Search Results

Search found 29575 results on 1183 pages for 'dynamic javascript'.

Page 686/1183 | < Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

  • How to search with parameters in MVC?

    - by SnowJim
    Hi, I need to be able to provide a page for the end user where thay can search in the following : Search work Category Price AdType Location and so on. Its important that the user can copy the url and then use it later(and get the same settings). Its also important to be able to save these settings on the user in the database. So far I have created a ModelView class that contains the parameters but I am not sure that this is the right way to go? Maby I should pass all inte the URL. If so, how do I accomplish this? Is there any samples I could look at? BestRegards

    Read the article

  • How to add "Back to top" link at bottom at <div> is browser window is shorter than page, using jquer

    - by metal-gear-solid
    How to add "Back to top" link at bottom at is browser window is shorter than page, using jquery? <div id="mainContent"> <p>Some content</p> </div> If some content is bigger than browser window ( I mean if vertical bar comes on the page) then i want to add Back to top just before closing the div. <div id="mainContent"> <p>Some content</p> <p>Some content</p> <p>Some content</p> <a href="#"> Back to top </a> </div>

    Read the article

  • Matching a String and then incrementing a number within HTML elements

    - by Abs
    Hello all, I have tags in a html list, here is an example of two tags. <div class="tags"> <ul> <li> <a onclick="tag_search('tag1');" href="#">tag1 <span class="num-active">1</span></a> </li> <li> <a onclick="tag_search('tag2');" href="#">tag2 <span class="num-active">1</span></a> </li> </ul> </div> I would like to write a function that I can pass a string to, that will match the strings in the a hyperlink i.e. "tag1" or "tag2", if there is a match then increment the number in the span, if not then add a new li. The bit I am having trouble with is how do I search for a string in the div with class tags and then when I find a match identifying the element. I can't even do the first bit as I am use to using an ID or a Class. I appreciate any help on this using JQuery Thanks all Code so far function change_tag_count(item){ alert(item);//alerts the string test $.fn.searchString = function(str) { return this.filter('*:contains("' + item + '")'); }; if($('body').searchString(item).length){ var n = $('a').searchString(item).children().text(); n = parseInt(n) + 1; $('a').searchString(item).children().text(n); }else{ alert('here');//does not alert this when no li contains the word test $("#all_tags ul").append('<a onclick="tag_search(\''+item+'\');" href="#">'+item+'<span class="num-active">1</span></a>'); } }

    Read the article

  • submit in html on sql query

    - by user1644661
    i need to run this sql query , which give me a list of Id and Dates i want to click each result and take with me the Id value to the next form i wrote this query above but i see in the debager that the hidden ID get his value but not pass to the next form i think i have a problem with the submit() . where should i put him ? thanks anat function ShowAllCarts($user_email) { $connB = new ProductDAO(); $connB->Connect(); $pro_query = "SELECT * FROM Cart WHERE `Email`='$user_email';"; $db_result = $connB->ExecSQL($pro_query); $html_result = '<div data-role="content"> <ul data-role="listview" data-theme="b"> '; $html_result .= '<form action="PreviouscartProduct.php" method="POST"/>'; while($row_array = $db_result->fetch_array(MYSQLI_ASSOC)) { $Id= $row_array['Id']; $Date= $row_array['Date']; //$html_result // $html_result .="<li><a href='PreviouscartProduct.php'>Cart number: $Id from Date: $Date><input type='hidden' name='Id' value'<?=$Id?>'</input></a></li>'"; $html_result .= '<a onclick="this.form.submit();" </a>; } $html_result .= ' </ul> </div>'; $html_result .= '</form>'; $connB->Disconnect(); return $html_result; } //display all carts $func_result = ShowAllCarts($Email);

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • Use a table as container or not?

    - by Camran
    I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Credit card validation with regexp using test()

    - by Matt
    I'm trying to complete some homework and it appears the book might have gotten it wrong. I have a simple html page that allows user to pick a credit card in our case american express. The user then enters a number and evalutes that number based on a regular expression. My question ends up being when test() evaluates the number it returns a boolean or a string? I should then compare that string or boolean? True == true should fire off the code in a nested if statement. Heres what the book gives me as valid code: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE if(cardProtocol.test(document.forms[0].cardNumber.value)) document.forms[0].ccResult.value = "Valid credit card number"; } The above code doesn't work in firefox. I've tried modifying it with 2 alerts to make sure the number is good and the boolean is good...and still no luck: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE <------ alert(document.forms[0].cardNumber.value) alert(cardProtocol.test(document.forms[0].cardNumber.value)) if((cardProtocol.test(document.forms[0].cardNumber.value)) == true ) // <--Problem { document.forms[0].ccResult.value = "Valid credit card number"; } else { document.forms[0].ccResult.value = "Invalid credit card number"; } } Any ideas? the if loop is the culprit but I'm not figuring out why it is not working. Please throw up the code for the if loop! Thanks for the help!

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • How to use jquery code in Internet Explorer?

    - by ilariah
    I put some jquery in my website that makes the text move to the right when the page changes. It works in Firefox and Safari but it doesn't work in Internet Explorer. My url to my website: http://katieduck.com/Courses/Improvisation%20Winter%20Course%20Dartington.html Here is the code that is not working: $(document).ready(function() { $('#tabvanilla > ul').tabs({ fx: { height: 'toggle', opacity: 'toggle' } }); $('#featuredvid > ul').tabs(); }); Maybe you can find out what is wrong.

    Read the article

  • jquery autocomplete extra spaces

    - by elasticrash
    I got this loop in a jsp file <% for (int i = 0; i < length; i++) { for( int j = 0; j < width; j++) { element = MAP_LIST[j][i]; if (element.equals("A")) {} else if (j == width-1 && i == length-1){ %> <%=element%><%} else { %> <%=element%>,<%} } } %> which gets me a csv list from an oracle database for my autocomplete text field by using jquery function Mapsheets(type,nomos) { $(function() { var f_data; $.get('/gaec_web/MapSheets.jsp',{'datasrc-select':datasource, 'type_1': type, 'nomos': nomos}, function(data){ f_data = data.split(','); $( "#fx_no" ).autocomplete({ source: f_data, minLength: 2 }); }); }); } everything works like a charm, i type the first 2 chars and the autocomplete pops up displays every thing as it was supposed to and when I try to pick a value i get the value with several (5) extra spaces in the tail. And then when it gets submitted it fails cause it doesnt match the mapname in question. the results look like this " 320-197" So what is causing this? if i run the jsp page alone also get normal results for example 372-146, 376-146, 372-149, 368-149, 376-149, 380-149, 380-152, 376-152, 372-152, 368-152, 368-155, 376-155, 372-155, 380-155, 368-158, 380-158, 376-158, 372-158 thanks in advance

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Fck Editor Multiple Editors

    - by DavisBains
    Hello, I have multiple textareas and only want one toolbar. How would I be able to achieve something like this: <div id="Editor"> <!-- Toolbar will go here -->' </div> <textarea>Some content...</textarea> <textarea>Some content...</textarea>

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • How to disable an input with jQuery Validation Plugin

    - by Eelke
    This should be really simple but I can't get it to work, how do I disable and add a class to an input? Let's say I've got an input field with id = name, this is how far I got, $("input#name").attr("disabled"); What am I doing wrong here? Any help would be greatly appreciated, thanks in advance!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • jQuery setinterval does not show first element

    - by Me-and-Coding
    Hi, I am creating this content slider, you can view/edit here: http://jsbin.com/esame4 I have put in place setInterval so that animation runs automatically, however, when it is run for the first time, google image is shown but not afterwords. Should be simple but i am unable to figure out the problem.

    Read the article

< Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >