Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • Load the <?php the_permalink(); ?> with an ajax loader

    - by fxg
    I´m working on a wordpress template. I´m trying to load the single.php of a post using ajax. I´m doing all the load thru a loader.js file that has this: // load single project page $("#project_slider").live("click", function(){ $("#content").hide(); $("#content").load("<?php the_permalink(); ?>", function(){ $(this).fadeIn("slow"); }); }); The problem is that I can´t just put on the .load because it doesn´t works. this is the markup: <div id="project_page" class="item"> <a href="#"> <img src="<?php the_field('artworks_thumbnail'); ?>" alt="" width="240" height="173"> </a> <div class="art_title"> <p>SWEET LIFE</p> </div> <div class="mask"></div> </div> How can I add the permalink via the loader.js?

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • getElementById does return null

    - by pbcoder
    I have following function: $('canvas').createWindow('xyz', 500, 600); And js-code behind is: var $ = function(element) { if (this.constructor !== $) { return new $(element); } alert(element); var windowObj = document.getElementById(element); this.createWindow = function(src, width, height) { if(width != "" && height != "") { windowWidth = windowObj.style.width = width + 'px'; windowHeight = windowObj.style.height = height + 'px'; } }; }; But the problem is that JS says windowObj is null, alert(element) works fine! Thanks for your help!

    Read the article

  • How to disable an input with jQuery Validation Plugin

    - by Eelke
    This should be really simple but I can't get it to work, how do I disable and add a class to an input? Let's say I've got an input field with id = name, this is how far I got, $("input#name").attr("disabled"); What am I doing wrong here? Any help would be greatly appreciated, thanks in advance!

    Read the article

  • Changing class of h2 inside specific div

    - by user1985060
    I want to make it so that everytime you click on an 'h2' tag, the 'input' inside gets selected and the 'h2' tag changes background, but if another 'h2' tag is clicked, the current highlight and 'input' selection changes accordingly. problem is that I have 3 different that do the same and with my code all the 3 forms are affected rather one. How do i limit my changes to only be contained to that form. Here is some code for clarification ' <form> ... <h2 onclick="document.getElementById(1001).checked='True' $('h2').removeClass('selected'); $(this).addClass('selected'); "> CONTENT <input type="radio" name="radio" id="1001" value="1001" /> </h2> ... </form>

    Read the article

  • why jquery can't be used in my $(document).ready() function?

    - by Firegun
    The page can be viewed at http://cistrome.org/cps/seqconfig?did=2693 When load in Firebugs, it gives me this error: TypeError: $(".open_gene").on is not a function [Break On This Error] $(".open_gene").on('change', function(event) { However, if I type in this expression in Firebug's console, it can be evaluated as a function without any problems: >>> $(".open_gene").on function() I was wondering what might be the reason to cause this issue. Does anyone have ideas about this? Thanks!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • jQuery plugins: How can I stop divs from overlapping?

    - by anir
    I'm using Masonry and Embedly plugin to display embedded content, I've put together an example in jsfiddle.net/anir/pBtbb/3/ It appears the Masonry plugin loads first and it causes the overlapping problem (they only show correctly when you resize the result window) I've read that I could use callback functions or retrigger Masonry once embedly has finished rendering content, but I don't know how to do it. Can you help me? Is there any other solution to fix this?

    Read the article

  • Jquery - $.(post) data response not consistent with PHP

    - by Sasha
    Jquery code: var code = $('#code'), id = $('input[name=id]').val(), url = '<?php echo base_url() ?>mali_oglasi/mgl_check_paid'; code.on('focusout', function(){ var code_value = $(this).val(); if(code_value.length != 16 ) { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; code.after('<p role=code_msg>Pogrešan kod je unešen.</p>'); } else { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; $.post(url, {id : id, code : code_value}, function(data){ if(data != 'TRUE'){ code.after('<p role=code_msg>Uneti kod je neispravan.</p>'); } else { code.after('<p role=code_msg>Status malog oglasa je promenjen.</p>'); code.after(create_image()); code.remove(); } }); } }); PHP (Codeigniter) code: function mgl_check_paid() { $code = $this->input->post('code'); $id = $this->input->post('id'); echo ($this->mgl->mgl_check_paid($code, $id)) ? 'TRUE' : 'FALSE'; } Problem is following: When code is sent and if it is correct, PHP part will echo TRUE, and JS will execute ELSE part (after post), but for some reason it is not doing that (it is executing the first part of the statment)? What is wrong with this code?

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • Best way to make sure I get all available options array/loop

    - by jaz872
    OK, here is my problem. I'm looking for the best way to loop through a bunch of options to make sure that I hit all available options. Some detail. I've created a feature that allows a client to build images that are basically other images layered on top of each other. These other images are split up into different groups. They have links on the side of the image that they can click to scroll through all the different images to view them. I'm now making an automated process that is going to run the function that changes the image when a user clicks one of the links. I need to make sure that every possible combo of the different images is hit during this process. So I have an array with the number of options for each group. The current array is [3, 9, 3, 3] My question is what is the best way to loop through this to make sure that all possible options will be shown? I apologize if this seems simple for someone out there, but I'm just having trouble wrapping my head around it. Hopefully if that person is out there, they can give a helping hand :)

    Read the article

  • How to hide URL from users when submitting this form?

    - by Camran
    I have a form with many many fields... When submitting these fields, I use the POST method which hides the actual variables passed along to the PHP page. However, I can't get rid of the complete link. Changing from GET to POST did make all the form fields invisible in the URL, but this part is still visible: mydomain.com/bin/query# I want it to be invisible, or say: mydomain.com/search I have mod_rewrite enabled so there is a possibility to do this with mod_rewrite I think, but I am new to mod_rewrite so I need your help... How should I hide this URL? If you need more input let me know...

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >