Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 641/972 | < Previous Page | 637 638 639 640 641 642 643 644 645 646 647 648  | Next Page >

  • Looking for a full list of jQuery event types.

    - by serg555
    Where I can find a complete list of all jQuery supported events (like click, mouseup etc) with some explanations when they are triggered? I am looking for those that can be binded: $('#foo').bind('click', handler); For example I just found out by accident that there is paste event but I can't find any references to it anywhere in their docs. What else is there?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • Display alert msg in web page when forwarding from one page to another on page load.

    - by Shantanu Gupta
    I have created a html page in php and upon submission i validates that page using PHP. After validating i want to show an alert msg to show its status like showing any greeting or request for re-enter. I have dont validation. Now i m using header( 'Location: http://localhost/assignment/WebForm.htm' ) ; to redirect user to same page but with a alert msg at page load or something like that. What I need to do ?

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • Is there a way to embed an mp3 player in a website that isn't flash based (so that the website is iP

    - by hartleybrody
    I did a lot of searching for what I thought would be a pretty common question, but I came up with nothing. If there is another thread with a similar topic, please let me know. Basically, I'm looking for a way to have an .mp3 file play in a website without relying on a flash-based player. I've searched w3 schools and every forum I can think of, but every media player I've found so far has been some sort of proprietary flash player. Doesn't HTML support some sort of native player? I've found some that rely on Windows Media Player which is close, but I want the player to work on an iPhone and something tells me WMP won't get that done... PS, as I'm thinking more about this this idea just popped into my head: a javascipt player and inside the <noscript> tag, put a flash player? I'm running a music blog (@ http://www.freshoncampus.com) so the less code per post, the better...

    Read the article

  • Simplify my menu animation code

    - by zaius
    I've got a bunch of 'project' divs that I want to expand when they're clicked on. If there's already a project open, I want to hide it before I slide out the new one. I also want to stop clicks on an already open project from closing and then opening it again. Here's an example of what I mean (warning - wrote the code in the browser): $('.projects').click(function() { var clicked_project = $(this); if (clicked_project.is(':visible')) { clicked_project.height(10).slideUp(); return; } var visible_projects = $('.projects:visible'); if (visible_projects.size() > 0) { visible_projects.height(10).slideUp(function() { clicked_project.slideDown(); }); } else { clicked_project.slideDown(); } }); Really, my big issue is with the second part - it sucks that I have to use that if/else - I should just be able to make the callback run instantly if there aren't any visible_projects. I would think this would be a pretty common task, and I'm sure there's a simplification I'm missing. Any suggestions appreciated!

    Read the article

  • Fetch html page content into a var

    - by Cipher
    Just a small question here, that how do we get fetch the html content via ajax into a variable that I could use later. Right now, I have a button on the click of which, I fetch another html page simply through load method as follows: $('#container').load('http://127.0.0.1/someUrl') I want to get the content into a var instead that I could at a later time use to append to the dom $('#someContainer').append(someVar)

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • Can I define which characters are allowed to 'break' a word?

    - by zneak
    Hey guys, I'm showing up veeeery long URLs in my Safari extension. Obviously, they can't fit on a single line. Currently, word breaking rules make it so most URLs are on two lines: the first one is rather short and ends with the ? symbol, and the other is ridiculously long and contains all the rest of the GET parameters. I'd like to make it so words also break on the & symbol, without screwing up copy-paste if possible. I've tried to replace every & with &\u00ad (& + the soft hyphen character), but it's kind of weird to see the hyphen after the & when there really isn't any in the URL. I thought there was something in store with CSS3 for that kind of problem, but I can't find it. Any suggestion welcome, as long as it works with Safari.

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • Is this possible?

    - by Stud33
    I want to incorporate some Accelerometer code into a Android application im working and want to see if this is possible. Basically what I need is for the code to detect car acceleration motion. I am not wanting to determine speed with the code but just distinguish if the phone is in a car and has accelerated motion (Hence the car is moving for the first time). I have gone through many different accelerometer applications to see if this motion produces a viable profile to go off of and it appears it does. Just looking for something that popups a "Hello World" dialog when it detects your in the car and its moving for the first time down the street. Any help would be appreciated and a simple yes or no its possible would work. I would also be interested in compensating anyone that is capable of doing this as well. I need this done like yesterday so please let me know. Thank You, JTW

    Read the article

  • Get an array of forms in java script using prototype

    - by Saurabh
    My document contains more than one forms. How can I get an array of all forms using prototype? <html> <head></head> <body> <form id="form1"> <!-- Other stuffs here --> </form> <form id="form2"> <!-- Other stuffs here --> </form> <form id="form3"> <!-- Other stuffs here --> </form> </body> </html>

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 637 638 639 640 641 642 643 644 645 646 647 648  | Next Page >