Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • My HTML5 web app crashes and I have no clue how to debug

    - by Shouvik
    Hi All, I have written a word game using HTML5 canvas tag and a little bit of audio. I developed the application on the chrome web browser on a linux system. Recently during the testing phase it was tried on safari 5.0.3 on Mac and the webpage froze. Not just the canvas element, but interactive element on the page froze. I have at some times experienced this problem on google chrome when I was developing but since the console did not throw any error before this happened, I did not give it much credence. Now as per requirements I am supposed to support both chrome and safari but this dismal performance on safari has left me shocked and I cannot see what error can be thrown which might lead to such a situation. Worse yet the CPU usage on using this application peaks to 70-80percent on my 2yr old macbook running ubuntu... I can only but pity the person who uses mac to operate this app, which undoubtedly is a heavier OS. Could someone help me out with a place I can start with to find out what exactly is causing this issue. I have run profiles on this webapp on google chromes console and noticed that in the heap spanshot value increases steadily with the playing of the game, specifically (root) value which jumps up by 900 counts. Any help would be very appreciated! Thanks EDIT: I don't know if this helps, but I have noticed that even on refreshing the page after the app becomes unresponsive the page reloads and I am still not able to interact with the page elements but the tab scroll bar continues to work and I can see my application window completely. So to summaries the tab stops accepting any sort of user interaction inside the page. Edit2: Nop. It doesn't work still... The app crashes on double click on the canvas element. The console is not throwing any errors either! =/ I have noticed this problem is isolated only to safari!

    Read the article

  • How to hide URL from users when submitting this form?

    - by Camran
    I have a form with many many fields... When submitting these fields, I use the POST method which hides the actual variables passed along to the PHP page. However, I can't get rid of the complete link. Changing from GET to POST did make all the form fields invisible in the URL, but this part is still visible: mydomain.com/bin/query# I want it to be invisible, or say: mydomain.com/search I have mod_rewrite enabled so there is a possibility to do this with mod_rewrite I think, but I am new to mod_rewrite so I need your help... How should I hide this URL? If you need more input let me know...

    Read the article

  • How to $.extend 2 objects by adding numerical values together from keys with the same name?

    - by muudless
    I currently have 2 obj and using the jquery extend function, however it's overriding value from keys with the same name. How can I add the values together instead? obj1 = {"orange":2,"apple":1, "grape":1} obj2 = {"orange":5,"apple":1, "banana":1} mergedObj = $.extend({}, obj1, obj2); var printObj = typeof JSON != "undefined" ? JSON.stringify : function(obj) { var arr = []; $.each(obj, function(key, val) { var next = key + ": "; next += $.isPlainObject(val) ? printObj(val) : val; arr.push( next ); }); return "{ " + arr.join(", ") + " }"; }; console.log('all together: '+printObj(mergedObj) ); And I get obj1 = {"orange":5,"apple":1, "grape":1, "banana":1} What I need is obj1 = {"orange":7,"apple":2, "grape":1, "banana":1}

    Read the article

  • Having an issue wit mouseup event

    - by user3680715
    Hello everyone I have this code working fine but I want the script to stop on the mouse up event. Here is an example of what I have now. How can I stop the script on mouse up event so that it looks like it only shows the coordinates when dragging over the image. Thank you! http://jsfiddle.net/Hc7x4/20/ $(document).ready(function () { $("#map-catcher").mousedown(function (e) { $("#map-catcher").mousemove(function (e) { $("#coord").text("x:"+e.offsetX+", y:"+e.offsetY); return; }); $("#map-catcher").mouseup(function (e) { return; }); }); });

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • Check for changes with jquery and a database

    - by Steve
    I am doing a notification system. When a new post is published, users will be notified immediately by an small notification on the screen. I am currently using this: setInterval(function(){ checkForChanges(); }, 2*1000); function checkForChanges(){ $.post("http://"+ document.domain + "/posts/checkForChanges/", function(dat){ if(dat>0){ .... /*create notification*/ } }); } And i was wondering if this is the correct way to do it or not. Because, this is calling a PHP function every 2 seconds and making a query to the database. In case there are no new changes, it won't do anything... Thanks.

    Read the article

  • Modifying html of dom element that was created after page loaded

    - by Ben321
    I have two separate AJAX calls. One that gets a list of items from a txt file and creates an HTML table out of them and one that talks to a database to find how much each item costs and then lists this in the corresponding table cell for each item (I know this may sound like a strange approach, but it's a good option in our case...). The issue is that the price is not getting written to the table since the table is created (or to be precise, the rows of the table are created) after the page loads. I'm not sure how to fix this. $(document).ready(function() { makeItemTable(); listPrices(); ... }); function makeItemTable() { $.ajax({ url: 'products.php', type: 'GET' }) .done(function(response) { $('.price-table > tbody').html(response); }) } function listPrices() { .ajax({ url: 'prices.php', type: 'GET' }) .done(function(response) { priceData = $.parseJSON(response); $('.price-table tr').each(function() { var item = $(this).find('td:nth-child(1)').text(); if (priceData[item]) { var price = priceData[item]; $(this).find('td:nth-child(2)').text(price); } }) }

    Read the article

  • Ttrigger extra paramter

    - by fire
    According to the jQuery manual you can send extra parameters (as an array) when calling a trigger. I am using this at the moment: $('#page0').trigger('click', [true]); How would I pick up whether the paramter has come through or not when using this? $('ul.pages li a').click(function() { // Do stuff if true has been passed as an extra parameter });

    Read the article

  • Any alternative to jQuery change() to detect when user selects new file via dialog box in IE8?

    - by ecu
    I am unable to detect when input type="file" changes its value after user selects file and the dialog box closes. $('.myInput').change(function(){ alert($(this).val()); }) Above jQuery code works perfectly in all browsers apart from IE. For some reason IE detects the change only after input field loses focus. Is there a way to detect the change immediately after dialog box closes? Or maybe to force input field to lose focus after dialog box closes so IE can detect it? I'm puzzled. Thanks for any help.

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • How to dynamically set div size?

    - by Vafello
    I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >