Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • JQuery function to select checkboxes

    - by Adem
    I need a function that accepts a parameter with its id example a div and after that loops inside the div to look for checkboxes and if there is/are any checks if its value is checked and returns true if every checkbox is checked returns false.

    Read the article

  • How do I get this validationTextBox to focus?

    - by Anurag Chaudhury
    After performing an ajax request if the input in the form was wrong I am trying to get this validatationTextBox to be focussed on and display an indicator message showing the problem. The code is: dijit.byId("passwordField").focusNode.focus() The form element is as mentioned a validationTextBox. The matter that is confusing me even further is that before in dojo 1.5, this piece of code was simply dijit.byId("passwordField").focus() and this worked fine. How can I fix this?

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • Ttrigger extra paramter

    - by fire
    According to the jQuery manual you can send extra parameters (as an array) when calling a trigger. I am using this at the moment: $('#page0').trigger('click', [true]); How would I pick up whether the paramter has come through or not when using this? $('ul.pages li a').click(function() { // Do stuff if true has been passed as an extra parameter });

    Read the article

  • jQuery scrollTop - animation stucks at the end of moving

    - by mobsteady
    i use jquery the scrollTop function to get my scrolling smooth while switching between different anchors. first, here is the url the problem this is my jquery script "ziel" is just the german word for "target", just to let you know why this variable is called "ziel" $(document).ready(function() { $('a[href*=#]').bind("click", function(event) { event.preventDefault(); var ziel = $(this).attr("href"); $('#portraitcontent').animate({ scrollTop: $(ziel).offset().top }, 3000 , function (){location.hash = ziel;}); }); return false; }); so how do i get a smooth scrolling without that ugly jumping at the end of the animation? any ideas? i really don't know what to do. spending hours with that bitch! thanks for your advices!

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • Delay image loading with jQuery

    - by DCD
    I have a page with several galleries including accordions and sliders. The problem is that the page takes forever to load. Is there a way of wrapping an image in a bit of code or applying a class to it to force it to load only after everything else is loaded?

    Read the article

  • correct function parameters designation

    - by david
    Every time i pass some parameters to a JavasScript or jQuery functon, i use some random letters. What are the correct letters for the corresponding variable types? function(o){} for example is for a object. But what are the other letters? Do someone have a list of those?

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • How to $.extend 2 objects by adding numerical values together from keys with the same name?

    - by muudless
    I currently have 2 obj and using the jquery extend function, however it's overriding value from keys with the same name. How can I add the values together instead? obj1 = {"orange":2,"apple":1, "grape":1} obj2 = {"orange":5,"apple":1, "banana":1} mergedObj = $.extend({}, obj1, obj2); var printObj = typeof JSON != "undefined" ? JSON.stringify : function(obj) { var arr = []; $.each(obj, function(key, val) { var next = key + ": "; next += $.isPlainObject(val) ? printObj(val) : val; arr.push( next ); }); return "{ " + arr.join(", ") + " }"; }; console.log('all together: '+printObj(mergedObj) ); And I get obj1 = {"orange":5,"apple":1, "grape":1, "banana":1} What I need is obj1 = {"orange":7,"apple":2, "grape":1, "banana":1}

    Read the article

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >