Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • Show elements depending on html value of a tag

    - by mike23
    I would like to accomplish the following with jquery : When I click on this link <a href="#">Cars</a> I would like all divs like those <div class="product"> <div class="category">Cars</div> </div> to do something. You get the idea, I have a menu with a list of categories, and a list of products, each containing a div with the category name, and I would like to make them hide/show.

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Check for changes with jquery and a database

    - by Steve
    I am doing a notification system. When a new post is published, users will be notified immediately by an small notification on the screen. I am currently using this: setInterval(function(){ checkForChanges(); }, 2*1000); function checkForChanges(){ $.post("http://"+ document.domain + "/posts/checkForChanges/", function(dat){ if(dat>0){ .... /*create notification*/ } }); } And i was wondering if this is the correct way to do it or not. Because, this is calling a PHP function every 2 seconds and making a query to the database. In case there are no new changes, it won't do anything... Thanks.

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • How to $.extend 2 objects by adding numerical values together from keys with the same name?

    - by muudless
    I currently have 2 obj and using the jquery extend function, however it's overriding value from keys with the same name. How can I add the values together instead? obj1 = {"orange":2,"apple":1, "grape":1} obj2 = {"orange":5,"apple":1, "banana":1} mergedObj = $.extend({}, obj1, obj2); var printObj = typeof JSON != "undefined" ? JSON.stringify : function(obj) { var arr = []; $.each(obj, function(key, val) { var next = key + ": "; next += $.isPlainObject(val) ? printObj(val) : val; arr.push( next ); }); return "{ " + arr.join(", ") + " }"; }; console.log('all together: '+printObj(mergedObj) ); And I get obj1 = {"orange":5,"apple":1, "grape":1, "banana":1} What I need is obj1 = {"orange":7,"apple":2, "grape":1, "banana":1}

    Read the article

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • How do I get this validationTextBox to focus?

    - by Anurag Chaudhury
    After performing an ajax request if the input in the form was wrong I am trying to get this validatationTextBox to be focussed on and display an indicator message showing the problem. The code is: dijit.byId("passwordField").focusNode.focus() The form element is as mentioned a validationTextBox. The matter that is confusing me even further is that before in dojo 1.5, this piece of code was simply dijit.byId("passwordField").focus() and this worked fine. How can I fix this?

    Read the article

  • How to hide URL from users when submitting this form?

    - by Camran
    I have a form with many many fields... When submitting these fields, I use the POST method which hides the actual variables passed along to the PHP page. However, I can't get rid of the complete link. Changing from GET to POST did make all the form fields invisible in the URL, but this part is still visible: mydomain.com/bin/query# I want it to be invisible, or say: mydomain.com/search I have mod_rewrite enabled so there is a possibility to do this with mod_rewrite I think, but I am new to mod_rewrite so I need your help... How should I hide this URL? If you need more input let me know...

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • Having an issue wit mouseup event

    - by user3680715
    Hello everyone I have this code working fine but I want the script to stop on the mouse up event. Here is an example of what I have now. How can I stop the script on mouse up event so that it looks like it only shows the coordinates when dragging over the image. Thank you! http://jsfiddle.net/Hc7x4/20/ $(document).ready(function () { $("#map-catcher").mousedown(function (e) { $("#map-catcher").mousemove(function (e) { $("#coord").text("x:"+e.offsetX+", y:"+e.offsetY); return; }); $("#map-catcher").mouseup(function (e) { return; }); }); });

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • How to dynamically set div size?

    - by Vafello
    I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >