Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 637/972 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • Find word using JQuery

    - by tinti
    I need a little piece of advice. I have a test page with 2 fields: word number and URL Also i have a button Push. When i push the button i want to open the specified URL (it's local html files) and highlight the word at the "word number" position Of course the code must ignore element nodes (<p>,<b>,<table> and so on)

    Read the article

  • Fancybox - getting html from element based on id?

    - by kastru
    I have the following snippet; $("a.lightbox_image").each(function () { $(this).fancybox({ 'transitionIn': 'elastic', 'transitionOut': 'elastic', 'speedIn': 600, 'speedOut': 200, 'content': $('#lightbox_image_content_'+this.id.replace('lightbox_image_','')).html() }); }); But the above does not get the content from the element referenced to in the content property - what am i doing wrong?

    Read the article

  • SO style alert header

    - by Zachary
    I apologize if this question is vague, but I want to build a drop down header, very similar to the one on StackOverflow that alerts you whenever you have earned a new badge, or on Twitter whenever a new tweet comes in. I've been looking around on the internet for a tutorial, but I'm having trouble googling exactly what I'm looking for. I assume there is a way to do this in jQuery, or there may be a jQuery plugin for it, but I haven't had any luck finding one. The idea would probably be to make an AJAX request every so many seconds, and if a new alert-worthy item is found, display it for the user. If someone could point me to a resource to learn how to build one, and/or an existing plugin, that would be great.

    Read the article

  • How to change class name of a button

    - by stackOver Flow
    I have four buttons like this <div class="btn-group"> <button id="btn-men" class="btn btn-default active" i18n:translate="men">Men</button> <button id="btn-women" class="btn btn-default" i18n:translate="women">Women</button> <button id="btn-kids" class="btn btn-default" i18n:translate="kids">Kids</button> </div> And I have different css styles for the class "btn btn-default active" and "btn btn-default". what I want to know is if there is any way of changing the class name of the clicked button as btn btn-default active from btn btn-default and also change the unclicked button as btn btn-default during run time. I also use i18n for mulitilingual purpose.

    Read the article

  • Reference an object, based on a variable with it's name in it

    - by James G
    I'm looking for a way to reference an object, based on a variable with it's name in it. I know I can do this for properties and sub properties: var req = {body: {jobID: 12}}; console.log(req.body.jobID); //12 var subProperty = "jobID"; console.log(req.body[subProperty ]); //12 var property = "body"; console.log(req[property][subProperty]); //12 is it possible for the object itself? var req = {body: {jobID: 12}}; var object = "req"; var property = "body"; var subProperty = "jobID"; console.log([object][property][subProperty]); //12 or console.log(this[object][property][subProperty]); //12 Note: I'm doing this in node.js not a browser. Here is an exert from the function: if(action.render){ res.render(action.render,renderData); }else if(action.redirect){ if(action.redirect.args){ var args = action.redirect.args; res.redirect(action.redirect.path+req[args[0]][args[1]]); }else{ res.redirect(action.redirect.path); } } I could work around it by changing it to this, but I was looking for something more dynamic. if(action.render){ res.render(action.render,renderData); }else if(action.redirect){ if(action.redirect.args){ var args = action.redirect.args; if(args[0]==="req"){ res.redirect(action.redirect.path+req[args[1]][args[2]]); }else if(args[0]==="rows"){ rows.redirect(action.redirect.path+rows[args[1]][args[2]]); } }else{ res.redirect(action.redirect.path); } }

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • appendChild + createElement

    - by user317005
    what's the difference between var div = document.createElement('div');//output -> [object HTMLDivElement] document.getElementById('container').appendChild(div); and var div = '<div></div>'; document.getElementById('container').appendChild(div);//output -> <div></div> shouldn't both be the same? and if not, how do i get the 2nd version to work?

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Can I define which characters are allowed to 'break' a word?

    - by zneak
    Hey guys, I'm showing up veeeery long URLs in my Safari extension. Obviously, they can't fit on a single line. Currently, word breaking rules make it so most URLs are on two lines: the first one is rather short and ends with the ? symbol, and the other is ridiculously long and contains all the rest of the GET parameters. I'd like to make it so words also break on the & symbol, without screwing up copy-paste if possible. I've tried to replace every & with &\u00ad (& + the soft hyphen character), but it's kind of weird to see the hyphen after the & when there really isn't any in the URL. I thought there was something in store with CSS3 for that kind of problem, but I can't find it. Any suggestion welcome, as long as it works with Safari.

    Read the article

  • [Need help]: Issue with submit button and html file input control’s Click() method

    - by somesh
    Scenario: On click of a button, we dynamically create html file input (file upload) control on the page and call that file input controls Click() method. User then selects the file from the disk. There is a “Submit” button to upload the selected file. Problem: The problem is, when clicked on “Submit” button first time, the input value from the file input control is cleared. And the request does not go to the server. When clicked second time, the request goes to server with empty file input value. Why the first click on submit button does not send the request to server. And why it clears the file input control value? Note: The issue is observed only when we call Click() method programmatically. If we let user to click browse, then in that case, the "Submit" does not clear the input value and sends request to server on first click itself. Any help would be appreciated. Thanks in advance. By the way, server side code is in asp.net and client side in java script, testing on IE. -Somesh

    Read the article

  • Retrieving values from a table in HTML using jQuery?

    - by Mo
    Hi i was just wondering whats the best way to retrieve the following labels and values from this HTMl code using jquery and storing them in to a array or hash map of some sort where i have for e.g "DataSet:" : "prod" or ["Dataset", "Prod"]? <table id="metric_summary"> <tbody> <tr class="editable_metrics"> <td><label>DataSet:</label></td> <td><input name="DataSet" value="prod"></td> </tr> <tr class="editable_metrics"> <td><label>HostGroup:</label></td> <td><input name="HostGroup" value="MONITOR-PORTAL-IAD"></td> </tr> <tr class="editable_metrics"> <td><label>Host:</label></td> <td><input name="Host" value="ALL"></td> </tr> <tr class="editable_metrics"> <td><label>Class:</label></td> <td><input name="Class" value="CPU"></td> </tr> <tr class="editable_metrics"> <td><label>Object:</label></td> <td><input name="Object" value="cpu"></td> </tr> <tr class="editable_metrics"> <td><label>Metric:</label></td> <td><input name="Metric" value="CapacityCPUUtilization"></td> </tr> thanks

    Read the article

  • How do i find dynamic average for not the 20 input boxes

    - by alpho07
    How do i find dynamic average for not the 20 input boxes with ".num" class but even just five out of 20. I have done it as below but it won't work $.fn.sumValues = function() { var sum = 0; this.each(function() { if ( $(this).is(':input') ) { var val = $(this).val(); } else { var val = $(this).text(); } sum += parseFloat( ('0' + val).replace(/[^0-9-\.]/g, ''), 10 ); }); return sum.toFixed(2); }; $(document).ready(function() { $('input.price').bind('keyup', function() { $('span.total').html( $('input.price').sumValues()/$('.num').length ); }); });

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • jquery: i have to use parseInt() even when deal with numbers, why?

    - by Syom
    i have the following script <select id="select1"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> <select id="select2"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> and jquery $("#select2").change(function() { var max_value = parseInt($("#select2 :selected").val()); var min_value = parseInt($("#select1 :selected").val()); if(max_value < min_value) { $("#select1").val($(this).val()); } }); and now, what i can't understand anyway - if values of option elements are integer numbers, why i have to use parseInt()? in some cases it doesn't work without parseInt(). Thanks

    Read the article

  • Show elements depending on html value of a tag

    - by mike23
    I would like to accomplish the following with jquery : When I click on this link <a href="#">Cars</a> I would like all divs like those <div class="product"> <div class="category">Cars</div> </div> to do something. You get the idea, I have a menu with a list of categories, and a list of products, each containing a div with the category name, and I would like to make them hide/show.

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >