Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • A HREF URL won't work

    - by user3586248
    I am trying to get the following link to work. <a href='#' onclick='window.open(" | &ESPP_Info_URL | ");return false;'>Employee Stock Purchase Plan Information</a> Basically the &ESPP_Info_URL variable takes in a url so that the code below looks like... <a onclick="window.open(https://...);return false;" href="#">Employee Stock Purchase Plan Information</a> But when I click the url it just refreshes the page. Does anyone know how to get this to access the link within the window.open function?

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • ANy way to fix the position of image

    - by Mirage
    I have an image on the left hand side and text on right side. Like two column layout. I want that when i scroll the text then the image should stay at center of page. I tried using position:fixed But then the problem , sometimes when i resize the IE window to small size then the image stay at same position and it comes out of the main content area when i scroll down. I want that image should scroll but should stay within the content area . It should not move outsid ethe main content aqrea

    Read the article

  • jQuery if condition text contains

    - by olo
    I wrote a simple if condition, but not quite working. if text is 123 change to hi, if text is 456 change it to hi2 Could someone please give me a hand. <h1>123</h1> <h1>456</h1> <h1>789</h1>? $(document).ready(function() { var changeText1 = '123'; var changeText2 = '456'; var text = $(h1).text(); if (text == changeText) { $(this).text('hi'); } else if (text == changeText2 ) { $(this).text('hi2'); } }); ? http://jsfiddle.net/8P2ma/

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • Can I define which characters are allowed to 'break' a word?

    - by zneak
    Hey guys, I'm showing up veeeery long URLs in my Safari extension. Obviously, they can't fit on a single line. Currently, word breaking rules make it so most URLs are on two lines: the first one is rather short and ends with the ? symbol, and the other is ridiculously long and contains all the rest of the GET parameters. I'd like to make it so words also break on the & symbol, without screwing up copy-paste if possible. I've tried to replace every & with &\u00ad (& + the soft hyphen character), but it's kind of weird to see the hyphen after the & when there really isn't any in the URL. I thought there was something in store with CSS3 for that kind of problem, but I can't find it. Any suggestion welcome, as long as it works with Safari.

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • Change URL of a saved HTML file

    - by Paul Camilleri
    I am new to HTML so this question might sound a bit lame. Anyways I have a saved webpage on my desktop that when i open it in google chrome i want it to show a specific URL instead of its current location. Any ideas how i might get this to work? I tried using the history.pushState but i have no idea why it is not working. I created a simple page for now to test it: <html> <head> <script> function setURL() { history.pushState("Test","page2", "www.test.com"); } </script> </head> <body> <button type="button" onclick="setURL()">Set Url</button> </body> </html> Any help would be greatly appreciated. Thank you

    Read the article

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • jQuery scrollTop - animation stucks at the end of moving

    - by mobsteady
    i use jquery the scrollTop function to get my scrolling smooth while switching between different anchors. first, here is the url the problem this is my jquery script "ziel" is just the german word for "target", just to let you know why this variable is called "ziel" $(document).ready(function() { $('a[href*=#]').bind("click", function(event) { event.preventDefault(); var ziel = $(this).attr("href"); $('#portraitcontent').animate({ scrollTop: $(ziel).offset().top }, 3000 , function (){location.hash = ziel;}); }); return false; }); so how do i get a smooth scrolling without that ugly jumping at the end of the animation? any ideas? i really don't know what to do. spending hours with that bitch! thanks for your advices!

    Read the article

  • Loading external content with jquery or iframe?

    - by nailuenlue
    Hiho, There's an existing website that i need to include into another site which goes like this: a.mysite.com and i need to fetch content from this site in my www.mysite.com website... As i need to access the content of the iframe the Same origin policy produces a problem here. What i did was to configure mod_proxy on Apache to proxy pass all requests from www.mysite.com/a to a.mysite.com This will work fine...but my problem is that im not sure what the best way would be to include those pages. 1. Idea As the content of the iframe is a full featured site with a top navigation...left navigation etc....i would need to change the page template to only show the content box to be able to integrate that page in the iframe. 2. Idea I could just load the DIV where the content lies through JQuery.load() and integrate it into my site. What is the best way to accomplish such a task? How bad is both ideas from the SEO point of view?

    Read the article

  • How to get four following text inputs after each checkbox?

    - by Richard Knop
    I am traversing checkboxes like this: $('.day').each(function() { // here I need to get the following 4 text inputs in the HTML // and set some attributes on them }); After every checkbox there are four text input fields (there are also some div, span tags for CSS around them). So inside the loop above I need to get four text input fields that follow the checkbox in the HTML source so I can set some attributes on them. How would I go about that?

    Read the article

  • Display alert msg in web page when forwarding from one page to another on page load.

    - by Shantanu Gupta
    I have created a html page in php and upon submission i validates that page using PHP. After validating i want to show an alert msg to show its status like showing any greeting or request for re-enter. I have dont validation. Now i m using header( 'Location: http://localhost/assignment/WebForm.htm' ) ; to redirect user to same page but with a alert msg at page load or something like that. What I need to do ?

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >