Search Results

Search found 29575 results on 1183 pages for 'dynamic javascript'.

Page 682/1183 | < Previous Page | 678 679 680 681 682 683 684 685 686 687 688 689  | Next Page >

  • How do I return something in JQuery?

    - by TIMEX
    function vote_helper(content_id, thevote){ var result = ""; $.ajax({ type:"POST", url:"/vote", data:{'thevote':thevote, 'content_id':content_id}, beforeSend:function() { }, success:function(html){ result = html; } }); return result; }; I want to return the result. But it's returning blank string.

    Read the article

  • How to make div clickable?

    - by metal-gear-solid
    I want to make this div click-able and want to use same href of inside <a> and want to keep link in inside <a> also (so if JS is disabled then link will be accessible). <div id="example"> <p> some text </p> <img src="example.jpg /> <a href="http://stackoverflow.com"> link </link> </div>

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • jQuery and array of objects

    - by sepoto
    $(document).ready(function () { output = ""; $.ajax({ url: 'getevents.php', data: { ufirstname: 'ufirstname' }, type: 'post', success: function (output) { alert(output); var date = new Date(); var d = date.getDate(); var m = date.getMonth(); var y = date.getFullYear(); $('#calendar').fullCalendar({ header: { left: 'prev,next today', center: 'title', right: 'month,basicWeek,basicDay' }, editable: true, events: output }); } }); }); I have code like this and if I copy the text verbatim out of my alert box and replace events: output with events: [{ id: 1, title: 'Birthday', start: new Date(1355011200*1000), end: new Date(1355011200*1000), allDay: true, url: 'http://www.yahoo.com/'},{ id: 2, title: 'Birthday Hangover', start: new Date(1355097600*1000), end: new Date(1355097600*1000), allDay: false, url: 'http://www.yahoo.com'},{ id: 3, title: 'Sepotomus Maximus Christmas', start: new Date(1356393600*1000), end: new Date(1356393600*1000), allDay: false, url: 'http://www.yahoo.com/'},] Everything works just fine. What can I do to fix this problem? I though that using events: output would place the text in that location but it does not seem to be working. Thank you all kindly in advance for any comments or answers!

    Read the article

  • Pulling .live() functionality out of jQuery

    - by Daniel
    I am writing a Firefox Add-On that currently is depending on jQuery for the following things: Selectors Animations A special .live("focus") hail-mary event-catching maneuver that happens to work with jQuery 1.4.2 (but not 1.4.4) jQuery isn't well suited for functioning inside XUL, and it's a miracle we've gotten this far with it. We're trying to remove the jQuery requirements, the first two are easy (animations are simple, and we can use .querySelector() instead of jQuery), but the .live has proven impossible to do on our own. I've tried reading the source code, but I haven't been able to piece it apart. What is the jQuery .live function doing? There's clearly a lot more going on than document.addEventListener("focus"/"focusin",function_to_pick_apart_events). What else is going on here?

    Read the article

  • jQuery autocomplete. Doesn't reveal existing matches.

    - by Alexander
    Hello fellow engineers. I have come across a problem I just can't solve. I am using autocomplete plugin for jQuery on an input. The HTML looks something like this: <tr id="row_house" class="no-display"> <td class="col_num">4</td> <td class="col_label">House Number</td> <td class="col_data"> <input type="text" title="House Number" name="house" id="house"/> <button class="pretty_button ui-state-default ui-corner-all button-finish">Get house info</button> </td> </tr> I am sure that this is the only id="house" field. Other fields that are before this one work fine with autocomplete, and it's basically the same algorithm (other variables, other data, other calls). So why doesn't it work like it should work with the following init. code: $("#house").autocomplete(["1/4","6","6/1","6/4","8","8/1","8/5","10","10/1","10/3","10/4","12","12/1","12/5","12/6","14","14/1","15","15/1","15/2","15/4","15/5","16","16/1","16/2","16/21","16/2B","16/3","16/4","17","17/1","17/2","17/4","17/5","17/6","17/7","17/8","18","18/1","18/2","18/3","18/5","18/95","19","19/1","19/2","19/3","19/4","19/5","19/6","19/7","19/8","20","20/1","20/2","20/3","20/4","21","21/1","21/2","21/3","21/4","22","22/9","23","23/2","23/4","24","24/1","24/2","24/3","24/A","25","25/1","25/10","25/2","25/4","25/5","25/6","25/7","25/8","25/9","26","26/1","26/6","27","27/2","28","28/1","29","29/2","29/3","29/4","30","30/1","30/2","30/3","31","31/1","31/3","32/A","33","34","34/1","34/11","34/2","34/3","35","35/1","35/2","35/4","36","36/1","36/A","37","37/1","37/2","38","38/1","38/2","39/1","39/2","39/3","39/4","40","40/1","41","41/2","42","43","44","45","45/1","45/10","45/11","45/12","45/13","45/14","45/15","45/16","45/17","45/2","45/3","45/6","45/7","45/8","45/9","46","47","47/2","49","49/1","50","51","51/1","51/2","52","53","54","55/7","66","109","122","190/8","412"], {minChars:1, mustMatch:true}).result(function(event, result, formatted) { var found=false; for(var index=0; index<HChouses.length; index++) //HChouses is the same array used for init, but each entry is paired with a database ID. if(HChouses[index][0]==result) { found=true; HChouseId=HChouses[index][1]; $("#row_house .button-finish").click(function() { QueryServer("HouseConnect","FillData",true,HChouseId); //this performs an AJAX request }); break; } if(!found) $("#row_house .button-finish").unbind("click"); }); Each time I start typing (say I press the "1" button), the text appears and gets deleted instantly. Rarely at all after repeated presses I get the list (although much shorter than it should be) But if after that I press the second digit, the whole thing disappears again. P.S. I use Firefox 3.6.3 for development.

    Read the article

  • Check for element equality in an animation function.

    - by Zardoz
    I have the the below code and would expect that in the first pass of the fadeTo function "yes" would be printed as those first two console logs tell me it is the same element. But it doesn't recognize them as equal. What do I miss here? var tds = self.element.find("td:nth-child(" + (columnIndex + 1) + ")"); tds.fadeTo(options.columnFadeOutTime, 0, function() { window.console.log(tds.first()); window.console.log($(this)); if ($(this) == tds.first()) { window.console.log("yes"); } else { window.console.log("no"); } }

    Read the article

  • Any alternative to jQuery change() to detect when user selects new file via dialog box in IE8?

    - by ecu
    I am unable to detect when input type="file" changes its value after user selects file and the dialog box closes. $('.myInput').change(function(){ alert($(this).val()); }) Above jQuery code works perfectly in all browsers apart from IE. For some reason IE detects the change only after input field loses focus. Is there a way to detect the change immediately after dialog box closes? Or maybe to force input field to lose focus after dialog box closes so IE can detect it? I'm puzzled. Thanks for any help.

    Read the article

  • Parent - child event jquery

    - by Tom Rider
    I have have a 2 div element. One is child and one is parent like : <div id="p"> <div id="c"> </div> </div> The parent div has 2 event attached click and dblclick and child div has 1 event attached click. Now my problem is when i clicked on the child div the parent div click event also executed. I tried e.stopPropagation(); but still same behavior. Help me ?

    Read the article

  • Why ajax doesn't work unless I refresh or use location.href?

    - by Connor Tang
    I am working on a html project, which will eventually package by Phonegap. So I am trying to encode the data from html form to JSON format, then use ajax send to a php file resides on server, and receive the response to do something else. Now I use <a href='login.html'> in my index.html to open the login page. In my login page, I have this <script> $(document).ready(function(e) { $('#loginform').submit(function(){ var jData = { "email": $('#emailLogin').val(), "password": $('#Password').val()}; $.ajax({ url: 'PHP/login.php', type:'POST', data: jData, dataType: 'json', async: false, error: function(xhr,status){ //reload(); location.href='index.html'; alert('Wrong email and password'); }, success: function(data){ if(data[1] == 1){ var Id_user = data[0]; location.href='loginSuccess.html'; } } }); }); }); </script> to send my data to server. But I found that it won't work, it's still in the login page. I tried to enter data and submit again, it's still nothing happen. Until I refresh the login page and enter data again, it can give an error message or go to the loginsuccess page. However, when I use <script> function loadLogin(){ location.href='login.html'; } </script> to open the login page, everything works well. So what cause this? How can I modify this piece of code to make it better?

    Read the article

  • Ajax request. Which callback is executed first complete or success?

    - by Gutzofter
    I could spike this to find out, but I'm going to use SO. In my unit tests (qunit) I use the asynchShould (alias for asynchTest) test. Part of the assertion is to wait for the completion/success of the request. Like this: asyncShould('talk to customer list server', 1, function() { stop(2000); var forCustomerList = newCustomerListRequest(); forCustomerList.page = 'helpers/helper.php'; forCustomerList.data += '&action=customerListServer&DB=11001'; var originalSuccess = forCustomerList.success; forCustomerList.success = function(msg) { if (msg.flash !== undefined && msg.data !== undefined && msg.status !== undefined) { ok(true, 'json structure correct') } else { ok(false, 'json structure not correct'); } originalSuccess(msg); start(); }; testController.getServerData(forCustomerList); })

    Read the article

  • Is there a way to delete a form element without using jQuery .remove()?

    - by Tommy
    Using .remove() so that the select all check box is not submitted to the server. However, it is visible to the user as the select all checkbox is "physically" removed from the web page, upon submit. Instead, I would like removing the select all check box to appear seamless but NOT on the server side. i.e. - I would like to keep the input on the page but remove the element in the form array before it is sent. Can I manipulate the element[] array of the form before it is sent to the server and delete it there? Thank you.

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • Creating a page selector with JSP/JSTL

    - by zakSyed
    I am working on a project where I am required to build a page somewhat similar to the one you see when you visit a website like blockbuster. When you click on browse more you are taken to a page with a bar on top with different page numbers and a drop down to select the number of pages you want to view on that page. I want to include a feature like that on my page but I am not sure where to start. In my page I have list of 200 items which I want to display page by page. I was suggested to use custom tags, but is there a more simpler or efficient way to create that functionality. My web application uses Spring MVC framework and is coded entirely in Java. Any suggestions will be appreciated.

    Read the article

  • What is XML good for and when should i be using it?

    - by Haroldo
    I'm curious, I've been developing pretty powerful websites/web apps, and I've never learnt XML, even odder I've never really felt the need to. It's not like Curl or Prepared Statements where before knowing what they did and how they worked I had a feeling 'there's got to be an easier way to do this!' or 'there's got to be something designed for this!'. Currently I work with MySQL and JSON and I don't have this feeling of 'I need to learn that' (XML), this must be wrong! I'm really interested to hear some compelling arguments for XML, and learn about things which it can do beter than JSON or MySQL (or some other aspect of web dev) and when i should be using it!

    Read the article

  • IE firing anything else but click

    - by shabunc
    I just wonder is there's any way to fire any event via IE's event-triggering implementation - fireEvent. I've tried to use it but failed with all event except click. The only reason i've get interested with this issue it curiousity, thus, any answers like "just do not trigger events, it is a bad idea" - all such answers would be considered, well...not full))) thanks in advance

    Read the article

  • Jquery Text Slide in Effect

    - by user3718016
    I want to make text animation like this slide in from left. There are three text fields Sports Cargo Bag $14 Sale $25 I want these text to be set from jquery and slide in from the left like this link. This is my code JsFiddle html <div id="mainContainer"> <div id="logdo"> <img src="http://i.share.pho.to/7346a9ca_o.gif"/> </div> <div id="images"> <img id="introImg" src="http://i.share.pho.to/9064dfe4_o.jpeg"/></div> <div id="headlineText"> <p id="headline1Txt" ></p> <p id="headline2Txt" ></p> <p id="headline3Txt" ></p> </div> <button class="btn btn-primary" id="ctaBtn" type="button">SHOP NOW</button> </div> css * { margin:0; padding:0; } #mainContainer{ text-align: center; width:160px; height:600px; box-sizing:border-box; -moz-box-sizing:border-box; -webkit-box-sizing:border-box; border:5px solid #BACAE4; overflow: hidden; position: fixed; } #images{ position:absolute; top:200px; left:3px; right:1286px; Width:130px; height:152px; } #introImg{ position:absolute; top:40px; left:7px; right:11px; } #headlineText p { text-align: center; position: absolute; top:60px; left:-120px; Width:120px; height:269px; line-height:1.0; overflow:hidden; } #ctaBtn{ position:absolute; top:540px; left:26px; right:0px; Width:106px; height:28px; }

    Read the article

  • More compact way to do this?

    - by Macha
    I have a couple of functions that loop around the surrounding cells of a cell. The grid is contained inside an array. In my code, I have checks to make sure it's not one of the edge cells, as checking an undefined cell causes an error. As such, I have code like this: if(x > 0) { var firstX = x - 1; } else { var firstX = x; } if(x < 199) { var lastX = x + 1; } else { var lastX = x; } if(y > 0) { var firstY = y - 1; } else { var firstY = y; } if(y < 199) { var lastY = y + 1; } else { var lastY = y; } A lot of lines of code to do very little. Is there a more elegant way to do this?

    Read the article

< Previous Page | 678 679 680 681 682 683 684 685 686 687 688 689  | Next Page >