Search Results

Search found 16731 results on 670 pages for 'memory limit'.

Page 636/670 | < Previous Page | 632 633 634 635 636 637 638 639 640 641 642 643  | Next Page >

  • Help with C# program design implementation: multiple array of lists or a better way?

    - by Bob
    I'm creating a 2D tile-based RPG in XNA and am in the initial design phase. I was thinking of how I want my tile engine to work and came up with a rough sketch. Basically I want a grid of tiles, but at each tile location I want to be able to add more than one tile and have an offset. I'd like this so that I could do something like add individual trees on the world map to give more flair. Or set bottles on a bar in some town without having to draw a bunch of different bar tiles with varying bottles. But maybe my reach is greater than my grasp. I went to implement the idea and had something like this in my Map object: List<Tile>[,] Grid; But then I thought about it. Let's say I had a world map of 200x200, which would actually be pretty small as far as RPGs go. That would amount to 40,000 Lists. To my mind I think there has to be a better way. Now this IS pre-mature optimization. I don't know if the way I happen to design my maps and game will be able to handle this, but it seems needlessly inefficient and something that could creep up if my game gets more complex. One idea I have is to make the offset and the multiple tiles optional so that I'm only paying for them when needed. But I'm not sure how I'd do this. A multiple array of objects? object[,] Grid; So here's my criteria: A 2D grid of tile locations Each tile location has a minimum of 1 tile, but can optionally have more Each extra tile can optionally have an x and y offset for pinpoint placement Can anyone help with some ideas for implementing such a design (don't need it done for me, just ideas) while keeping memory usage to a minimum? If you need more background here's roughly what my Map and Tile objects amount to: public struct Map { public Texture2D Texture; public List<Rectangle> Sources; //Source Rectangles for where in Texture to get the sprite public List<Tile>[,] Grid; } public struct Tile { public int Index; //Where in Sources to find the source Rectangle public int X, Y; //Optional offsets }

    Read the article

  • Java app makes screen display unresponsive after 10 minutes of user idle time

    - by Ross
    I've written a Java app that allows users to script mouse/keyboard input (JMacro, link not important, only for the curious). I personally use the application to automate character actions in an online game overnight while I sleep. Unfortunately, I keep coming back to the computer in the morning to find it unresponsive. Upon further testing, I'm finding that my application causes the computer to become unresponsive after about 10 minutes of user idle time (even if the application itself it simulating user activity). I can't seem to pin-point the issue, so I'm hoping somebody else might have a suggestion of where to look or what might be causing the issue. The relevant symptoms and characteristics: Unresponsiveness occurs after user is idle for 10 minutes User can still move the mouse pointer around the screen Everything but the mouse appears frozen... mouse clicks have no effect and no applications update their displays, including the Windows 7 desktop I left the task manager up along the with the app overnight so I could see the last task manager image before the screen freezes... the Java app is at normal CPU/Memory usage and total CPU usage is only ~1% After moving the mouse (in other words, the user comes back from being idle), the screen image starts updating again within 30 minutes (this is very hit and miss... sometimes 10 minutes, sometimes no results after two hours) User can CTRL-ALT-DEL to get to Windows 7's CTRL-ALT-DEL screen (after a 30 second pause). User is still able to move mouse pointer, but clicking any of the button options causes the screen to appear to freeze again On some very rare occasions, the system never freezes, and I come back to it in the morning with full responsiveness The Java app automatically stops input scripting in the middle of the night, so Windows 7 detects "real" idleness and turns the monitors into Standby mode... which they successfully come out of upon manually moving the mouse in the morning when I wake up, even though the desktop display still appears frozen Given the symptoms and characteristics of the issue, it's as if the Java app is causing the desktop display of the logged in user to stop updating, including any running applications. Programming concepts and Java packages used: Multi-threading Standard out and err are rerouted to a javax.swing.JTextArea The application uses a Swing GUI awt.Robot (very heavily used) awt.PointerInfo awt.MouseInfo System Specs: Windows 7 Professional Java 1.6.0 u17 In conclusion, I should stress that I'm not looking for any specific solutions, as I'm not asking a very specific question. I'm just wondering if anybody has run into a similar problem when using the Java libraries that I'm using. I would also gladly appreciate any suggestions for things to try to attempt to further pinpoint what is causing my problem. Thanks! Ross PS, I'll post an update/answer if I manage to stumble across anything else while I continue to debug this.

    Read the article

  • Performing full screen grab in windows

    - by Steven Lu
    I am working an idea that involves getting a full capture of the screen including windows and apps, analyzing it, and then drawing items back onto the screen, as an overlay. I want to learn image processing techniques and I could get lots of data to work with if I can directly access the Windows screen. I could use this to build automation tools the likes of which have never been seen before. More on that later. I have full screen capture working for the most part. HWND hwind = GetDesktopWindow(); HDC hdc = GetDC(hwind); int resx = GetSystemMetrics(SM_CXSCREEN); int resy = GetSystemMetrics(SM_CYSCREEN); int BitsPerPixel = GetDeviceCaps(hdc,BITSPIXEL); HDC hdc2 = CreateCompatibleDC(hdc); BITMAPINFO info; info.bmiHeader.biSize = sizeof(BITMAPINFOHEADER); info.bmiHeader.biWidth = resx; info.bmiHeader.biHeight = resy; info.bmiHeader.biPlanes = 1; info.bmiHeader.biBitCount = BitsPerPixel; info.bmiHeader.biCompression = BI_RGB; void *data; hbitmap = CreateDIBSection(hdc2,&info,DIB_RGB_COLORS,(void**)&data,0,0); SelectObject(hdc2,hbitmap); Once this is done, I can call this repeatedly: BitBlt(hdc2,0,0,resx,resy,hdc,0,0,SRCCOPY); The cleanup code (I have no idea if this is correct): DeleteObject(hbitmap); ReleaseDC(hwind,hdc); if (hdc2) { DeleteDC(hdc2); } Every time BitBlt is called it grabs the screen and saves it in memory I can access thru data. Performance is somewhat satisfactory. BitBlt executes in 50 milliseconds (sometimes as low as 33ms) at 1920x1200x32. What surprises me is that when I switch display mode to 16 bit, 1920x1200x16, either through my graphics settings beforehand, or by using ChangeDisplaySettings, I get a massively improved screen grab time between 1ms and 2ms, which cannot be explained by the factor of two reduction in bit-depth. Using CreateDIBSection (as above) offers a significant speed up when in 16-bit mode, compared to if I set up with CreateCompatibleBitmap (6-7ms/f). Does anybody know why dropping to 16bit causes such a speed increase? Is there any hope for me to grab 32bit at such speeds? if not for the color depth, but for not forcing a change of screen buffer modes and the awful flickering.

    Read the article

  • Issues declaring already existing NSMutableArray in new class

    - by Graeme
    I have a class (DataImporter) which has the code to download an RSS feed. I also have a view and separate class (TableView) which displays the data in a UITableView and starts the parsing process, storing parsed information in an NSMutableArray (items) which is located in the (TableView) subclass. Now I wish to add a UIMapView which displays the items in the (items) NSMutableArray. Herein lies the issue - I need to somehow get the data from the (items) NSMutableArray into the new (mapView) subclass which I'm struggling with - and I preferably don't want to have to create a new class to download the data again for the mapView class when it already is in the applications memory. Is there a way I can transfer the information from the NSMutableArray (items) class to the (mapView) class (i.e. how do I declare the NSMutableArray in the (mapView) class)? Here's a overview of how the system works: App opened Data downloaded (using DataImporter class) when (TableView) viewDidLoad runs Data stored in NSMutableArray accessible by the (TableView) class And from here I need to access and declare the array from a new (mapView) class. Any help greatly appreciated, thanks. Code for viewDidLoad MapKit: Data *data = nil; NSString *ilocation = [data locations]; NSString *ilocation2 = @"New Zealand"; NSString *inewlString; inewlString = [ilocation stringByAppendingString:ilocation2]; NSLog(@"inewlString=%@",inewlString); if(forwardGeocoder == nil) { forwardGeocoder = [[BSForwardGeocoder alloc] initWithDelegate:self]; } // Forward geocode! [forwardGeocoder findLocation: inewlString]; Code for parsing data into original NSMutable Array: - (void)beginParsing { NSLog(@"Parsing has begun"); //self.navigationItem.rightBarButtonItem.enabled = NO; // Allocate the array for song storage, or empty the results of previous parses if (incidents == nil) { NSLog(@"Grabbing array"); self.datas = [NSMutableArray array]; } else { [datas removeAllObjects]; [self.tableView reloadData]; } // Create the parser, set its delegate, and start it. self.parser = [[DataImporter alloc] init]; parser.delegate = self; [parser start]; }

    Read the article

  • How can I optimize this subqueried and Joined MySQL Query?

    - by kevzettler
    I'm pretty green on mysql and I need some tips on cleaning up a query. It is used in several variations through out a site. Its got some subquerys derived tables and fun going on. Heres the query: # Query_time: 2 Lock_time: 0 Rows_sent: 0 Rows_examined: 0 SELECT * FROM ( SELECT products . *, categories.category_name AS category, ( SELECT COUNT( * ) FROM distros WHERE distros.product_id = products.product_id) AS distro_count, (SELECT COUNT(*) FROM downloads WHERE downloads.product_id = products.product_id AND WEEK(downloads.date) = WEEK(curdate())) AS true_downloads, (SELECT COUNT(*) FROM views WHERE views.product_id = products.product_id AND WEEK(views.date) = WEEK(curdate())) AS true_views FROM products INNER JOIN categories ON products.category_id = categories.category_id ORDER BY created_date DESC, true_views DESC ) AS count_table WHERE count_table.distro_count > 0 AND count_table.status = 'published' AND count_table.active = 1 LIMIT 0, 8 Heres the explain: +----+--------------------+------------+-------+---------------+-------------+---------+------------------------------------+------+----------------------------------------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+--------------------+------------+-------+---------------+-------------+---------+------------------------------------+------+----------------------------------------------+ | 1 | PRIMARY | <derived2> | ALL | NULL | NULL | NULL | NULL | 232 | Using where | | 2 | DERIVED | categories | index | PRIMARY | idx_name | 47 | NULL | 13 | Using index; Using temporary; Using filesort | | 2 | DERIVED | products | ref | category_id | category_id | 4 | digizald_db.categories.category_id | 9 | | | 5 | DEPENDENT SUBQUERY | views | ref | product_id | product_id | 4 | digizald_db.products.product_id | 46 | Using where | | 4 | DEPENDENT SUBQUERY | downloads | ref | product_id | product_id | 4 | digizald_db.products.product_id | 14 | Using where | | 3 | DEPENDENT SUBQUERY | distros | ref | product_id | product_id | 4 | digizald_db.products.product_id | 1 | Using index | +----+--------------------+------------+-------+---------------+-------------+---------+------------------------------------+------+----------------------------------------------+ 6 rows in set (0.04 sec) And the Tables: mysql> describe products; +---------------+--------------------------------------------------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------------+--------------------------------------------------+------+-----+-------------------+----------------+ | product_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_key | char(32) | NO | | NULL | | | title | varchar(150) | NO | | NULL | | | company | varchar(150) | NO | | NULL | | | user_id | int(10) unsigned | NO | MUL | NULL | | | description | text | NO | | NULL | | | video_code | text | NO | | NULL | | | category_id | int(10) unsigned | NO | MUL | NULL | | | price | decimal(10,2) | NO | | NULL | | | quantity | int(10) unsigned | NO | | NULL | | | downloads | int(10) unsigned | NO | | NULL | | | views | int(10) unsigned | NO | | NULL | | | status | enum('pending','published','rejected','removed') | NO | | NULL | | | active | tinyint(1) | NO | | NULL | | | deleted | tinyint(1) | NO | | NULL | | | created_date | datetime | NO | | NULL | | | modified_date | timestamp | NO | | CURRENT_TIMESTAMP | | | scrape_source | varchar(215) | YES | | NULL | | +---------------+--------------------------------------------------+------+-----+-------------------+----------------+ 18 rows in set (0.00 sec) mysql> describe categories -> ; +------------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+------------------+------+-----+---------+----------------+ | category_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | category_name | varchar(45) | NO | MUL | NULL | | | parent_id | int(10) unsigned | YES | MUL | NULL | | | category_type_id | int(10) unsigned | NO | | NULL | | +------------------+------------------+------+-----+---------+----------------+ 4 rows in set (0.00 sec) mysql> describe compatibilities -> ; +------------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+------------------+------+-----+---------+----------------+ | compatibility_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | name | varchar(45) | NO | | NULL | | | code_name | varchar(45) | NO | | NULL | | | description | varchar(128) | NO | | NULL | | | position | int(10) unsigned | NO | | NULL | | +------------------+------------------+------+-----+---------+----------------+ 5 rows in set (0.01 sec) mysql> describe distros -> ; +------------------+--------------------------------------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+--------------------------------------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_id | int(10) unsigned | NO | MUL | NULL | | | compatibility_id | int(10) unsigned | NO | MUL | NULL | | | user_id | int(10) unsigned | NO | | NULL | | | status | enum('pending','published','rejected','removed') | NO | | NULL | | | distro_type | enum('file','url') | NO | | NULL | | | version | varchar(150) | NO | | NULL | | | filename | varchar(50) | YES | | NULL | | | url | varchar(250) | YES | | NULL | | | virus | enum('READY','PASS','FAIL') | YES | | NULL | | | downloads | int(10) unsigned | NO | | 0 | | +------------------+--------------------------------------------------+------+-----+---------+----------------+ 11 rows in set (0.01 sec) mysql> describe downloads; +------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_id | int(10) unsigned | NO | MUL | NULL | | | distro_id | int(10) unsigned | NO | MUL | NULL | | | user_id | int(10) unsigned | NO | MUL | NULL | | | ip_address | varchar(15) | NO | | NULL | | | date | datetime | NO | | NULL | | +------------+------------------+------+-----+---------+----------------+ 6 rows in set (0.01 sec) mysql> describe views -> ; +------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_id | int(10) unsigned | NO | MUL | NULL | | | user_id | int(10) unsigned | NO | MUL | NULL | | | ip_address | varchar(15) | NO | | NULL | | | date | datetime | NO | | NULL | | +------------+------------------+------+-----+---------+----------------+ 5 rows in set (0.00 sec)

    Read the article

  • JPA2 adding referential contraint to table complicates criteria query with lazy fetch, need advice

    - by Quaternion
    Following is a lot of writing for what I feel is a pretty simple issue. Root of issue is my ignorance, not looking so much for code but advice. Table: Ininvhst (Inventory-schema inventory history) column ihtran (inventory history transfer code) using an old entity mapping I have: @Basic(optional = false) @Column(name = "IHTRAN") private String ihtran; ihtran is really a foreign key to table Intrnmst ("Inventory Transfer Master" which contains a list of "transfer codes"). This was not expressed in the database so placed a referential constraint on Ininvhst re-generating JPA2 entity classes produced: @JoinColumn(name = "IHTRAN", referencedColumnName = "TMCODE", nullable = false) @ManyToOne(optional = false) private Intrnmst intrnmst; Now previously I was using JPA2 to select the records/(Ininvhst entities) from the Ininvhst table where "ihtran" was one of a set of values. I used in.value() to do this... here is a snippet: cq = cb.createQuery(Ininvhst.class); ... In in = cb.in(transactionType); //Get in expression for transacton types for (String s : transactionTypes) { //has a value in = in.value(s);//check if the strings we are looking for exist in the transfer master } predicateList.add(in); My issue is that the Ininvhst used to contain a string called ihtran but now it contains Ininvhst... So I now need a path expression: this.predicateList = new ArrayList<Predicate>(); if (transactionTypes != null && transactionTypes.size() > 0) { //list of strings has some values Path<Intrnmst> intrnmst = root.get(Ininvhst_.intrnmst); //get transfermaster from Ininvhst Path<String> transactionType = intrnmst.get(Intrnmst_.tmcode); //get transaction types from transfer master In<String> in = cb.in(transactionType); //Get in expression for transacton types for (String s : transactionTypes) { //has a value in = in.value(s);//check if the strings we are looking for exist in the transfer master } predicateList.add(in); } Can I add ihtran back into the entity along with a join column that is both references "IHTRAN"? Or should I use a projection to somehow return Ininvhst along with the ihtran string which is now part of the Intrnmst entity. Or should I use a projection to return Ininvhst and somehow limit Intrnmst just just the ihtran string. Further information: I am using the resulting list of selected Ininvhst objects in a web application, the class which contains the list of Ininvhst objects is transformed into a json object. There are probably quite a few serialization methods that would navigate the object graph the problem is that my current fetch strategy is lazy so it hits the join entity (Intrnmst intrnmst) and there is no Entity Manager available at that point. At this point I have prevented the object from serializing the join column but now I am missing a critical piece of data. I think I've said too much but not knowing enough I don't know what you JPA experts need. What I would like is my original object to have both a string object and be able to join on the same column (ihtran) and have it as a string too, but if this isn't possible or advisable I want to hear what I should do and why. Pseudo code/English is more than fine.

    Read the article

  • Approach for authentication and storing user details.

    - by cappuccino
    Hey folks, I am using the Zend Framework but my question is broadly about sessions / databases / auth (PHP MySQL). Currently this is my approach to authentication: 1) User signs in, the details are checked in database. - Standard stuff really. 2) If the details are correct only the user's unique ID is stored in the session and a security token (user unique ID + IP + Browser info + salt). The session in written to the filesystem. I've been reading around and many are saying that storing stuff in sessions is not a good idea, and that you should really only write a unique ID which refers back to the user's details and a security token to prevent session hijacking. So this is the approach i've taken, i use to write the user's details in session, but i've moved that out. Wanted to know your opinions on this. I'm keeping sessions in the filesystem since i don't run on multiple servers, and since i'm only writting a tiny tiny bit of data to sessions, i thought that performance would be greater keeping sessions in the filesystem to reduce load on the database. Once the session is written on authentication, it really is only read-only from then on. 3) The rest of the user's details (like subscription details, permissions, account info etc) are cached in the filesystem (this can always be easily moved to memory if i wanted even more performance). So rather than keeping the user's details in session, the user's details are cached in the file system. I'm using Zend_Cache and the unique cache id is something like md5(/cache/auth/2892), the number is the unique id of the user. I guess the benefit of this method is that once the user is logged in, there is essentially not database queries being run to get the user's details. Just wonder if this approach is better than keeping the whole lot in session... 4) As the user moves throughout the site the only thing that is checked is the ID in the session and the security token. So, overall the first question is 1) is the filesystem more efficient than a database for this purpose 2) have i taken enough security precautions 3) is separating user detail's from the session into a cached file a pointless task? Thanks.

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Understanding C++ dynamic allocation

    - by kiokko89
    Consider the following code: class CString { private: char* buff; size_t len; public: CString(const char* p):len(0), buff(nullptr) { cout << "Constructor called!"<<endl; if (p!=nullptr) { len= strlen(p); if (len>0) { buff= new char[len+1]; strcpy_s(buff, len+1, p); } } } CString (const CString& s) { cout << "Copy constructor called!"<<endl; len= s.len; buff= new char[len+1]; strcpy_s(buff, len+1, s.buff); } CString& operator = (const CString& rhs) { cout << "Assignment operator called!"<<endl; if (this != &rhs) { len= rhs.len; delete[] buff; buff= new char[len+1]; strcpy_s(buff, len+1, rhs.buff); } return *this; } CString operator + (const CString& rhs) const { cout << "Addition operator called!"<<endl; size_t lenght= len+rhs.len+1; char* tmp = new char[lenght]; strcpy_s(tmp, lenght, buff); strcat_s(tmp, lenght, rhs.buff); return CString(tmp); } ~CString() { cout << "Destructor called!"<<endl; delete[] buff; } }; int main() { CString s1("Hello"); CString s2("World"); CString s3 = s1+s2; } My problem is that I don't know how to delete the memory allocated in the addition operator function(char* tmp = new char[length]). I couldn't do this in the constructor(I tried delete[] p) because it is also called from the main function with arrays of chars as parameters which are not allocated on the heap...How can I get around this? (Sorry for my bad English...)

    Read the article

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • System user authentication via web interface [closed]

    - by donodarazao
    Background: We have one pretty slow and expensive satellite Internet connection that is shared in a network with 5-50 users. To limit traffic, users shall pay a certain sum of money per hour. Routing and traffic accounting on user basis is done by a opensuse 10.3 server. Login is done via pppoe, and for each connection, username, bytes_sent, bytes_rcvd, start_time, end_time,etc are written into a mysql database. Now it was decided that we want to change from time-based to volume-based pricing. As the original developer who installed the system a couple of years ago isn't available, I'm trying to do the changes. Although I'm absolutely new to all this, there is some progress. However, there's one point I'm absolutely stuck. Up to now, only administrators can access connection details and billing information via a web interface. But as volume-based prices are less transparent to users than time-based prices, it is essential that users themselves can check their connections and how much they cost via the web interface. For this, we need some kind of user authentication. Actual question: How to develop such a user authentication? Every user has a linux system user account. With this user name and password, connection to the pppoe-server is made by the client machines. I thought about two possibles ways to authenticate users: First possibility: Users type username and password in a form. This is then somehow checked. We already have to possibilities to change passwords via the web interface. Here are parts of the code: Part of the Perl script the homepage is linked to: #!/usr/bin/perl use CGI; use CGI::Carp qw(fatalsToBrowser); use lib '../lib'; use own_perl_module; my @error; my $data; $query = new CGI; $username = $query->param('username') || ''; $oldpasswd = $query->param('oldpasswd') || ''; $passwd = $query->param('passwd') || ''; $passwd2 = $query->param('passwd2') || ''; own_perl_module::connect(); if ($query->param('submit')) { my $benutzer = own_perl_module::select_benutzer(username => $username) or push @error, "user not exists"; push @error, "your password?!?" unless $passwd; unless (@error) { own_perl_module::update_benutzer($benutzer->{id}, { oldpasswd => $oldpasswd, passwd => $passwd, passwd2 => $passwd2 }, error => \@error) and push @error, "Password changed."; } } Here's part of the sub update_benutzer in the own_perl_module: if ($dat-{passwd} ne '') { my $username = $dat-{username} || $select-{username}; my $system = "./chpasswd.pl '$username' '$dat-{passwd}'" . (defined($dat-{oldpasswd}) ? " '$dat-{oldpasswd}'" : undef); my $answer = $system; if ($? != 0) { chomp($answer); push @$error, $answer || "error changing password ($?)"; Here's chpasswd.pl: #!/usr/bin/perl use FileHandle; use IPC::Open3; local $username = shift; local $passwd = shift; local $oldpasswd = shift; local $chat = { 'Old Password: $' => sub { print POUT "$oldpasswd\n"; }, 'New password: $' => sub { print POUT "$passwd\n"; }, 'Re-enter new password: $' => sub { print POUT "$passwd\n"; }, '(.*)\n$' => sub { print "$1\n"; exit 1; } }; local $/ = \1; my $command; if (defined($oldpasswd)) { $command = "sudo -u '$username' /usr/bin/passwd"; } else { $command = "sudo /usr/bin/passwd '$username'"; } $pid = open3(\*POUT, \*PIN, \*PERR, $command) or die; my $buffer; LOOP: while($_ = <PERR>) { $buffer .= $_; foreach (keys(%$chat)) { if ($buffer =~ /$_/i) { $buffer = undef; &{$chat->{$_}}; } } } exit; Could this somehow be adjusted to verify users, but not changing user passwords? The second possibility I see: all pppoe connections are logged in the mysql database. If I could somehow retrieve the username (or uid) of the user connected by pppoe, this could be used to authenticate users. Users could only check their internet connections and costs when they are online (and thus paying money), but this could be tolerated. Here's a line of the script that inserts connections into the database: my $username = $ENV{PEERNAME}; I thought it would be easy to use this variable, but $username seems to be always empty in test-scripts (print $username). Any idea how to retrieve the user connected to the pppoe server? Sorry for the long question! Any help would be very much appreciated. :)

    Read the article

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • trie reg exp parse step over char and continue

    - by forest.peterson
    Setup: 1) a string trie database formed from linked nodes and a vector array linking to the next node terminating in a leaf, 2) a recursive regular expression function that if A) char '*' continues down all paths until string length limit is reached, then continues down remaining string paths if valid, and B) char '?' continues down all paths for 1 char and then continues down remaining string paths if valid. 3) after reg expression the candidate strings are measured for edit distance against the 'try' string. Problem: the reg expression works fine for adding chars or swapping ? for a char but if the remaining string has an error then there is not a valid path to a terminating leaf; making the matching function redundant. I tried adding a 'step-over' ? char if the end of the node vector was reached and then followed every path of that node - allowing this step-over only once; resulted in a memory exception; I cannot find logically why it is accessing the vector out of range - bactracking? Questions: 1) how can the regular expression step over an invalid char and continue with the path? 2) why is swapping the 'sticking' char for '?' resulting in an overflow? Function: void Ontology::matchRegExpHelper(nodeT *w, string inWild, Set<string> &matchSet, string out, int level, int pos, int stepover) { if (inWild=="") { matchSet.add(out); } else { if (w->alpha.size() == pos) { int testLength = out.length() + inWild.length(); if (stepover == 0 && matchSet.size() == 0 && out.length() > 8 && testLength == tokenLength) {//candidate generator inWild[0] = '?'; matchRegExpHelper(w, inWild, matchSet, out, level, 0, stepover+1); } else return; //giveup on this path } if (inWild[0] == '?' || (inWild[0] == '*' && (out.length() + inWild.length() ) == level ) ) { //wild matchRegExpHelper(w->alpha[pos].next, inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover);//follow path -> if ontology is full, treat '*' like a '?' } else if (inWild[0] == '*') matchRegExpHelper(w->alpha[pos].next, '*'+inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover); //keep adding chars if (inWild[0] == w->alpha[pos].letter) //follow self matchRegExpHelper(w->alpha[pos].next, inWild.substr(1), matchSet, out+w->alpha[pos].letter, level, 0, stepover); //follow char matchRegExpHelper(w, inWild, matchSet, out, level, pos+1, stepover);//check next path } } Error Message: +str "Attempt to access index 1 in a vector of size 1." std::basic_string<char,std::char_traits<char>,std::allocator<char> > +err {msg="Attempt to access index 1 in a vector of size 1." } ErrorException Note: this function works fine for hundreds of test strings with '*' wilds if the extra stepover gate is not used Semi-Solved: I place a pos < w->alpha.size() condition on each path that calls w->alpha[pos]... - this prevented the backtrack calls from attempting to access the vector with an out of bounds index value. Still have other issues to work out - it loops infinitely adding the ? and backtracking to remove it, then repeat. But, moving forward now. Revised question: why during backtracking is the position index accumulating and/or not deincrementing - so at somepoint it calls w->alpha[pos]... with an invalid position that is either remaining from the next node or somehow incremented pos+1 when passing upward?

    Read the article

  • Optimizing Vector elements swaps using CUDA

    - by Orion Nebula
    Hi all, Since I am new to cuda .. I need your kind help I have this long vector, for each group of 24 elements, I need to do the following: for the first 12 elements, the even numbered elements are multiplied by -1, for the second 12 elements, the odd numbered elements are multiplied by -1 then the following swap takes place: Graph: because I don't yet have enough points, I couldn't post the image so here it is: http://www.freeimagehosting.net/image.php?e4b88fb666.png I have written this piece of code, and wonder if you could help me further optimize it to solve for divergence or bank conflicts .. //subvector is a multiple of 24, Mds and Nds are shared memory _shared_ double Mds[subVector]; _shared_ double Nds[subVector]; int tx = threadIdx.x; int tx_mod = tx ^ 0x0001; int basex = __umul24(blockDim.x, blockIdx.x); Mds[tx] = M.elements[basex + tx]; __syncthreads(); // flip the signs if (tx < (tx/24)*24 + 12) { //if < 12 and even if ((tx & 0x0001)==0) Mds[tx] = -Mds[tx]; } else if (tx < (tx/24)*24 + 24) { //if >12 and < 24 and odd if ((tx & 0x0001)==1) Mds[tx] = -Mds[tx]; } __syncthreads(); if (tx < (tx/24)*24 + 6) { //for the first 6 elements .. swap with last six in the 24elements group (see graph) Nds[tx] = Mds[tx_mod + 18]; Mds [tx_mod + 18] = Mds [tx]; Mds[tx] = Nds[tx]; } else if (tx < (tx/24)*24 + 12) { // for the second 6 elements .. swp with next adjacent group (see graph) Nds[tx] = Mds[tx_mod + 6]; Mds [tx_mod + 6] = Mds [tx]; Mds[tx] = Nds[tx]; } __syncthreads(); Thanks in advance ..

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • Mysql - help me optimize this query (improved question)

    - by sandeepan-nath
    About the system: - There are tutors who create classes and packs - A tags based search approach is being followed.Tag relations are created when new tutors register and when tutors create packs (this makes tutors and packs searcheable). For details please check the section How tags work in this system? below. Following is the concerned query SELECT SUM(DISTINCT( t.tag LIKE "%Dictatorship%" )) AS key_1_total_matches, SUM(DISTINCT( t.tag LIKE "%democracy%" )) AS key_2_total_matches, COUNT(DISTINCT( od.id_od )) AS tutor_popularity, CASE WHEN ( IF(( wc.id_wc > 0 ), ( wc.wc_api_status = 1 AND wc.wc_type = 0 AND wc.class_date > '2010-06-01 22:00:56' AND wccp.status = 1 AND ( wccp.country_code = 'IE' OR wccp.country_code IN ( 'INT' ) ) ), 0) ) THEN 1 ELSE 0 END AS 'classes_published', CASE WHEN ( IF(( lp.id_lp > 0 ), ( lp.id_status = 1 AND lp.published = 1 AND lpcp.status = 1 AND ( lpcp.country_code = 'IE' OR lpcp.country_code IN ( 'INT' ) ) ), 0) ) THEN 1 ELSE 0 END AS 'packs_published', td . *, u . * FROM tutor_details AS td JOIN users AS u ON u.id_user = td.id_user LEFT JOIN learning_packs_tag_relations AS lptagrels ON td.id_tutor = lptagrels.id_tutor LEFT JOIN learning_packs AS lp ON lptagrels.id_lp = lp.id_lp LEFT JOIN learning_packs_categories AS lpc ON lpc.id_lp_cat = lp.id_lp_cat LEFT JOIN learning_packs_categories AS lpcp ON lpcp.id_lp_cat = lpc.id_parent LEFT JOIN learning_pack_content AS lpct ON ( lp.id_lp = lpct.id_lp ) LEFT JOIN webclasses_tag_relations AS wtagrels ON td.id_tutor = wtagrels.id_tutor LEFT JOIN webclasses AS wc ON wtagrels.id_wc = wc.id_wc LEFT JOIN learning_packs_categories AS wcc ON wcc.id_lp_cat = wc.id_wp_cat LEFT JOIN learning_packs_categories AS wccp ON wccp.id_lp_cat = wcc.id_parent LEFT JOIN order_details AS od ON td.id_tutor = od.id_author LEFT JOIN orders AS o ON od.id_order = o.id_order LEFT JOIN tutors_tag_relations AS ttagrels ON td.id_tutor = ttagrels.id_tutor JOIN tags AS t ON ( t.id_tag = ttagrels.id_tag ) OR ( t.id_tag = lptagrels.id_tag ) OR ( t.id_tag = wtagrels.id_tag ) WHERE ( u.country = 'IE' OR u.country IN ( 'INT' ) ) AND CASE WHEN ( ( t.id_tag = lptagrels.id_tag ) AND ( lp.id_lp 0 ) ) THEN lp.id_status = 1 AND lp.published = 1 AND lpcp.status = 1 AND ( lpcp.country_code = 'IE' OR lpcp.country_code IN ( 'INT' ) ) ELSE 1 END AND CASE WHEN ( ( t.id_tag = wtagrels.id_tag ) AND ( wc.id_wc 0 ) ) THEN wc.wc_api_status = 1 AND wc.wc_type = 0 AND wc.class_date '2010-06-01 22:00:56' AND wccp.status = 1 AND ( wccp.country_code = 'IE' OR wccp.country_code IN ( 'INT' ) ) ELSE 1 END AND CASE WHEN ( od.id_od 0 ) THEN od.id_author = td.id_tutor AND o.order_status = 'paid' AND CASE WHEN ( od.id_wc 0 ) THEN od.can_attend_class = 1 ELSE 1 END ELSE 1 END GROUP BY td.id_tutor HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 ORDER BY tutor_popularity DESC, u.surname ASC, u.name ASC LIMIT 0, 20 The problem The results returned by the above query are correct (AND logic working as per expectation), but the time taken by the query rises alarmingly for heavier data and for the current data I have it is like 25 seconds as against normal query timings of the order of 0.005 - 0.0002 seconds, which makes it totally unusable. It is possible that some of the delay is being caused because all the possible fields have not yet been indexed. The tag field of tags table is indexed. Is there something faulty with the query? What can be the reason behind 20+ seconds of execution time? How tags work in this system? When a tutor registers, tags are entered and tag relations are created with respect to tutor's details like name, surname etc. When a Tutors create packs, again tags are entered and tag relations are created with respect to pack's details like pack name, description etc. tag relations for tutors stored in tutors_tag_relations and those for packs stored in learning_packs_tag_relations. All individual tags are stored in tags table. The explain query output:- Please see this screenshot - http://www.test.examvillage.com/Explain_query.jpg

    Read the article

  • Displaying unnecessary HTML when showing content from MySQL database.

    - by ThatMacLad
    My homepage pulls in content from my MySQL database to create a blog. I've got it so that it only displays an extract from the posts. For some reason it displays HTML tags as well rather than formatting it using the tags (See picture below). Any help is appreciated. Homepage: <html> <head> <title>Ultan Casey | Homepage</title> <link rel="stylesheet" href="css/style.css" type="text/css" /> </head> <body> <div class="wrapper"> <div id="upperbar"> <a href="#">Home</a> <a href="#">About Me</a> <a href="#">Contact Me</a> <a href="http://www.twitter.com/UltanKC">Twitter</a> <form id="search-form" action="/search" method="get"> <input type="text" id="textarea" size="33" name="q" value=""/> <input type="submit" id="submit" value="Search"/> </form> </div> <div id="banner"> <img src="images/banner.jpg"> </div> <div class="sidebar"></div> <div class="posts"> <?php mysql_connect ('localhost', 'root', 'root') ; mysql_select_db ('tmlblog'); $sql = "SELECT * FROM php_blog ORDER BY timestamp DESC LIMIT 5"; $result = mysql_query($sql) or print ("Can't select entries from table php_blog.<br />" . $sql . "<br />" . mysql_error()); while($row = mysql_fetch_array($result)) { $date = date("l F d Y", $row['timestamp']); $title = stripslashes($row['title']); $entry = stripslashes($row['entry']); $id = $row['id']; ?> <?php echo "<p id='title'><strong><a href=\"post.php?id=". $id . "\">" . $title . "</a></strong></p>"; ?><br /> <div class="post-thumb"><img src="thumbs/<?php echo $id ?>.png"></div> <?php echo htmlspecialchars(substr($entry, 0, 1050)) ?>... <br> <hr><br /> Posted on <?php echo $date; ?> </p> </div> </div> </p <?php } ?> </div> </div> </div> </body> </html> Image:

    Read the article

  • Updating with using custom class collection not working

    - by Risho
    I've posted this yesterday on asp forum but no one replied so perhaps I'll have better luck here. For some reason the OnUpdating method does not pull new values from the grid which is in edit mode. I've search and have come across several blogs and sites, some sugesting that an ObjectDataSource is required in order to use the "e.NewValue" construct others provide code to the contrary. I don't get any errors - the variables in the code file would contain the old values rather then new ones. I don't want to use the ODS way of manipulating the data. My delete method works but not the update one. Can you suggest what is wrong with the code? Here is what I've got: aspx file: <asp:GridView ID="gvBlack" runat="server" AutoGenerateColumns="False" OnRowUpdating="gvBlack_OnUpdating" OnRowEditing="gvBlack_RowEditing"> <Columns> <%--<asp:BoundField DataField="Ident_Black" ReadOnly="True" visible="false" />--%> <asp:TemplateField ItemStyle-Width="1px"> <EditItemTemplate> <asp:Label ID="lblIdent_Black" runat="server" Text='<%# Bind("Ident_Black") %>' Visible="false" /> </EditItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Model" > <ItemTemplate> <asp:Label ID="lblModel_Black" runat="server" Text='<%# Bind("Model_Black") %>' width="130px" /> </ItemTemplate> <EditItemTemplate> <asp:TextBox ID="txtModel_Black" runat="server" Text='<%# Eval("Model_Black") %>' width="100px" /> <asp:RequiredFieldValidator ID="rfvModel_Black" runat="server" ControlToValidate="txtModel_Black" SetFocusOnError="true" ErrorMessage="*" ValidationGroup="CurrentMfg" ForeColor="Red" Font-Bold="true" /> </EditItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Description" > <ItemTemplate> <asp:Label ID="lblDesc_Black" runat="server" Text='<%# Bind("Desc_Black") %>' width="200px" /> </ItemTemplate> <EditItemTemplate> <asp:TextBox ID="txtDesc_Black" runat="server" Text='<%# Eval("Desc_Black") %>' width="170px" /> <span></span> </EditItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Qty" > <ItemTemplate> <asp:Label ID="lblQty_Black" runat="server" Text='<%# Bind("Qty_Black") %>' width="35px" /> </ItemTemplate> <EditItemTemplate> <asp:TextBox ID="txtQty_Black" runat="server" Text='<%# Eval("Qty_Black") %>' width="35px" /> <asp:RequiredFieldValidator ID="rfvQty_Black" runat="server" ControlToValidate="txtQty_Black" SetFocusOnError="true" ErrorMessage="*" ValidationGroup="CurrentMfg" ForeColor="Red" Font-Bold="true" /> </EditItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Reorder<br />Limit"> <ItemTemplate> <asp:Label ID="lblBlack_Reorder_Limit" runat="server" Text='<%# Bind("Black_Reorder_Limit") %>' width="35px" /> </ItemTemplate> <EditItemTemplate> <asp:TextBox ID="txtBlack_Reorder_Limit" runat="server" Text='<%# Eval("Black_Reorder_Limit") %>' width="35px" /> <asp:RequiredFieldValidator ID="rfvBlack_Reorder_Limit" runat="server" ControlToValidate="txtBlack_Reorder_Limit" SetFocusOnError="true" ErrorMessage="*" ValidationGroup="CurrentMfg" ForeColor="Red" Font-Bold="true" /> </EditItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Notes"> <ItemTemplate> <asp:Label ID="lblNotes" runat="server" Text='<%# Bind("Notes") %>' width="200px" /> </ItemTemplate> <EditItemTemplate> <asp:TextBox ID="txtNotes" runat="server" Text='<%# Eval("Notes") %>' width="170px" /> <span></span> </EditItemTemplate> </asp:TemplateField> <asp:CommandField ShowEditButton="True" ShowDeleteButton="false" ValidationGroup="CurrentToner" /> </Columns> </asp:GridView> aspx.cs file: protected void Page_Load(object sender, EventArgs e) { LoadData_TonerBlack(); } private void LoadData_TonerBlack() { dalConsumables_TonerBlack drTonerBlack = new dalConsumables_TonerBlack(); gvBlack.DataSource = drTonerBlack.GetListTonersBlack(); gvBlack.DataBind(); } protected void gvBlack_OnUpdating(object sender, GridViewUpdateEventArgs e) { //GridView gvBlack = (GridView)sender; //GridViewRow gvBlackRow = (GridViewRow)gvBlack.Rows[e.RowIndex]; int _Ident_Black = Convert.ToInt32(gvBlack.DataKeys[e.RowIndex].Values[0].ToString()); TextBox _txtModel_Black = (TextBox)gvBlack.Rows[e.RowIndex].FindControl("txtModel_Black"); TextBox _txtDesc_Black = (TextBox)gvBlack.Rows[e.RowIndex].FindControl("txtDesc_Black"); TextBox _txtQty_Black = (TextBox)gvBlack.Rows[e.RowIndex].FindControl("txtQty_Black"); TextBox _txtBlack_Reorder_Limit = (TextBox)gvBlack.Rows[e.RowIndex].FindControl("txtBlack_Reorder_Limit"); TextBox _txtNotes = (TextBox)gvBlack.Rows[e.RowIndex].FindControl("txtNotes"); string _updatedBy = Request.ServerVariables["AUTH_USER"].ToString(); dalConsumables_TonerBlack updateTonerBlack = new dalConsumables_TonerBlack(); updateTonerBlack.UpdateTonerBlack(_Ident_Black, _txtModel_Black.Text, _txtDesc_Black.Text, Convert.ToInt32(_txtQty_Black.Text), Convert.ToInt32(_txtBlack_Reorder_Limit.Text), _txtNotes.Text, _updatedBy); gvBlack.EditIndex = -1; LoadData_TonerBlack(); } protected void gvBlack_RowEditing(object sender, GridViewEditEventArgs e) { gvBlack.EditIndex = e.NewEditIndex; LoadData_TonerBlack(); } Thanks in advance! Risho

    Read the article

  • Differences between matrix implementation in C

    - by tempy
    I created two 2D arrays (matrix) in C in two different ways. I don't understand the difference between the way they're represented in the memory, and the reason why I can't refer to them in the same way: scanf("%d", &intMatrix1[i][j]); //can't refer as &intMatrix1[(i * lines)+j]) scanf("%d", &intMatrix2[(i * lines)+j]); //can't refer as &intMatrix2[i][j]) What is the difference between the ways these two arrays are implemented and why do I have to refer to them differently? How do I refer to an element in each of the arrays in the same way (?????? in my printMatrix function)? int main() { int **intMatrix1; int *intMatrix2; int i, j, lines, columns; lines = 3; columns = 2; /************************* intMatrix1 ****************************/ intMatrix1 = (int **)malloc(lines * sizeof(int *)); for (i = 0; i < lines; ++i) intMatrix1[i] = (int *)malloc(columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix1[%d][%d]\t", i, j); scanf("%d", &intMatrix1[i][j]); } } /************************* intMatrix2 ****************************/ intMatrix2 = (int *)malloc(lines * columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix2[%d][%d]\t", i, j); scanf("%d", &intMatrix2[(i * lines)+j]); } } /************** printing intMatrix1 & intMatrix2 ****************/ printf("intMatrix1:\n\n"); printMatrix(*intMatrix1, lines, columns); printf("intMatrix2:\n\n"); printMatrix(intMatrix2, lines, columns); } /************************* printMatrix ****************************/ void printMatrix(int *ptArray, int h, int w) { int i, j; printf("Printing matrix...\n\n\n"); for (i = 0; i < h; ++i) for (j = 0; j < w; ++j) printf("array[%d][%d] ==============> %d\n, i, j, ??????); }

    Read the article

  • Saving data in custom class via AppDelegate

    - by redspike
    I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

< Previous Page | 632 633 634 635 636 637 638 639 640 641 642 643  | Next Page >