx@wxxxxxxx /d/test (master) $ touch filea fileb exxxxxxx@wxxxxxxx /d/test (master) $ git add . exxxxxxx@wxxxxxxx /d/test (master) $ git commit -m "first commit" [master (root-commit) fcaf171] first commit 0 files changed, 0 insertions(+), 0 deletions(-) create mode 100644 filea create mode 100644 fileb exxxxxxx@wxxxxxxx /d/test (master) $ ls -l > filea exxxxxxx@wxxxxxxx /d/test (master) $ touch fileb -t 200912301000 exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 1 -rw-r--r-- 1 exxxxxxx Administ 132 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Dec 30 10:00 fileb exxxxxxx@wxxxxxxx /d/test (master) $ git status -a warning: LF will be replaced by CRLF in filea # On branch master warning: LF will be replaced by CRLF in filea # Changes to be committed: # (use "git reset HEAD <file>..." to unstage) # # modified: filea # exxxxxxx@wxxxxxxx /d/test (master) $ git checkout . exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 0 -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 fileb Now my question: Why did git change the timestamp of file fileb? I'd expect the timestamp to be unchanged. Are my commands causing a problem? Maybe it is possible to do something like a git checkout . --modified instead? I am using git version 1.6.5.1.1367.gcd48 under mingw32/windows xp.

    Read the article

  • NetBeans Platform - how to refresh the property sheet view of a node?

    - by I82Much
    Hi all, I am using the PropertySheetView component to visualize and edit the properties of a node. This view should always reflect the most recent properties of the object; if there is a change to the object in another process, I want to somehow refresh the view and see the updated properties. The best way I was able to do this is something like the following (making use of EventBus library to publish and subscribe to changes in objects): public DomainObjectWrapperNode(DomainObject obj) { super (Children.LEAF, Lookups.singleton(obj)); EventBus.subscribe(DomainObject.class, this); } public void onEvent(DomainObject event) { // Do a check to determine if the updated object is the one wrapped by this node; // if so fire a property sets change firePropertySetsChange(null, this.getPropertySets()); } This works, but my place in the scrollpane is lost when the sheet refreshes; it resets the view to the top of the list and I have to scroll back down to where I was before the refresh action. So my question is, is there a better way to refresh the property sheet view of a node, specifically so my place in the property list is not lost upon refresh?

    Read the article

  • How to wait until location is completely found? (Core Location)

    - by sudo rm -rf
    Hello. I have a problem within my app. I'm trying to find the user's location to the best preciseness in order to determine their zip-code. Currently I have a button that, when pressed, starts a method named locateMe. -(IBAction)locateMe; { self.locationManager = [[CLLocationManager alloc] init]; locationManager.delegate = self; locationManager.desiredAccuracy = kCLLocationAccuracyBest; [locationManager startUpdatingLocation]; Then I've implemented didUpdateToLocation: -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation; { NSLog(@"Found location! %f,%f",newLocation.coordinate.latitude,newLocation.coordinate.longitude); } I had previously done much more complicated stuff in didUpdateToLocation but as I tested some things I realized that the first location it found was not precise in the least. So, I put the NSLog call in there and it gave me an output similar to below... Found location! 39.594093,-98.614834 Found location! 39.601372,-98.592171 Found location! 39.601372,-98.592171 Found location! 39.611444,-98.538196 Found location! 39.611444,-98.538196 As you can see, it first gives me a value which is not correct, which was causing problems within my app because it wasn't giving the correct location. So, here's my question. Is there any way I can wait for the location manager to finish finding the most precise location? Thanks in advance! EDIT: I'm wanting something like this: if (newLocation.horizontalAccuracy <= locationManager.desiredAccuracy) { } But it never gets called!

    Read the article

  • How can I generate an "unlimited" world?

    - by snowlord
    I would like to create a game with an endless (in reality an extremely large) world in which the player can move about. Whether or not I will ever get around to implement the game is one matter, but I find the idea interesting and would like some input on how to do it. The point is to have a world where all data is generated randomly on-demand, but in a deterministic way. Currently I focus on a large 2D map from which it should be possible to display any part without knowledge about the surrounding parts. I have implemented a prototype by writing a function that gives a random-looking, but deterministic, integer given the x and y of a pixel on the map (see my recent question about this function). Using this function I populate the map with "random" values, and then I smooth the map using a simple filter based on the surrounding pixels. This makes the map dependent on a few pixels outside its edge, but that's not a big problem. The final result is something that at least looks like a map (especially with a good altitude color map). Given this, one could maybe first generate a coarser map which is used to generate bigger differences in altitude to create mountain ranges and seas. Anyway, that was my idea, but I am sure that there exist ways to do this already and I also believe that given the specification, many of you can come up with better ideas. EDIT: Forgot the link to my question.

    Read the article

  • C# Minimize all running windows when application runs

    - by Derek
    I am working on a C# windows form application. How can i edit my code in a way that when more than 2 faces is being detected by my webcam. More information: When "FaceDetectedLabel.Text = "Faces Detected : " + cam.facesdetected.ToString();" becomes Face Detected: 2 or more... How can i do the following: Minimize all program running except my application. Log out of my computer Here is my code: namespace PBD { public partial class MainPage : Form { //declaring global variables private Capture capture; //takes images from camera as image frames public MainPage() { InitializeComponent(); } private void ProcessFrame(object sender, EventArgs arg) { Wrapper cam = new Wrapper(); //show the image in the EmguCV ImageBox WebcamPictureBox.Image = cam.start_cam(capture).Resize(390, 243, Emgu.CV.CvEnum.INTER.CV_INTER_CUBIC).ToBitmap(); FaceDetectedLabel.Text = "Faces Detected : " + cam.facesdetected.ToString(); } private void MainPage_Load(object sender, EventArgs e) { #region if capture is not created, create it now if (capture == null) { try { capture = new Capture(); } catch (NullReferenceException excpt) { MessageBox.Show(excpt.Message); } } #endregion Application.Idle += ProcessFrame; }

    Read the article

  • How do I stop js files being cached in IE?

    - by DoctaJonez
    Hello stackers! I've created a page that uses the CKEditor javascript rich edit control. It's a pretty neat control, especially seeing as it's free, but I'm having serious issues with the way it allows you to add templates. To add a template you need to modify the templates js file in the CKEditor templates folder. The documentation page describing it is here. This works fine until I want to update a template or add a new one (or anything else that requires me to modify the js file). Internet Explorer caches the js file and doesn't pick up the update. Emptying the cache allows the update to be picked up, but this isn't an acceptable solution. Whenever I update a template I do not want to tell all of the users across the organisation to empty their IE cache. There must be a better way! Is there a way to stop IE caching the js file? Or is there another solution to this problem?

    Read the article

  • ModRewrite weird redirect behavior on removing WWW

    - by vitto
    Hi, I'm trying to use some rule on my project to remove www from the beginning of the URL but I've some problem. my server structure is: domain.com/beta_folder domain.com/beta_folder/page+type domain.com/beta_folder/page+type/content+name domain.com/beta_folder/page+type/content+name/edit domain.com/beta_folder/page+type/content+name/etc. domain.com/beta_folder/.htaccess //here is where my htaccess is beta_folder is the site folder, and content+name are content vars, created to retrieve pages from the database. the site works perfect with this rules RewriteEngine On RewriteRule ^(page\+type/)([a-zA-Z0-9_+-]+)[/]?$ page_folder/page.php?varname=$2 My intention was to remove www, so I've added this rule but it isn't effective RewriteEngine On RewriteCond %{HTTP_HOST} ^www.domain.com$ [NC] RewriteRule ^(.*)$ http://domain.com$1 [R=301,L] RewriteRule ^(page\+type/)([a-zA-Z0-9_+-]+)[/]?$ page_folder/page.php?varname=$2 My problem starts if I digit www in front of my domain name: this works http://domain.com/beta_folder/page+type/content+name if i write http://www.domain.com/beta_folder/page+type/content+name the rewrite rule redirect me at http://www.domain.compage+type/content+name if i remove the www rules, the problem still active unfortunately, I can't make a public test for my domain basically, if I write http://www.domain.com/beta_folder the rules sends me to http://domain.com/ where I'm wrong?

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • using libcurl to check if a file exists on a SFTP site

    - by Snazzer
    I'm using C++ with libcurl to do SFTP/FTPS transfers. Before uploading a file, I need to check if the file exists without actually downloading it. If the file doesn't exist, I run into the following problems: //set up curlhandle for the public/private keys and whatever else first. curl_easy_setopt(CurlHandle, CURLOPT_URL, "sftp://user@pass:host/nonexistent-file"); curl_easy_setopt(CurlHandle, CURLOPT_NOBODY, 1); curl_easy_setopt(CurlHandle, CURLOPT_FILETIME, 1); int result = curl_easy_perform(CurlHandle); //result is CURLE_OK, not CURLE_REMOTE_FILE_NOT_FOUND //using curl_easy_getinfo to get the file time will return -1 for filetime, regardless //if the file is there or not. If I don't use CURLOPT_NOBODY, it works, I get CURLE_REMOTE_FILE_NOT_FOUND. However, if the file does exist, it gets downloaded, which wastes time for me, since I just want to know if it's there or not. Any other techniques/options I'm missing? Note that it should work for ftps as well. Edit: This error occurs with sftp. With FTPS/FTP I get CURLE_FTP_COULDNT_RETR_FILE, which I can work with.

    Read the article

  • Django + jquery : getting 301

    - by llazzaro
    Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

    Read the article

< Previous Page | 615 616 617 618 619 620 621 622 623 624 625 626  | Next Page >