Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • Ttrigger extra paramter

    - by fire
    According to the jQuery manual you can send extra parameters (as an array) when calling a trigger. I am using this at the moment: $('#page0').trigger('click', [true]); How would I pick up whether the paramter has come through or not when using this? $('ul.pages li a').click(function() { // Do stuff if true has been passed as an extra parameter });

    Read the article

  • JQuery function to select checkboxes

    - by Adem
    I need a function that accepts a parameter with its id example a div and after that loops inside the div to look for checkboxes and if there is/are any checks if its value is checked and returns true if every checkbox is checked returns false.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • JSON element detection

    - by user3614570
    I’ve created a string… {"atts": [{"name": "wedw"}, {"type": "---"}]} I pile a bunch of these together in an array based on user input and attach them to another string to complete a JSON object that tests out as valid. So I end up with a global array called fields with a bunch of these little snippets. So how do I change the name "weds" with a new name? I’ve tried... function changefieldname(pos){ var obj = JSON.parse(jsonstring); var oldname = obj.tracelog.fields[pos].atts[0]["name"]; var newname = document.getElementById("newlogfieldname"+pos).value; fields[pos].replace(oldname, newname); //writejson(); } And a bunch of variations. I know everything is checking out correct interms of the variables pos, oldname, and newname. I also know that fields[pos] returns the string in the array I want to correct but it’s not happy. I also tried converting fields[pos] to a string, but the replace function doesn't work on it. I’m sure there is a good reason.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How do I get this validationTextBox to focus?

    - by Anurag Chaudhury
    After performing an ajax request if the input in the form was wrong I am trying to get this validatationTextBox to be focussed on and display an indicator message showing the problem. The code is: dijit.byId("passwordField").focusNode.focus() The form element is as mentioned a validationTextBox. The matter that is confusing me even further is that before in dojo 1.5, this piece of code was simply dijit.byId("passwordField").focus() and this worked fine. How can I fix this?

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • finding specific immediate children of an element using prototype

    - by tatilans
    Following DOM structure: <ul> <li class="item">yes</li> <li>no</li> <li class="item">yes</li> <li> <ul> <li class="item">no</li> </ul> </li> </ul> Assuming I have the outer <ul> in $ul. How do I get the two immediate children which have the item-class? In jQuery I would write something like this: $ul.children().filter(".item") $ul.children(".item") $ul.find("> .item") How do I to this with Prototype? I tried the following ... $ul.select("> .item") //WRONG ... but it does does exactly the opposite and returns the one inner <li>

    Read the article

  • jQuery scrollTop - animation stucks at the end of moving

    - by mobsteady
    i use jquery the scrollTop function to get my scrolling smooth while switching between different anchors. first, here is the url the problem this is my jquery script "ziel" is just the german word for "target", just to let you know why this variable is called "ziel" $(document).ready(function() { $('a[href*=#]').bind("click", function(event) { event.preventDefault(); var ziel = $(this).attr("href"); $('#portraitcontent').animate({ scrollTop: $(ziel).offset().top }, 3000 , function (){location.hash = ziel;}); }); return false; }); so how do i get a smooth scrolling without that ugly jumping at the end of the animation? any ideas? i really don't know what to do. spending hours with that bitch! thanks for your advices!

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • Delay image loading with jQuery

    - by DCD
    I have a page with several galleries including accordions and sliders. The problem is that the page takes forever to load. Is there a way of wrapping an image in a bit of code or applying a class to it to force it to load only after everything else is loaded?

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • How to $.extend 2 objects by adding numerical values together from keys with the same name?

    - by muudless
    I currently have 2 obj and using the jquery extend function, however it's overriding value from keys with the same name. How can I add the values together instead? obj1 = {"orange":2,"apple":1, "grape":1} obj2 = {"orange":5,"apple":1, "banana":1} mergedObj = $.extend({}, obj1, obj2); var printObj = typeof JSON != "undefined" ? JSON.stringify : function(obj) { var arr = []; $.each(obj, function(key, val) { var next = key + ": "; next += $.isPlainObject(val) ? printObj(val) : val; arr.push( next ); }); return "{ " + arr.join(", ") + " }"; }; console.log('all together: '+printObj(mergedObj) ); And I get obj1 = {"orange":5,"apple":1, "grape":1, "banana":1} What I need is obj1 = {"orange":7,"apple":2, "grape":1, "banana":1}

    Read the article

  • Looking for a full list of jQuery event types.

    - by serg555
    Where I can find a complete list of all jQuery supported events (like click, mouseup etc) with some explanations when they are triggered? I am looking for those that can be binded: $('#foo').bind('click', handler); For example I just found out by accident that there is paste event but I can't find any references to it anywhere in their docs. What else is there?

    Read the article

  • Creating a json obj from a string when working without a net connection?

    - by user246114
    Hi, I have a json object returned from a third party api, it looks like: {"version":"1.0","encoding":"UTF-8"} I'm going to be working on my project without a network connection, so I have to do everything locally. How can I create an instance of a json object locally for testing? Say I copy the above string, can I do something like: var json = null; if (debugging_locally) { json = new jsonObj('{"version":"1.0","encoding":"UTF-8"}'); } else { json = doAjaxCall(); } doStuffWithJsonObj(json); so I just want to create a json object from a stored string if debugging locally - how can I do that? Thanks

    Read the article

  • Show elements depending on html value of a tag

    - by mike23
    I would like to accomplish the following with jquery : When I click on this link <a href="#">Cars</a> I would like all divs like those <div class="product"> <div class="category">Cars</div> </div> to do something. You get the idea, I have a menu with a list of categories, and a list of products, each containing a div with the category name, and I would like to make them hide/show.

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >