Search Results

Search found 29575 results on 1183 pages for 'dynamic javascript'.

Page 686/1183 | < Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • submit in html on sql query

    - by user1644661
    i need to run this sql query , which give me a list of Id and Dates i want to click each result and take with me the Id value to the next form i wrote this query above but i see in the debager that the hidden ID get his value but not pass to the next form i think i have a problem with the submit() . where should i put him ? thanks anat function ShowAllCarts($user_email) { $connB = new ProductDAO(); $connB->Connect(); $pro_query = "SELECT * FROM Cart WHERE `Email`='$user_email';"; $db_result = $connB->ExecSQL($pro_query); $html_result = '<div data-role="content"> <ul data-role="listview" data-theme="b"> '; $html_result .= '<form action="PreviouscartProduct.php" method="POST"/>'; while($row_array = $db_result->fetch_array(MYSQLI_ASSOC)) { $Id= $row_array['Id']; $Date= $row_array['Date']; //$html_result // $html_result .="<li><a href='PreviouscartProduct.php'>Cart number: $Id from Date: $Date><input type='hidden' name='Id' value'<?=$Id?>'</input></a></li>'"; $html_result .= '<a onclick="this.form.submit();" </a>; } $html_result .= ' </ul> </div>'; $html_result .= '</form>'; $connB->Disconnect(); return $html_result; } //display all carts $func_result = ShowAllCarts($Email);

    Read the article

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

  • How to use jquery code in Internet Explorer?

    - by ilariah
    I put some jquery in my website that makes the text move to the right when the page changes. It works in Firefox and Safari but it doesn't work in Internet Explorer. My url to my website: http://katieduck.com/Courses/Improvisation%20Winter%20Course%20Dartington.html Here is the code that is not working: $(document).ready(function() { $('#tabvanilla > ul').tabs({ fx: { height: 'toggle', opacity: 'toggle' } }); $('#featuredvid > ul').tabs(); }); Maybe you can find out what is wrong.

    Read the article

  • How to add "Back to top" link at bottom at <div> is browser window is shorter than page, using jquer

    - by metal-gear-solid
    How to add "Back to top" link at bottom at is browser window is shorter than page, using jquery? <div id="mainContent"> <p>Some content</p> </div> If some content is bigger than browser window ( I mean if vertical bar comes on the page) then i want to add Back to top just before closing the div. <div id="mainContent"> <p>Some content</p> <p>Some content</p> <p>Some content</p> <a href="#"> Back to top </a> </div>

    Read the article

  • Large Data Table with first column fixed

    - by bhavya_w
    I have structure as shown in the fiddle http://jsfiddle.net/5LN7U/. <section class="container"> <section class="field"> <ul> <li> Question 1 </li> <li> question 2 </li> <li> question 3 </li> <li> question 4 </li> <li> question 5 </li> <li> question 6 </li> <li> question 7 </li> </ul> </section> <section class="datawrap"> <section class="datawrapinner"> <ul> <li><b>Answer 1 :</b></li> <li><b>Answer 2 :</b></li> <li><b>Answer 3 :</b></li> <li><b>Answer 4 :</b></li> <li><b>Answer 5 :</b></li> <li><b>Answer 6 :</b></li> <li><b>Answer 7 :</b></li> </ul> </section> </section> </section> Basically its a table structure made using divs. The first column contains a long list of questions and the second column contains answers/multiple answers which can be quite big ( there has to be horizontal scrolling in the second column.) The problem i am facing is when i scroll downwards the second column which has the horizontal scroll bar is also scrolling downward. I want horizontal scrollbar to be fixed there. as in it should be always fixed there no matter how much i scroll vertically. Much Like Google Spreadsheets: where the first column stays fixed and there's horizontal scrolling on rest of the columns with over vertical scrolling for whole of the data. I cannot used position fixed in the second column. P.S : please no lectures on using div's for making a table structure. I have my own reasons. and its kinda urgent. Thanks in advance.

    Read the article

  • How to disable an input with jQuery Validation Plugin

    - by Eelke
    This should be really simple but I can't get it to work, how do I disable and add a class to an input? Let's say I've got an input field with id = name, this is how far I got, $("input#name").attr("disabled"); What am I doing wrong here? Any help would be greatly appreciated, thanks in advance!

    Read the article

  • Local variable vs parameter

    - by Dhana
    function doIt(param) { var localVar = param; //do lots of stuff with localVar } function doIt(param) { //do lots of stuff with param } Is there any difference in terms of efficiency between the code above?

    Read the article

  • Expanding a row in a div-based table

    - by magneticMonster
    I have a stack of <div> elements that show a name. I'd like to include a + link off to the side that, when clicked, expands the <div> and adds more detailed information (from a RoR controller). After poking around on the net, I found link_to_remote and related RoR stuff, but I can't seem to get the right combination to work together. Can someone point me to a tutorial or show what the controller and view interaction should look like? Thanks!

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • Matching a String and then incrementing a number within HTML elements

    - by Abs
    Hello all, I have tags in a html list, here is an example of two tags. <div class="tags"> <ul> <li> <a onclick="tag_search('tag1');" href="#">tag1 <span class="num-active">1</span></a> </li> <li> <a onclick="tag_search('tag2');" href="#">tag2 <span class="num-active">1</span></a> </li> </ul> </div> I would like to write a function that I can pass a string to, that will match the strings in the a hyperlink i.e. "tag1" or "tag2", if there is a match then increment the number in the span, if not then add a new li. The bit I am having trouble with is how do I search for a string in the div with class tags and then when I find a match identifying the element. I can't even do the first bit as I am use to using an ID or a Class. I appreciate any help on this using JQuery Thanks all Code so far function change_tag_count(item){ alert(item);//alerts the string test $.fn.searchString = function(str) { return this.filter('*:contains("' + item + '")'); }; if($('body').searchString(item).length){ var n = $('a').searchString(item).children().text(); n = parseInt(n) + 1; $('a').searchString(item).children().text(n); }else{ alert('here');//does not alert this when no li contains the word test $("#all_tags ul").append('<a onclick="tag_search(\''+item+'\');" href="#">'+item+'<span class="num-active">1</span></a>'); } }

    Read the article

  • jquery autocomplete extra spaces

    - by elasticrash
    I got this loop in a jsp file <% for (int i = 0; i < length; i++) { for( int j = 0; j < width; j++) { element = MAP_LIST[j][i]; if (element.equals("A")) {} else if (j == width-1 && i == length-1){ %> <%=element%><%} else { %> <%=element%>,<%} } } %> which gets me a csv list from an oracle database for my autocomplete text field by using jquery function Mapsheets(type,nomos) { $(function() { var f_data; $.get('/gaec_web/MapSheets.jsp',{'datasrc-select':datasource, 'type_1': type, 'nomos': nomos}, function(data){ f_data = data.split(','); $( "#fx_no" ).autocomplete({ source: f_data, minLength: 2 }); }); }); } everything works like a charm, i type the first 2 chars and the autocomplete pops up displays every thing as it was supposed to and when I try to pick a value i get the value with several (5) extra spaces in the tail. And then when it gets submitted it fails cause it doesnt match the mapname in question. the results look like this " 320-197" So what is causing this? if i run the jsp page alone also get normal results for example 372-146, 376-146, 372-149, 368-149, 376-149, 380-149, 380-152, 376-152, 372-152, 368-152, 368-155, 376-155, 372-155, 380-155, 368-158, 380-158, 376-158, 372-158 thanks in advance

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • Same function on multiple div classes doesn't work

    - by Sebass van Boxel
    I'm doing something terribly wrong and just can't find the solution for it. Situation: I've got a number of products with a number of quotes per product. Those quote automatically scroll in a div. If the scroll reaches the last quote is scroll back to the first one. What works: The function basically works when it's applied on 1 div, but when applied on multiple div it doesn't scroll back to the first one or keeps scrolling endlessly. This is the function i've written for this: function quoteSlide(divname){ $total = ($(divname+" > div").size()) $width = $total * 160; $(divname).css('width', ($width)); console.log ($totalleft *-1); if ($width - 160 > $totalleft *-1){ $currentleft = $(divname).css('left'); $step = -160; $totalleft = parseInt($currentleft)+$step; }else{ $totalleft = 0; } $(divname).animate(     { left: $totalleft }, // what we are animating     'slow', // how fast we are animating     'swing', // the type of easing     function() { // the callback }); } It's being executed by something like: quoteSlide('#quotecontainer_1'); in combination with a setInterval so it keeps scrolling automatically. This is the jsFiddle where it goes wrong (So applied on more than 1 div) http://jsfiddle.net/FsrbZ/. This is the jsFiddle where everything goes okay. (applied on 1 div) When changing the following: quoteSlide('#quotecontainer_1'); quoteSlide('#quotecontainer_2'); setInterval(function() { quoteSlide('#quotecontainer_1'); quoteSlide('#quotecontainer_2'); }, 3400);? to quoteSlide('#quotecontainer_1'); setInterval(function() { quoteSlide('#quotecontainer_1'); }, 3400);? it does work... but only on 1 quotecontainer.

    Read the article

  • Credit card validation with regexp using test()

    - by Matt
    I'm trying to complete some homework and it appears the book might have gotten it wrong. I have a simple html page that allows user to pick a credit card in our case american express. The user then enters a number and evalutes that number based on a regular expression. My question ends up being when test() evaluates the number it returns a boolean or a string? I should then compare that string or boolean? True == true should fire off the code in a nested if statement. Heres what the book gives me as valid code: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE if(cardProtocol.test(document.forms[0].cardNumber.value)) document.forms[0].ccResult.value = "Valid credit card number"; } The above code doesn't work in firefox. I've tried modifying it with 2 alerts to make sure the number is good and the boolean is good...and still no luck: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE <------ alert(document.forms[0].cardNumber.value) alert(cardProtocol.test(document.forms[0].cardNumber.value)) if((cardProtocol.test(document.forms[0].cardNumber.value)) == true ) // <--Problem { document.forms[0].ccResult.value = "Valid credit card number"; } else { document.forms[0].ccResult.value = "Invalid credit card number"; } } Any ideas? the if loop is the culprit but I'm not figuring out why it is not working. Please throw up the code for the if loop! Thanks for the help!

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >