Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • JSON element detection

    - by user3614570
    I’ve created a string… {"atts": [{"name": "wedw"}, {"type": "---"}]} I pile a bunch of these together in an array based on user input and attach them to another string to complete a JSON object that tests out as valid. So I end up with a global array called fields with a bunch of these little snippets. So how do I change the name "weds" with a new name? I’ve tried... function changefieldname(pos){ var obj = JSON.parse(jsonstring); var oldname = obj.tracelog.fields[pos].atts[0]["name"]; var newname = document.getElementById("newlogfieldname"+pos).value; fields[pos].replace(oldname, newname); //writejson(); } And a bunch of variations. I know everything is checking out correct interms of the variables pos, oldname, and newname. I also know that fields[pos] returns the string in the array I want to correct but it’s not happy. I also tried converting fields[pos] to a string, but the replace function doesn't work on it. I’m sure there is a good reason.

    Read the article

  • JQuery function to select checkboxes

    - by Adem
    I need a function that accepts a parameter with its id example a div and after that loops inside the div to look for checkboxes and if there is/are any checks if its value is checked and returns true if every checkbox is checked returns false.

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Show elements depending on html value of a tag

    - by mike23
    I would like to accomplish the following with jquery : When I click on this link <a href="#">Cars</a> I would like all divs like those <div class="product"> <div class="category">Cars</div> </div> to do something. You get the idea, I have a menu with a list of categories, and a list of products, each containing a div with the category name, and I would like to make them hide/show.

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • Modifying html of dom element that was created after page loaded

    - by Ben321
    I have two separate AJAX calls. One that gets a list of items from a txt file and creates an HTML table out of them and one that talks to a database to find how much each item costs and then lists this in the corresponding table cell for each item (I know this may sound like a strange approach, but it's a good option in our case...). The issue is that the price is not getting written to the table since the table is created (or to be precise, the rows of the table are created) after the page loads. I'm not sure how to fix this. $(document).ready(function() { makeItemTable(); listPrices(); ... }); function makeItemTable() { $.ajax({ url: 'products.php', type: 'GET' }) .done(function(response) { $('.price-table > tbody').html(response); }) } function listPrices() { .ajax({ url: 'prices.php', type: 'GET' }) .done(function(response) { priceData = $.parseJSON(response); $('.price-table tr').each(function() { var item = $(this).find('td:nth-child(1)').text(); if (priceData[item]) { var price = priceData[item]; $(this).find('td:nth-child(2)').text(price); } }) }

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • How do I get this validationTextBox to focus?

    - by Anurag Chaudhury
    After performing an ajax request if the input in the form was wrong I am trying to get this validatationTextBox to be focussed on and display an indicator message showing the problem. The code is: dijit.byId("passwordField").focusNode.focus() The form element is as mentioned a validationTextBox. The matter that is confusing me even further is that before in dojo 1.5, this piece of code was simply dijit.byId("passwordField").focus() and this worked fine. How can I fix this?

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • jQuery scrollTop - animation stucks at the end of moving

    - by mobsteady
    i use jquery the scrollTop function to get my scrolling smooth while switching between different anchors. first, here is the url the problem this is my jquery script "ziel" is just the german word for "target", just to let you know why this variable is called "ziel" $(document).ready(function() { $('a[href*=#]').bind("click", function(event) { event.preventDefault(); var ziel = $(this).attr("href"); $('#portraitcontent').animate({ scrollTop: $(ziel).offset().top }, 3000 , function (){location.hash = ziel;}); }); return false; }); so how do i get a smooth scrolling without that ugly jumping at the end of the animation? any ideas? i really don't know what to do. spending hours with that bitch! thanks for your advices!

    Read the article

  • How to $.extend 2 objects by adding numerical values together from keys with the same name?

    - by muudless
    I currently have 2 obj and using the jquery extend function, however it's overriding value from keys with the same name. How can I add the values together instead? obj1 = {"orange":2,"apple":1, "grape":1} obj2 = {"orange":5,"apple":1, "banana":1} mergedObj = $.extend({}, obj1, obj2); var printObj = typeof JSON != "undefined" ? JSON.stringify : function(obj) { var arr = []; $.each(obj, function(key, val) { var next = key + ": "; next += $.isPlainObject(val) ? printObj(val) : val; arr.push( next ); }); return "{ " + arr.join(", ") + " }"; }; console.log('all together: '+printObj(mergedObj) ); And I get obj1 = {"orange":5,"apple":1, "grape":1, "banana":1} What I need is obj1 = {"orange":7,"apple":2, "grape":1, "banana":1}

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • How to dynamically set div size?

    - by Vafello
    I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

    Read the article

  • How to hide URL from users when submitting this form?

    - by Camran
    I have a form with many many fields... When submitting these fields, I use the POST method which hides the actual variables passed along to the PHP page. However, I can't get rid of the complete link. Changing from GET to POST did make all the form fields invisible in the URL, but this part is still visible: mydomain.com/bin/query# I want it to be invisible, or say: mydomain.com/search I have mod_rewrite enabled so there is a possibility to do this with mod_rewrite I think, but I am new to mod_rewrite so I need your help... How should I hide this URL? If you need more input let me know...

    Read the article

  • Having an issue wit mouseup event

    - by user3680715
    Hello everyone I have this code working fine but I want the script to stop on the mouse up event. Here is an example of what I have now. How can I stop the script on mouse up event so that it looks like it only shows the coordinates when dragging over the image. Thank you! http://jsfiddle.net/Hc7x4/20/ $(document).ready(function () { $("#map-catcher").mousedown(function (e) { $("#map-catcher").mousemove(function (e) { $("#coord").text("x:"+e.offsetX+", y:"+e.offsetY); return; }); $("#map-catcher").mouseup(function (e) { return; }); }); });

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >