Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • Detecting when HTML5 audio is finished playing (more than once)?

    - by user386911
    I am having a problem detecting when an tag is finished playing an mp3. When I do something like this: myAudio.addEventListener("ended", function() { alert("ended"); }); It only occurs the first time the audi is played. When I play the audio again, nothing happens. The same thing occurs when I use the onended=doThis(); method. I've heard maybe there is a way to do it in jquery, but I haven't been able to get it to work. I've also heard there might be a way to fix it by changing the audio div id everytime the mp3 is played, but this doesn't work for me because I need the id to stay the same. Anyone got any ideas?

    Read the article

  • Any alternative to jQuery change() to detect when user selects new file via dialog box in IE8?

    - by ecu
    I am unable to detect when input type="file" changes its value after user selects file and the dialog box closes. $('.myInput').change(function(){ alert($(this).val()); }) Above jQuery code works perfectly in all browsers apart from IE. For some reason IE detects the change only after input field loses focus. Is there a way to detect the change immediately after dialog box closes? Or maybe to force input field to lose focus after dialog box closes so IE can detect it? I'm puzzled. Thanks for any help.

    Read the article

  • Page does update with details from the database after i hit a button

    - by swathi
    I have a code and the way it should work is,when they click on NEW CUSTOMER,it takes them to test1.php where in they enter the details and they hit submit.it saves all the details in properly in the database and when i go back and hit REFRESH ,it should come up with the customer details which they had entered in previously. But what happens is, when i click on the REFRESH,it refreshes the same old page which is empty.I wanted to find out where am i missing the logic.Thanks in advance. The sample code would be <tr> <td class="tdvisitbig" colspan="5">THIS IS A TEST</td> </tr> <tr> <td class='tdvisitbig' colspan="5"><input type="button" onClick="openVisit('test1.php?id=<?=$key?>&name=<?=$name?>');return false;" value="NEW CUSTOMER" class="submit">&nbsp;<input type="button" value="REFRESH" name="add_xyz" class="submit" onClick="document.add.target='_self';document.add.action='test3.php?redirect=visit&section=test page';document.add.submit();"></td> </tr> <? $q = "SELECT address,customernum,status FROM customer WHERE name='$name' ORDER BY customernum"; $r = mysql_query( $q , $Link ); while( $rw = mysql_fetch_assoc( $r ) ) { extract( $rw ); ?> <tr> <? } ?>

    Read the article

  • Matching a String and then incrementing a number within HTML elements

    - by Abs
    Hello all, I have tags in a html list, here is an example of two tags. <div class="tags"> <ul> <li> <a onclick="tag_search('tag1');" href="#">tag1 <span class="num-active">1</span></a> </li> <li> <a onclick="tag_search('tag2');" href="#">tag2 <span class="num-active">1</span></a> </li> </ul> </div> I would like to write a function that I can pass a string to, that will match the strings in the a hyperlink i.e. "tag1" or "tag2", if there is a match then increment the number in the span, if not then add a new li. The bit I am having trouble with is how do I search for a string in the div with class tags and then when I find a match identifying the element. I can't even do the first bit as I am use to using an ID or a Class. I appreciate any help on this using JQuery Thanks all Code so far function change_tag_count(item){ alert(item);//alerts the string test $.fn.searchString = function(str) { return this.filter('*:contains("' + item + '")'); }; if($('body').searchString(item).length){ var n = $('a').searchString(item).children().text(); n = parseInt(n) + 1; $('a').searchString(item).children().text(n); }else{ alert('here');//does not alert this when no li contains the word test $("#all_tags ul").append('<a onclick="tag_search(\''+item+'\');" href="#">'+item+'<span class="num-active">1</span></a>'); } }

    Read the article

  • Load the <?php the_permalink(); ?> with an ajax loader

    - by fxg
    I´m working on a wordpress template. I´m trying to load the single.php of a post using ajax. I´m doing all the load thru a loader.js file that has this: // load single project page $("#project_slider").live("click", function(){ $("#content").hide(); $("#content").load("<?php the_permalink(); ?>", function(){ $(this).fadeIn("slow"); }); }); The problem is that I can´t just put on the .load because it doesn´t works. this is the markup: <div id="project_page" class="item"> <a href="#"> <img src="<?php the_field('artworks_thumbnail'); ?>" alt="" width="240" height="173"> </a> <div class="art_title"> <p>SWEET LIFE</p> </div> <div class="mask"></div> </div> How can I add the permalink via the loader.js?

    Read the article

  • Jquery - $.(post) data response not consistent with PHP

    - by Sasha
    Jquery code: var code = $('#code'), id = $('input[name=id]').val(), url = '<?php echo base_url() ?>mali_oglasi/mgl_check_paid'; code.on('focusout', function(){ var code_value = $(this).val(); if(code_value.length != 16 ) { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; code.after('<p role=code_msg>Pogrešan kod je unešen.</p>'); } else { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; $.post(url, {id : id, code : code_value}, function(data){ if(data != 'TRUE'){ code.after('<p role=code_msg>Uneti kod je neispravan.</p>'); } else { code.after('<p role=code_msg>Status malog oglasa je promenjen.</p>'); code.after(create_image()); code.remove(); } }); } }); PHP (Codeigniter) code: function mgl_check_paid() { $code = $this->input->post('code'); $id = $this->input->post('id'); echo ($this->mgl->mgl_check_paid($code, $id)) ? 'TRUE' : 'FALSE'; } Problem is following: When code is sent and if it is correct, PHP part will echo TRUE, and JS will execute ELSE part (after post), but for some reason it is not doing that (it is executing the first part of the statment)? What is wrong with this code?

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • Prevent "jQuery( html )" from triggering the browser to request images and other referenced content

    - by Chris Dutrow
    Using jQuery to create new DOM elements from text. Example: jQuery('<div><img src="/some_image.gif"></img></div>'); When this statement is executed, it causes the browser to request the file 'some_img.gif' from the server. Is there a way to execute this statement so that the resulting jQuery object can be used from DOM traversal, but not actually cause the browser to hit the server with requests for images and other referenced content? Example: var jquery_elememnts = jQuery('<div><img class="a_class" src="/some_image.gif"></img></div>'); var img_class = jquery_elememnts.find('img').attr('class'); The only idea I have now is to use regex to remove all of the 'src' tags from image elements and other things that will trigger the browser requests before using jQuery to evaluate the HTML. How can jQuery be used to evaluate HTML without triggering the browser to make requests to the server for referenced content inside the evaluated HTML? Thanks!

    Read the article

  • why jquery can't be used in my $(document).ready() function?

    - by Firegun
    The page can be viewed at http://cistrome.org/cps/seqconfig?did=2693 When load in Firebugs, it gives me this error: TypeError: $(".open_gene").on is not a function [Break On This Error] $(".open_gene").on('change', function(event) { However, if I type in this expression in Firebug's console, it can be evaluated as a function without any problems: >>> $(".open_gene").on function() I was wondering what might be the reason to cause this issue. Does anyone have ideas about this? Thanks!

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to hide URL from users when submitting this form?

    - by Camran
    I have a form with many many fields... When submitting these fields, I use the POST method which hides the actual variables passed along to the PHP page. However, I can't get rid of the complete link. Changing from GET to POST did make all the form fields invisible in the URL, but this part is still visible: mydomain.com/bin/query# I want it to be invisible, or say: mydomain.com/search I have mod_rewrite enabled so there is a possibility to do this with mod_rewrite I think, but I am new to mod_rewrite so I need your help... How should I hide this URL? If you need more input let me know...

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >