Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 717/776 | < Previous Page | 713 714 715 716 717 718 719 720 721 722 723 724  | Next Page >

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • [C#] Problems with implementing generic IEnumerator and IComparable

    - by r0h
    Hi all! I'm working on an AVL Tree. The tree itself seems to be working but I need a iterator to walk through the values of the tree. Therefore I tried to implement the IEnumerator interace. Unfortunately I get a compile time error implementing IEnumerator and IComparable. First the code and below that the error. class AvlTreePreOrderEnumerator<T> : IEnumerator<T> where T :IComparable<T> { private AvlTreeNode<T> current = default(T); private AvlTreeNode<T> tree = null; private Queue<AvlTreeNode<T>> traverseQueue = null; public AvlTreePreOrderEnumerator(AvlTreeNode<T> tree) { this.tree = tree; //Build queue traverseQueue = new Queue<AvlTreeNode<T>>(); visitNode(this.tree.Root); } private void visitNode(AvlTreeNode<T> node) { if (node == null) return; else { traverseQueue.Enqueue(node); visitNode(node.LeftChild); visitNode(node.RightChild); } } public T Current { get { return current.Value; } } object IEnumerator.Current { get { return Current; } } public void Dispose() { current = null; tree = null; } public void Reset() { current = null; } public bool MoveNext() { if (traverseQueue.Count > 0) current = traverseQueue.Dequeue(); else current = null; return (current != null); } } The error given by VS2008: Error 1 The type 'T' cannot be used as type parameter 'T' in the generic type or method 'Opdr2_AvlTreeTest_Final.AvlTreeNode'. There is no boxing conversion or type parameter conversion from 'T' to 'System.IComparable'. For now I've not included the tree and node logic. I anybody thinks is necessary to resolve this probleem, just say so! Thx!

    Read the article

  • using Object input\ output Streams with files and array list

    - by soad el-hayek
    hi every one .. i'm an it student , and it's time to finish my final project in java , i've faced too many problems , this one i couldn't solve it and i'm really ubset ! :S my code is like this : in Admin class : public ArrayList cos_info = new ArrayList(); public ArrayList cas_info = new ArrayList(); public int cos_count = 0 ; public int cas_count = 0 ; void coustmer_acount() throws FileNotFoundException, IOException{ String add=null; do{ person p = new person() ; cos_info.add(cos_count, p); cos_count ++ ; add =JOptionPane.showInputDialog("Do you want to add more coustmer..\n'y'foryes ..\n 'n'for No .."); } while(add.charAt(0) == 'Y'||add.charAt(0)=='y'); writenew_cos(); // add_acounts(); } void writenew_cos() throws IOException{ ObjectOutputStream aa = new ObjectOutputStream(new FileOutputStream("coustmer.txt")); aa.writeObject(cos_info); JOptionPane.showMessageDialog(null,"Added to file done sucessfuly.."); aa.close(); } in Coustmer class : void read_cos() throws IOException, ClassNotFoundException{ person p1= null ; int array_count = 0; ObjectInputStream d = new ObjectInputStream(new FileInputStrea ("coustmer.txt")); JOptionPane.showMessageDialog(null,d.available() ); for(int i = 0;d.available() == 0;i++){ a.add(array_count,(ArrayList) d.readObject()); array_count++; JOptionPane.showMessageDialog(null,"Haaaaai :D" ); JOptionPane.showMessageDialog(null,array_count ); } d.close(); JOptionPane.showMessageDialog(null,array_count +"1111" ); for(int i = 0 ; i<a.size()&& found!= true ; i++){ count++ ; p1 =(person)a.get(i); user=p1.user; pass = p1.pass; cas_checkpass(); } } it just print JOptionPane.showMessageDialog(null,d.available() ); and having excep. here a.add(array_count,(ArrayList) d.readObject()); p.s : person object from my own class and it's Serializabled

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • Embedded "Smart" character LCD driver. Is this a good idea?

    - by chris12892
    I have an embedded project that I am working on, and I am currently coding the character LCD driver. At the moment, the LCD driver only supports "dumb" writing. For example, let's say line 1 has some text on it, and I make a call to the function that writes to the line. The function will simply seek to the beginning of the line and write the text (plus enough whitespace to erase whatever was last written). This is well and good, but I get the feeling it is horribly inefficient sometimes, since some lines are simply: "Some-reading: some-Value" Rather than "brute force" replacing the entire line, I wanted to develop some code that would figure out the best way to update the information on the LCD. (just as background, it takes 2 bytes to seek to any char position. I can then begin writing the string) My idea was to first have a loop. This loop would compare the input to the last write, and in doing so, it would cover two things: A: Collect all the differences between the last write and the input. For every contiguous segment (be it same or different) add two bytes to the byte count. This is referenced in B to determine if we are wasting serial bandwidth. B: The loop would determine if this is really a smart thing to do. If we end up using more bytes to update the line than to "brute force" the line, then we should just return and let the brute force method take over. We should exit the smart write function as soon as this condition is met to avoid wasting time. The next part of the function would take all the differences, seek to the required char on the LCD, and write them. Thus, if we have a string like this already on the LCD: "Current Temp: 80F" and we want to update it to "Current Temp: 79F" The function will go through and see that it would take less bandwidth to simply seek to the "8" and write "79". The "7" will cover the "8" and the "9" will cover the "0". That way, we don't waste time writing out the entire string. Does this seem like a practical idea?

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • Flex/Air/AS3 Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Searching in Ruby on Rails - How do I search on each word entered and not the exact string?

    - by bgadoci
    I have built a blog application w/ ruby on rails and I am trying to implement a search feature. The blog application allows for users to tag posts. The tags are created in their own table and belong_to :post. When a tag is created, so is a record in the tag table where the name of the tag is tag_name and associated by post_id. Tags are strings. I am trying to allow a user to search for any word tag_name in any order. Here is what I mean. Lets say a particular post has a tag that is 'ruby code controller'. In my current search feature, that tag will be found if the user searches for 'ruby', 'ruby code', or 'ruby code controller'. It will not be found if the user types in 'ruby controller'. Essentially what I am saying is that I would like each word entered in the search to be searched for, not necessarily the 'string' that is entered into the search. I have been experimenting with providing multiple textfields to allow the user to type in multiple words, and also have been playing around with the code below, but can't seem to accomplish the above. I am new to ruby and rails so sorry if this is an obvious question and prior to installing a gem or plugin I thought I would check to see if there was a simple fix. Here is my code: View: /views/tags/index.html.erb <% form_tag tags_path, :method => 'get' do %> <p> <%= text_field_tag :search, params[:search], :class => "textfield-search" %> <%= submit_tag "Search", :name => nil, :class => "search-button" %> </p> <% end %> TagsController def index @tags = Tag.search(params[:search]).paginate :page => params[:page], :per_page => 5 @tagsearch = Tag.search(params[:search]) @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 100) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @tags } end end Tag Model class Tag < ActiveRecord::Base belongs_to :post validates_length_of :tag_name, :maximum=>42 validates_presence_of :tag_name def self.search(search) if search find(:all, :order => "created_at DESC", :conditions => ['tag_name LIKE ?', "%#{search}%"]) else find(:all, :order => "created_at DESC") end end end

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • Loading images to UIScrollview crashes

    - by Icky
    Hello All. I have a Navigationcontroller pushing a UIViewController with a scrollview inside. Within the scrollview I download a certain number of images around 20 (sometimes more) each sized around 150 KB. All these images are added to the scrollview so that their origin is x +imageSize and the following is sorted right to the one before. All in all I think its a lot of data (3-4 MB). On an I pod Touch this sometimes crashes, the IPhone can handle it once, if it has to load the data again (some other images) , it crashes too. I guess its a memory issue but within my code, I download the image, save it to a file on the phone as NSData, read it again from file and add it to a UIImageview which I release. So I have freed the memory I allocated, nevertheless it still crashes. Can anyone help me out? Since Im new to this, I dont know the best way to handle the Images in a scrollview. Besides I create the controller at start from nib, which means I dont have to release it, since I dont use alloc - right? Code: In my rootviewcontroller I do: -(void) showImages { [[self naviController] pushViewController:imagesViewController animated:YES]; [imagesViewController viewWillAppear:YES]; } Then in my Controller handling the scroll View, this is the method to load the images: - (void) loadOldImageData { for (int i = 0; i < 40 ; i++) { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectory stringByAppendingPathComponent:[NSString stringWithFormat:@"img%d.jpg", i]]; NSData *myImg = [NSData dataWithContentsOfFile:filePath]; UIImage *im = [UIImage imageWithData:myImg]; if([im isKindOfClass:[UIImage class]]) { NSLog(@"IM EXISTS"); UIImageView *imgView = [[UIImageView alloc] initWithImage:im]; CGRect frame = CGRectMake(i*320, 0, 320, 416); imgView.frame = frame; [myScrollView addSubview:imgView]; [imgView release]; //NSLog(@"Adding img %d", i); numberImages = i; NSLog(@"setting numberofimages to %d", numberImages); //NSLog(@"scroll subviews %d", [myScrollView.subviews count]); } } myScrollView.contentSize = CGSizeMake(320 * (numberImages + 1), 416); }

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

  • SQL Native Client 10 Performance miserable (due to server-side cursors)

    - by namezero
    we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • How to Convert arrays or SimpleXML-Objects into an XML-String

    - by streetparade
    I want to create a xml from a given string, i have a function but i didn't wrote it.It seems a bit cryptical too. Can please some one review it and give me some Ideas, how it could be written clearer for everybody? /** * Converts arrays or SimpleXML-Objects into an XML-String * @params mixed Accepts an array or xml string with data to Post * @params integer DO NOT PROVIDE. Internal Usage for recursion only */ private function mixedDataToXML($data, $level = 1) { if(!$data){ return FALSE; } if(is_array($data)) { $xml = ''; if ($level==1) { $xml .= '<?xml version="1.0" encoding="ISO-8859-1"?>'."\n"; } foreach ($data as $key => $value) { $key = strtolower($key); if (is_array($value)) { $multi_tags = false; foreach($value as $key2=>$value2) { if (is_array($value2)) { $xml .= str_repeat("\t",$level)."<$key>\n"; $xml .= $this->mixedDataToXML($value2, $level+1); $xml .= str_repeat("\t",$level)."</$key>\n"; $multi_tags = true; } else { if (trim($value2)!='') { if (htmlspecialchars($value2)!=$value2) { $xml .= str_repeat("\t",$level). "<$key><![CDATA[$value2]]>". "</$key>\n"; } else { $xml .= str_repeat("\t",$level). "<$key>$value2</$key>\n"; } } $multi_tags = true; } } if (!$multi_tags and count($value)>0) { $xml .= str_repeat("\t",$level)."<$key>\n"; $xml .= $this->mixedDataToXML($value, $level+1); $xml .= str_repeat("\t",$level)."</$key>\n"; } } else { if (trim($value)!='') { if (htmlspecialchars($value)!=$value) { $xml .= str_repeat("\t",$level)."<$key>". "<![CDATA[$value]]></$key>\n"; } else { $xml .= str_repeat("\t",$level). "<$key>$value</$key>\n"; } } } } return $xml; }else{ return (string)$data; } }

    Read the article

  • initializing a vector of custom class in c++

    - by Flamewires
    Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • c# event fires windows form incorrectly

    - by MikeW
    I'm trying to understand what's happening here. I have a CheckedListBox which contains some ticked and some un-ticked items. I'm trying to find a way of determining the delta in the selection of controls. I've tried some cumbersome like this - but only works part of the time, I'm sure there's a more elegant solution. A maybe related problem is the myCheckBox_ItemCheck event fires on form load - before I have a chance to perform an ItemCheck. Here's what I have so far: void clbProgs_ItemCheck(object sender, ItemCheckEventArgs e) { // i know its awful System.Windows.Forms.CheckedListBox cb = (System.Windows.Forms.CheckedListBox)sender; string sCurrent = e.CurrentValue.ToString(); int sIndex = e.Index; AbstractLink lk = (AbstractLink)cb.Items[sIndex]; List<ILink> _links = clbProgs.DataSource as List<ILink>; foreach (AbstractLink lkCurrent in _links) { if (!lkCurrent.IsActive) { if (!_groupValues.ContainsKey(lkCurrent.Linkid)) { _groupValues.Add(lkCurrent.Linkid, lkCurrent); } } } if (_groupValues.ContainsKey(lk.Linkid)) { AbstractLink lkDirty = (AbstractLink)lk.Clone(); CheckState newValue = (CheckState)e.NewValue; if (newValue == CheckState.Checked) { lkDirty.IsActive = true; } else if (newValue == CheckState.Unchecked) { lkDirty.IsActive = false; } if (_dirtyGroups.ContainsKey(lk.Linkid)) { _dirtyGroups[lk.Linkid] = lkDirty; } else { CheckState oldValue = (CheckState)e.NewValue; if (oldValue == CheckState.Checked) { lkDirty.IsActive = true; } else if (oldValue == CheckState.Unchecked) { lkDirty.IsActive = false; } _dirtyGroups.Add(lk.Linkid, lk); } } else { if (!lk.IsActive) { _dirtyGroups.Add(lk.Linkid, lk); } else { _groupValues.Add(lk.Linkid, lk); } } } Then onclick of a save button - I check whats changed before sending to database: private void btSave_Click(object sender, EventArgs e) { List<AbstractLink> originalList = new List<AbstractLink>(_groupValues.Values); List<AbstractLink> changedList = new List<AbstractLink>(_dirtyGroups.Values); IEnumerable<AbstractLink> dupes = originalList.ToArray<AbstractLink>().Intersect(changedList.ToArray<AbstractLink>()); foreach (ILink t in dupes) { MessageBox.Show("Changed"); } if (dupes.Count() == 0) { MessageBox.Show("No Change"); } } For further info. The definition of type AbstractLink uses: public bool Equals(ILink other) { if (Object.ReferenceEquals(other, null)) return false; if (Object.ReferenceEquals(this, other)) return true; return IsActive.Equals(other.IsActive) && Linkid.Equals(other.Linkid); }

    Read the article

  • Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

    - by McKev
    I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

    Read the article

  • Spring.Net Message Selectors with compound statements don't seem to be working

    - by Jonathan Beerhalter
    I'm using Spring.NET to connect to ActiveMQ and do some fairly simple pub sub routing. Everything works fine when my selector is a simple expression like Car='Honda' but if I try a compound expression like Car='Honda' AND Make='Pilot' I never get any matches on my subscription. Here's the code to generate the subscription, does anyone see where I might be doing something wrong? public bool AddSubscription(string topicName, Dictionary<string,string> selectorList, GDException exp) { try { ActiveMQTopic topic = new ActiveMQTopic(topicName); string selectorString = ""; if (selectorList.Keys.Count == 0) { // Select all items for this topic selectorString = "2>1"; } else { foreach (string key in selectorList.Keys) { selectorString += key + " = '" + selectorList[key] + "'" + " AND "; } selectorString = selectorString.Remove(selectorString.Length - 5, 5); } IMessageConsumer consumer = this._subSession.CreateConsumer(topic, selectorString, false); if (consumer != null) { _consumers.Add(consumer); consumer.Listener += new MessageListener(HandleRecieveMessage); return true; } else { exp.SetValues("Error adding subscription, null consumer returned"); return false; } } catch (Exception ex) { exp.SetValues(ex); return false; } } And then the code to send the message, which seems simple enough to me public void SendMessage(GDPubSubMessage messageToSend) { if (!this.isDisposed) { if (_producers.ContainsKey(messageToSend.Topic)) { IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage, false, (byte)255, TimeSpan.FromSeconds(1)); } else { ActiveMQTopic topic = new ActiveMQTopic(messageToSend.Topic); _producers.Add(messageToSend.Topic, this._pubSession.CreateProducer(topic)); IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage); } } else { throw new ObjectDisposedException(this.GetType().FullName); } } 07/102009: Update Ok, found the problem bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); This justs sets a single property, so my messages are only being tagged with a single property, hence the combo subscription never gets hit. Anyone know how to add more properties? You'd think bytesMessage.Properties would have a Add method, but it doesn't.

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

< Previous Page | 713 714 715 716 717 718 719 720 721 722 723 724  | Next Page >