Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 717/776 | < Previous Page | 713 714 715 716 717 718 719 720 721 722 723 724  | Next Page >

  • Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Abnormally disconnected TCP sockets and write timeout

    - by James
    Hello I will try to explain the problem in shortest possible words. I am using c++ builder 2010. I am using TIdTCPServer and sending voice packets to a list of connected clients. Everything works ok untill any client is disconnected abnormally, For example power failure etc. I can reproduce similar disconnect by cutting the ethernet connection of a connected client. So now we have a disconnected socket but as you know it is not yet detected at server side so server will continue to try to send data to that client too. But when server try to write data to that disconnected client ...... Write() or WriteLn() HANGS there in trying to write, It is like it is wating for somekind of Write timeout. This hangs the hole packet distribution process as a result creating a lag in data transmission to all other clients. After few seconds "Socket Connection Closed" Exception is raised and data flow continues. Here is the code try { EnterCriticalSection(&SlotListenersCriticalSection); for(int i=0;i<SlotListeners->Count;i++) { try { //Here the process will HANG for several seconds on a disconnected socket ((TIdContext*) SlotListeners->Objects[i])->Connection->IOHandler->WriteLn("Some DATA"); }catch(Exception &e) { SlotListeners->Delete(i); } } }__finally { LeaveCriticalSection(&SlotListenersCriticalSection); } Ok i already have a keep alive mechanism which disconnect the socket after n seconds of inactivity. But as you can imagine, still this mechnism cant sync exactly with this braodcasting loop because this braodcasting loop is running almost all the time. So is there any Write timeouts i can specify may be through iohandler or something ? I have seen many many threads about "Detecting disconnected tcp socket" but my problem is little different, i need to avoid that hangup for few seconds during the write attempt. So is there any solution ? Or should i consider using some different mechanism for such data broadcasting for example the broadcasting loop put the data packet in some kind of FIFO buffer and client threads continuously check for available data and pick and deliver it to themselves ? This way if one thread hangs it will not stop/delay the over all distribution thread. Any ideas please ? Thanks for your time and help. Regards Jams

    Read the article

  • PHP Session Class and $_SESSION Array

    - by Gianluca Bargelli
    Hello, i've implemented this custom PHP Session Class for storing sessions into a MySQL database: class Session { private $_session; public $maxTime; private $database; public function __construct(mysqli $database) { $this->database=$database; $this->maxTime['access'] = time(); $this->maxTime['gc'] = get_cfg_var('session.gc_maxlifetime'); session_set_save_handler(array($this,'_open'), array($this,'_close'), array($this,'_read'), array($this,'_write'), array($this,'_destroy'), array($this,'_clean') ); register_shutdown_function('session_write_close'); session_start();//SESSION START } public function _open() { return true; } public function _close() { $this->_clean($this->maxTime['gc']); } public function _read($id) { $getData= $this->database->prepare("SELECT data FROM Sessions AS Session WHERE Session.id = ?"); $getData->bind_param('s',$id); $getData->execute(); $allData= $getData->fetch(); $totalData = count($allData); $hasData=(bool) $totalData >=1; return $hasData ? $allData['data'] : ''; } public function _write($id, $data) { $getData = $this->database->prepare("REPLACE INTO Sessions VALUES (?, ?, ?)"); $getData->bind_param('sss', $id, $this->maxTime['access'], $data); return $getData->execute(); } public function _destroy($id) { $getData=$this->database->prepare("DELETE FROM Sessions WHERE id = ?"); $getData->bind_param('S', $id); return $getData->execute(); } public function _clean($max) { $old=($this->maxTime['access'] - $max); $getData = $this->database->prepare("DELETE FROM Sessions WHERE access < ?"); $getData->bind_param('s', $old); return $getData->execute(); } } It works well but i don't really know how to properly access the $_SESSION array: For example: $db=new DBClass();//This is a custom database class $session=new Session($db->getConnection()); if (isset($_SESSION['user'])) { echo($_SESSION['user']);//THIS IS NEVER EXECUTED! } else { $_SESSION['user']="test"; Echo("Session created!"); } At every page refresh it seems that $_SESSION['user'] is somehow "resetted", what methods can i apply to prevent such behaviour?

    Read the article

  • c# event fires windows form incorrectly

    - by MikeW
    I'm trying to understand what's happening here. I have a CheckedListBox which contains some ticked and some un-ticked items. I'm trying to find a way of determining the delta in the selection of controls. I've tried some cumbersome like this - but only works part of the time, I'm sure there's a more elegant solution. A maybe related problem is the myCheckBox_ItemCheck event fires on form load - before I have a chance to perform an ItemCheck. Here's what I have so far: void clbProgs_ItemCheck(object sender, ItemCheckEventArgs e) { // i know its awful System.Windows.Forms.CheckedListBox cb = (System.Windows.Forms.CheckedListBox)sender; string sCurrent = e.CurrentValue.ToString(); int sIndex = e.Index; AbstractLink lk = (AbstractLink)cb.Items[sIndex]; List<ILink> _links = clbProgs.DataSource as List<ILink>; foreach (AbstractLink lkCurrent in _links) { if (!lkCurrent.IsActive) { if (!_groupValues.ContainsKey(lkCurrent.Linkid)) { _groupValues.Add(lkCurrent.Linkid, lkCurrent); } } } if (_groupValues.ContainsKey(lk.Linkid)) { AbstractLink lkDirty = (AbstractLink)lk.Clone(); CheckState newValue = (CheckState)e.NewValue; if (newValue == CheckState.Checked) { lkDirty.IsActive = true; } else if (newValue == CheckState.Unchecked) { lkDirty.IsActive = false; } if (_dirtyGroups.ContainsKey(lk.Linkid)) { _dirtyGroups[lk.Linkid] = lkDirty; } else { CheckState oldValue = (CheckState)e.NewValue; if (oldValue == CheckState.Checked) { lkDirty.IsActive = true; } else if (oldValue == CheckState.Unchecked) { lkDirty.IsActive = false; } _dirtyGroups.Add(lk.Linkid, lk); } } else { if (!lk.IsActive) { _dirtyGroups.Add(lk.Linkid, lk); } else { _groupValues.Add(lk.Linkid, lk); } } } Then onclick of a save button - I check whats changed before sending to database: private void btSave_Click(object sender, EventArgs e) { List<AbstractLink> originalList = new List<AbstractLink>(_groupValues.Values); List<AbstractLink> changedList = new List<AbstractLink>(_dirtyGroups.Values); IEnumerable<AbstractLink> dupes = originalList.ToArray<AbstractLink>().Intersect(changedList.ToArray<AbstractLink>()); foreach (ILink t in dupes) { MessageBox.Show("Changed"); } if (dupes.Count() == 0) { MessageBox.Show("No Change"); } } For further info. The definition of type AbstractLink uses: public bool Equals(ILink other) { if (Object.ReferenceEquals(other, null)) return false; if (Object.ReferenceEquals(this, other)) return true; return IsActive.Equals(other.IsActive) && Linkid.Equals(other.Linkid); }

    Read the article

  • mootools fx working except in ie9

    - by Craig
    This is my first attempt with Mootools, so I welcome a critique of the code. I have a dynamic list of images that expand on the 'click" event and contract on the 'mouseout' event. The code works fine in all browsers (FF, Safari, Chrome, even the smartphones) but not in IE9 (JS is enabled) Anyone with similar problem or solution? I plan to use a lightbox effect, downloading a larger & clearer image to the center of the page, instead of just resizing a small image. However, I am hesitant to attempt this, if there is problems with IE9. I have coded three image sizes with the upload commit, so the larger image is available for the lightbox, but, I don't see anything in mootools for a lightbox, or am I missing it? $i = 0; while($i < count($validate)) { <div class="validate"> <div class="validate_image_<?php echo $validate[$i]['validate_type']; ?>"> <div class="validate_image" id="validate_image_wrapper_<?php echo $i; ?>"> <?php if ($validate[$i]['validate_image_filename'] != '') { if (file_exists(UPLOAD_DIR . 'validate_image/' . str_replace('.', '_medium.', $validate[$i]['validate_image_filename']))) { echo '<img src="' . UPLOAD_URL . 'validate_image/' . str_replace('.', '_medium.', $validate[$i]['validate_image_filename']) . '" alt="Listing Image" />'; } else { echo '<img src="' . UPLOAD_URL . 'validate_image/' . str_replace('.', '_large.', $validate[$i]['validate_image_filename']) . '" alt="Listing image" />'; } } else { ?> <img src="/images/no_image_posted_validate.png" alt="no image posted" /> <?php } ?> </div> ... remainder of HTML display code function setupEnlargeImage() { window.myFx = new Fx({ duration: 200, transition: Fx.Transitions.Sine.easeOut }); $$('.validate_image').addEvent('click', function() { window.selectedImage = this.id; myFx.start(1,2.0); }); $$('.validate_image').addEvent('mouseout', function() { window.selectedImage = this.id; myFx.start(1.0,1); }); myFx.set = function(value) { var style = "scale(" + (value) + ")"; $(window.selectedImage).setStyles({ "-webkit-transform": style, "-moz-transform": style, "-o-transform": style, "-ms-transform": style, transform: style }); } }

    Read the article

  • Converting Multiple files to zip and saving them in ownCloud

    - by user1055380
    I wanted to convert an array with some css, js and html files into a zip file and save them in ownCloud (it has it's own framework but it's knowledge is not required.) What I am saving is an infinite loop of zip files, as in, a zip inside a zip so I can't even check that the code is working correctly or not. Please help. Here is the link to the code. <?php /* creates a compressed zip file */ $filename = $_GET["filename"]; function create_zip($files = array(),$destination = '',$overwrite = false) { //if the zip file already exists and overwrite is false, return false if(file_exists($destination) && !$overwrite) { return false; } //vars $valid_files = array(); //if files were passed in... if(is_array($files)) { //cycle through each file foreach($files as $file => $local) { //make sure the file exists if(file_exists($file)) { $valid_files[$file] = $local; } } } //if we have good files... if(count($valid_files)) { //create the archive $zip = new ZipArchive(); if($zip->open($destination,$overwrite ? ZIPARCHIVE::OVERWRITE : ZIPARCHIVE::CREATE) !== true) { return false; } //add the files foreach($valid_files as $file => $local) { $zip->addFile($file, $local); } //debug //echo 'The zip archive contains ',$zip->numFiles,' files with a status of ',$zip->status; //close the zip -- done! $zip->close(); //check to make sure the file exists return file_exists($destination); } else { return false; } } $files_to_zip = array( 'apps/impressionist/css/mappingstyle.css' => '/css/mappingstyle.css', 'apps/impressionist/css/style.css' => '/css/style.css', 'apps/impressionist/js/jquery.js' => '/scripts/jquery.js', 'apps/impressionist/js/impress.js' => '/scripts/impress.js', realpath('apps/impressionist/output/'.$filename.'.html') => $filename.'.html' ); //if true, good; if false, zip creation failed $result = create_zip($files_to_zip, $filename.'.zip'); $save_file = OC_App::getStorage('impressionist'); $save_file ->file_put_contents($filename.'.zip',$files_to_zip); ?>

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • What is the best practice to segment c#.net projects based on a single base project

    - by Anthony
    Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

    Read the article

  • Windows phone app xaml error

    - by thewarri0r9
    i am developing an app for windows phone 8 and i stuck on this code which visual studio showing invalid xaml. But Code compiles and works well. Invalid xaml Code is : <DataTemplate x:Key="AddrBookItemTemplate"> <StackPanel Margin="0,0,0,2" Orientation="Horizontal"> <StackPanel Width="80" Orientation="Horizontal" Height="80"> <Ellipse Margin="0" Height="70" Width="70" HorizontalAlignment="Left" Stroke="{x:Null}"> <Ellipse.Fill> <ImageBrush Stretch="Fill" ImageSource="{Binding imageBytes, Converter={StaticResource BytesToImageConverter}}"/> </Ellipse.Fill> </Ellipse> </StackPanel> <StackPanel Height="80" Margin="0" Width="380" HorizontalAlignment="Left"> <TextBlock FontWeight="Bold" Text="{Binding FirstName}" FontFamily="Segoe WP Semibold" FontSize="30" VerticalAlignment="Top" Margin="5,0,0,0" HorizontalAlignment="Left" /> <TextBlock Text="{Binding Phone}" FontFamily="Segoe WP" FontSize="24" Foreground="{StaticResource PhoneTextBoxReadOnlyBrush}" Margin="5,0,0,-12" Width="320" HorizontalAlignment="Left" VerticalAlignment="Top"/> </StackPanel> </StackPanel> </DataTemplate> I am serializing image by converting it to byte, it works fine but if image is null it gives an error. code behind: if (e.Results != null) { List<AddressBook> source = new List<AddressBook>(); foreach (var result in e.Results) { if (result.PhoneNumbers.FirstOrDefault() != null && result.GetPicture()!=null) { BitmapImage bmp = new BitmapImage(); BitmapImage nullbmp = new BitmapImage(); if (result.GetPicture() == null) { bmp.UriSource = new Uri(@"/Images/ci2.png", UriKind.RelativeOrAbsolute); } else { bmp.SetSource(result.GetPicture()); } listobj.Add(new AddressBook() { FirstName = result.DisplayName != null ? result.DisplayName : "", imageBytes = AddressBook.imageConvert(bmp), EmailAddress = "", LastName = "", Phone = result.PhoneNumbers.FirstOrDefault() != null ? result.PhoneNumbers.FirstOrDefault().PhoneNumber : "", }); } } Above code show an error "object reference not set to instance of an object". I want to show the default image (or color) in ellipse when image is null.What should I do?

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • [Reloaded] Error while sorting filtered data from a GridView

    - by Bogdan M
    Hello guys, I have an error I cannot solve, on a ASP.NET website. One of its pages - Countries.aspx, has the following controls: a CheckBox called "CheckBoxNAME": < asp:CheckBox ID="CheckBoxNAME" runat="server" Text="Name" /> a TextBox called "TextBoxName": < asp:TextBox ID="TextBoxNAME" runat="server" Width="100%" Wrap="False"> < /asp:TextBox> a SQLDataSource called "SqlDataSourceCOUNTRIES", that selects all records from a Table with 3 columns - ID (Number, PK), NAME (Varchar2(1000)), and POPULATION (Number) called COUNTRIES < asp:SqlDataSource ID="SqlDataSourceCOUNTRIES" runat="server" ConnectionString="< %$ ConnectionStrings:myDB %> " ProviderName="< %$ ConnectionStrings:myDB.ProviderName %> " SelectCommand="SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES ORDER BY COUNTRIES.NAME, COUNTRIES.ID"> < /asp:SqlDataSource> a GridView called GridViewCOUNTRIES: < asp:GridView ID="GridViewCOUNTRIES" runat="server" AllowPaging="True" AllowSorting="True" AutoGenerateColumns="False" DataSourceID="SqlDataSourceCOUNTRIES" DataKeyNames="ID" DataMember="DefaultView"> < Columns> < asp:CommandField ShowSelectButton="True" /> < asp:BoundField DataField="ID" HeaderText="Id" SortExpression="ID" /> < asp:BoundField DataField="NAME" HeaderText="Name" SortExpression="NAME" /> < asp:BoundField DataField="POPULATION" HeaderText="Population" SortExpression="POPULATION" /> < /Columns> < /asp:GridView> a Button called ButtonFilter: < asp:Button ID="ButtonFilter" runat="server" Text="Filter" onclick="ButtonFilter_Click"/> This is the onclick event: protected void ButtonFilter_Click(object sender, EventArgs e) { Response.Redirect("Countries.aspx?" + (this.CheckBoxNAME.Checked ? string.Format("NAME={0}", this.TextBoxNAME.Text) : string.Empty)); } Also, this is the main onload event of the page: protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack == false) { if (Request.QueryString.Count != 0) { Dictionary parameters = new Dictionary(); string commandTextFormat = string.Empty; if (Request.QueryString["NAME"] != null) { if (commandTextFormat != string.Empty && commandTextFormat.EndsWith("AND") == false) { commandTextFormat += "AND"; } commandTextFormat += " (UPPER(COUNTRIES.NAME) LIKE '%' || :NAME || '%') "; parameters.Add("NAME", Request.QueryString["NAME"].ToString()); } this.SqlDataSourceCOUNTRIES.SelectCommand = string.Format("SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES WHERE {0} ORDER BY COUNTRIES.NAME, COUNTRIES.ID", commandTextFormat); foreach (KeyValuePair parameter in parameters) { this.SqlDataSourceCOUNTRIES.SelectParameters.Add(parameter.Key, parameter.Value.ToUpper()); } } } } Basicly, the page displays in the GridViewCOUNTRIES all the records of table COUNTRIES. The scenario is the following: - the user checks the CheckBox; - the user types a value in the TextBox (let's say "ch"); - the user presses the Button; - the page loads displaying only the records that match the filter criteria (in this case, all the countries that have names containing "Ch"); - the user clicks on the header of the column called "Name" in order to sort the data in the GridView Then, I get the following error: ORA-01036: illegal variable name/number. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.OracleClient.OracleException: ORA-01036: illegal variable name/number Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Any help is greatly appreciated, tnks. PS: I'm using ASP.NET 3.5, under Visual Studio 2008, with an OracleXE database.

    Read the article

  • Spring's JdbcDaoSupport (using MySQL Connector/J) fails after executing sql that adds FK

    - by John
    I am using Spring's JdbcDaoSupport class with a DriverManagerDataSource using the MySQL Connector/J 5.0 driver (driverClassName=com.mysql.jdbc.driver). allowMultiQueries is set to true in the url. My application is an in-house tool we recently developed that executes sql scripts in a directory one-by-one (allows us to re-create our schema and reference table data for a given date, etc, but I digress). The sql scripts sometime contain multiple statements (hence allowMultiQueries), so one script can create a table, add indexes for that table, etc. The problem happens when including a statement to add a foreign key constraint in one of these files. If I have a file that looks like... --(column/constraint names are examples) CREATE TABLE myTable ( fk1 BIGINT(19) NOT NULL, fk2 BIGINT(19) NOT NULL, PRIMARY KEY (fk1, fk2) ); ALTER TABLE myTable ADD CONSTRAINT myTable_fk1 FOREIGN KEY (fk1) REFERENCES myOtherTable (id) ; ALTER TABLE myTable ADD CONSTRAINT myTable_fk2 FOREIGN KEY (fk2) REFERENCES myOtherOtherTable (id) ; then JdbcTemplate.execute throws an UncategorizedSqlException with the following error message and stack trace: Exception in thread "main" org.springframework.jdbc.UncategorizedSQLException: StatementCallback; uncategorized SQLException for SQL [ THE SQL YOU SEE ABOVE LISTED HERE ]; SQL state [HY000]; error code [1005]; Can't create table 'myDatabase.myTable' (errno: 150); nested exception is java.sql.SQLException: Can't create table 'myDatabase.myTable' (errno: 150) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:83) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) and the table and foreign keys are not inserted. Also, especially weird: if I take the foreign key statements out of the script I showed above and then place them in their own script that executes after (so I now have 1 script with just the create table statement, and 1 script with the add foreign key statements that executes after that) then what happens is: tool executes create table script, works fine, table is created tool executes add fk script, throws the same exception as seen above (except errno=121 this time), but the FKs actually get added (!!!) In other words, when the create table/FK statements are in the same script then the exception is thrown and nothing is created, but when they are different scripts a nearly identical exception is thrown but both things get created. Any help on this would be greatly appreciated. Please let me know if you'd like me to clarify anything more.

    Read the article

  • Unset/Change Binding in WPF

    - by captcalamares
    How can I unset the binding applied to an object so that I can apply another binding to it from a different location? Suppose I have two data templates binded to the same object reference. Data Template #1 is the default template to be loaded. I try to bind a button command to a Function1 from my DataContext class: <Button Content="Button 1" CommandParameter="{Binding }" Command="{Binding DataContext.Function1, RelativeSource={RelativeSource AncestorType={x:Type Window}}}"/> This actually works and the function gets binded. However, when I try to load Data Template # 2 to the same object (while trying to bind another button command to a different function (Function2) from my DataContext class): <Button Content="Button 2" CommandParameter="{Binding }" Command="{Binding DataContext.Function2, RelativeSource={RelativeSource AncestorType={x:Type Window}}}" /> It doesn't work and the first binding is still the one executed. Is there a workaround to this? EDIT (for better problem context): I defined my templates in my Window.Resources: <Window.Resources> <DataTemplate DataType="{x:Type local:ViewModel1}"> <local:View1 /> </DataTemplate> <DataTemplate DataType="{x:Type local:ViewModel2}"> <local:View2 /> </DataTemplate> </Window.Resources> The View1.xaml and the View2.xaml contain the button definitions that I described above (I want them to command the control of my process flow). ViewModel1 and ViewModel2 are my ViewModels that implement the interface IPageViewModel which is the type of my variable CurrentPageViewModel. In my XAML, I binded ContentControl to the variable CurrentPageViewModel: <ContentControl Content="{Binding CurrentPageViewModel}" HorizontalAlignment="Center"/> In my .CS, I have a list defined as List<IPageViewModel> PageViewModels, which I use to contain the instances of my two View Models: PageViewModels.Add(new ViewModel1()); PageViewModels.Add(new ViewModel2()); // Set starting page CurrentPageViewModel = PageViewModels[0]; When I try to change my CurrentPageViewModel to the other view model, this is when I want the new binding to work. Unfortunately, it doesn't. Am I doing things the right way?

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Java: Combination of recursive loops which has different FOR loop inside; Output: FOR loops indexes

    - by vvinjj
    currently recursion is fresh & difficult topic for me, however I need to use it in one of my algorithms. Here is the challenge: I need a method where I specify number of recursions (number of nested FOR loops) and number of iterations for each FOR loop. The result should show me, something simmilar to counter, however each column of counter is limited to specific number. ArrayList<Integer> specs= new ArrayList<Integer>(); specs.add(5); //for(int i=0 to 5; i++) specs.add(7); specs.add(9); specs.add(2); specs.add(8); specs.add(9); public void recursion(ArrayList<Integer> specs){ //number of nested loops will be equal to: specs.size(); //each item in specs, specifies the For loop max count e.g: //First outside loop will be: for(int i=0; i< specs.get(0); i++) //Second loop inside will be: for(int i=0; i< specs.get(1); i++) //... } The the results will be similar to outputs of this manual, nested loop: int[] i; i = new int[7]; for( i[6]=0; i[6]<5; i[6]++){ for( i[5]=0; i[5]<7; i[5]++){ for(i[4] =0; i[4]<9; i[4]++){ for(i[3] =0; i[3]<2; i[3]++){ for(i[2] =0; i[2]<8; i[2]++){ for(i[1] =0; i[1]<9; i[1]++){ //... System.out.println(i[1]+" "+i[2]+" "+i[3]+" "+i[4]+" "+i[5]+" "+i[6]); } } } } } } I already, killed 3 days on this, and still no results, was searching it in internet, however the examples are too different. Therefore, posting the programming question in internet first time in my life. Thank you in advance, you are free to change the code efficiency, I just need the same results.

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Does my TPL partitioner cause a deadlock?

    - by Scott Chamberlain
    I am starting to write my first parallel applications. This partitioner will enumerate over a IDataReader pulling chunkSize records at a time from the data-source. protected class DataSourcePartitioner<object[]> : System.Collections.Concurrent.Partitioner<object[]> { private readonly System.Data.IDataReader _Input; private readonly int _ChunkSize; public DataSourcePartitioner(System.Data.IDataReader input, int chunkSize = 10000) : base() { if (chunkSize < 1) throw new ArgumentOutOfRangeException("chunkSize"); _Input = input; _ChunkSize = chunkSize; } public override bool SupportsDynamicPartitions { get { return true; } } public override IList<IEnumerator<object[]>> GetPartitions(int partitionCount) { var dynamicPartitions = GetDynamicPartitions(); var partitions = new IEnumerator<object[]>[partitionCount]; for (int i = 0; i < partitionCount; i++) { partitions[i] = dynamicPartitions.GetEnumerator(); } return partitions; } public override IEnumerable<object[]> GetDynamicPartitions() { return new ListDynamicPartitions(_Input, _ChunkSize); } private class ListDynamicPartitions : IEnumerable<object[]> { private System.Data.IDataReader _Input; int _ChunkSize; private object _ChunkLock = new object(); public ListDynamicPartitions(System.Data.IDataReader input, int chunkSize) { _Input = input; _ChunkSize = chunkSize; } public IEnumerator<object[]> GetEnumerator() { while (true) { List<object[]> chunk = new List<object[]>(_ChunkSize); lock(_Input) { for (int i = 0; i < _ChunkSize; ++i) { if (!_Input.Read()) break; var values = new object[_Input.FieldCount]; _Input.GetValues(values); chunk.Add(values); } if (chunk.Count == 0) yield break; } var chunkEnumerator = chunk.GetEnumerator(); lock(_ChunkLock) //Will this cause a deadlock? { while (chunkEnumerator.MoveNext()) { yield return chunkEnumerator.Current; } } } } IEnumerator IEnumerable.GetEnumerator() { return ((IEnumerable<object[]>)this).GetEnumerator(); } } } I wanted IEnumerable object it passed back to be thread safe (the .Net example was so I am assuming PLINQ and TPL could need it) will the lock on _ChunkLock near the bottom help provide thread safety or will it cause a deadlock? From the documentation I could not tell if the lock would be released on the yeld return. Also if there is built in functionality to .net that will do what I am trying to do I would much rather use that. And if you find any other problems with the code I would appreciate it.

    Read the article

  • initializing a vector of custom class in c++

    - by Flamewires
    Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

    Read the article

  • Trying to implement a method that can compare any two lists but it always returns false

    - by Tyler Pfaff
    Hello like the title says I'm trying to make a method that can compare any two lists for equality. I'm trying to compare them in a way that validates that every element of one list has the same value as every element of another list. My Equals method below always returns false, can anyone see why that is? Thank you! using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Threading.Tasks; public class IEnumerableComparer<T> : IEqualityComparer<IEnumerable<T>> { public bool Equals(IEnumerable<T> x, IEnumerable<T> y) { for(int i = 0; i<x.Count();i++){ if(!Object.Equals(x.ElementAt(i), y.ElementAt(i))){ return false; } } return true; } public int GetHashCode(IEnumerable<T> obj) { if (obj == null) return 0; return unchecked(obj.Select(e => e.GetHashCode()).Aggregate(0, (a, b) => a + b)); } } Here is my data I'm using to test this Equals method. static void Main(string[] args) { Car car1 = new Car(); car1.make = "Toyota"; car1.model = "xB"; Car car2 = new Car(); car2.make = "Toyota"; car2.model = "xB"; List<Car> l1 = new List<Car>(); List<Car> l2 = new List<Car>(); l1.Add(car1); l2.Add(car2); IEnumerableComparer<Car> seq = new IEnumerableComparer<Car>(); bool b = seq.Equals(l1, l2); Console.Write(b); //always says false Console.Read(); } } Car class class Car { public String make { get; set; } public String model { get; set; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 713 714 715 716 717 718 719 720 721 722 723 724  | Next Page >