Search Results

Search found 29575 results on 1183 pages for 'dynamic javascript'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 686/1183 | < Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • jquery integrate form parameter in one object

    - by jesse
    There are many forms in my page. I want to merge them in one object and submit them in one object. But I find serializeArray() or serialize() do not match my request, the serializeArray function will generate a array object and serialize is used by get model, it is not an object. is there a jquery or local function can merge them in one object. I have one solution but it is not perfect, loop the array object generated by serializeArray, use $.extend to merge them in one object. is there a better method? kindly help, thanks.

    Read the article

  • How to set focus to a control inside frame

    - by Geetha
    Hi All, i am using two frames in a page. Mainframe have a page with text box to get input and gives the result url. Needs: I want to show this page in the topframe. I want to set focus to the text box control in the mainframe always. using the following code but giving null error. parent.frames['mainFrame'].document.getElementById('form1:txtbox').focus(); <frameset rows="550,0" cols="1008" frameborder="NO" border="0" framespacing="0"> <frame src="" id="topFrame" target="topFrame" runat="server" scrolling="no"></frame> <frame src="Search.aspx" runat="server" id="mainFrame"></frame> </frameset>

    Read the article

  • Check for element equality in an animation function.

    - by Zardoz
    I have the the below code and would expect that in the first pass of the fadeTo function "yes" would be printed as those first two console logs tell me it is the same element. But it doesn't recognize them as equal. What do I miss here? var tds = self.element.find("td:nth-child(" + (columnIndex + 1) + ")"); tds.fadeTo(options.columnFadeOutTime, 0, function() { window.console.log(tds.first()); window.console.log($(this)); if ($(this) == tds.first()) { window.console.log("yes"); } else { window.console.log("no"); } }

    Read the article

  • Find word using JQuery

    - by tinti
    I need a little piece of advice. I have a test page with 2 fields: word number and URL Also i have a button Push. When i push the button i want to open the specified URL (it's local html files) and highlight the word at the "word number" position Of course the code must ignore element nodes (<p>,<b>,<table> and so on)

    Read the article

  • Show elements depending on html value of a tag

    - by mike23
    I would like to accomplish the following with jquery : When I click on this link <a href="#">Cars</a> I would like all divs like those <div class="product"> <div class="category">Cars</div> </div> to do something. You get the idea, I have a menu with a list of categories, and a list of products, each containing a div with the category name, and I would like to make them hide/show.

    Read the article

  • jquery: i have to use parseInt() even when deal with numbers, why?

    - by Syom
    i have the following script <select id="select1"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> <select id="select2"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> and jquery $("#select2").change(function() { var max_value = parseInt($("#select2 :selected").val()); var min_value = parseInt($("#select1 :selected").val()); if(max_value < min_value) { $("#select1").val($(this).val()); } }); and now, what i can't understand anyway - if values of option elements are integer numbers, why i have to use parseInt()? in some cases it doesn't work without parseInt(). Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • Is canvas security model ignoring access-control-allow-origin headers?

    - by luklatlug
    It seems that even if you set the access-control-allow-origin header to allow access from mydomain.org to an image hosted on domain example.org, the canvas' origin-clean flag gets set to false, and trying to manipulate that image's pixel data will trigger a security exception. Shouldn't canvas' obey the access-control-allow-origin header and allow access to image's data without throwing an exception?

    Read the article

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • Add a Click Event to elements added to the DOM

    - by E7AD
    var myOP = '<div>'; for (var i = 0; i < op.length; i++) { myOP += '<div>'; myOP += '<div id="myBTN-' + [i] + '">' + op[i]['Field1'] + '</div>'; myOP += '<div id="blah-' + [i] + '">' + op[i]['Field2'] + '</div>'; myOP += '</div>'; } myOP += '</div>'; $("#myBTN-" + i).click(function () { $('#blah-' + i).toggle("slow"); }); $('#container').html(myOP); I'm trying to get the click function to fire on the elements i'm created w/ the above for loop. Can anyone point me in the right direction?

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • how to sort an existing table in greasemonkey ?

    - by user570512
    i'm writing a greasemonkey user.js for a page with a table in it. (table is 100 rows by 18 columns.) now what i want to do is to make it sortable on column. and also have it run in both chrome and firefox. all searches for answers sofar resulted in suggestions to use jquery/dojo or something alike. can i be done without any external code? after all it's just a matter of replacing the row's in a different order, right? or is that a silly thing to say? the thing is that i'm already using dojo for some query needs but since i want it to run in both firefox and chrome, i just copy paste the whole dojo thing in my script.. also, most of the solutions i found sofar seem to be more for use when building a table. not for altering an existing one. any help is appreciated.

    Read the article

  • Input type "Text" to have a blurred text, which dissappears onFocus?

    - by Camran
    Some websites have forms with input type="text". And inside these textboxes there is a blurred text, which says for example: "Enter your name here". And then onClick or OnFocus or whatever, the text dissappears and you can type into the textbox. Like the title of posting a question here at stackoverflow, same thing. How is this done easiest way? Would prefer if there was not too much js involved. Thanks

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • Animate/Ease an element to position when other elements disappear

    - by Jonathan
    Please take a look at this fiddle: http://jsfiddle.net/dhcyA/ Try clicking on a block. What I want is that when the other elements disapear, the selected block will animate/ease to his giving position instead of just jumping like it does now. Then the same animation repeats itself when clicking again on the box, but then back to place. Maybe to keep in mind: I'm using a reponsive design, which means those blocks can be vertical and horizontal after scaling the window. Any redevisions on the fiddle or suggustions would be great!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >