Search Results

Search found 2551 results on 103 pages for 'sequence'.

Page 72/103 | < Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >

  • Trouble converting string/character to byte in lisp

    - by WanderingPhd
    I've some data that I'm reading in using read-line and I want to convert it into a byte-array. babel:string-to-octet works for the most part except when the character\byte is larger (above 200) in which case it returns two numbers. As an example, if the character is ú using babel:string-to-octet returns (195 185) instead of 250 which is what I'm looking for. I tried a number of encodings in babel but none of them seem to work. If I use read-byte or read-sequence it does read in 250. But for reasons of backward compatibility, I'm left with using read-line and I would like to know if there is something I'm missing when using babel:string-to-octet to convert ú to 250. I'm using ccl 1.8 btw.

    Read the article

  • cleartool question

    - by chuanose
    Lets say I have a directory at \testfolder, and the latest is currently at /main/10. I know that the operation resulting in testfolder@@/main/6 is to remove a file named test.txt. What's a sequence of cleartool operations that can be done in a script that will take "testfolder@@/main/6" and "test.txt" as input, and will cat out the contents of test.txt as of that time? One way I can think of is to get the time of /main/6 operation, create a view with config spec -time set to that time, and then cat the test.txt at the directory. But I'm wondering if I can do this in a easier way that doesn't involve manipulating config specs, perhaps through "cleartool find" and extended path names

    Read the article

  • How do I read UTF-8 characters via a pointer?

    - by Jen
    Suppose I have UTF-8 content stored in memory, how do I read the characters using a pointer? I presume I need to watch for the 8th bit indicating a multi-byte character, but how exactly do I turn the sequence into a valid Unicode character? Also, is wchar_t the proper type to store a single Unicode character? This is what I have in mind: wchar_t readNextChar (char** p) { char ch = *p++; if (ch & 128) { // This is a multi-byte character, what do I do now? // char chNext = *p++; // ... but how do I assemble the Unicode character? ... } ... }

    Read the article

  • some thing wrong with memory?

    - by Rocker
    Hi there I am developing a game using Cocos2D. I got some error out of sudden after few time successfully played the game. And When i debugged it gives the error called EXC_BAD_ACCESS. here is the code. -(void) winGame { //the debug stopped here... WinningScene *winner = [WinningScene node]; [[Director sharedDirector] replaceScene:[FadeTransition transitionWithDuration:1.0 scene:winner]]; } if ((touchCount > 0 && touchCount ==2) && (rangeY2 > 0.0 && rangeY2 < 20.0)) { bras++; if (bras == 1) { //[self winGame]; [self runAction:[Sequence actionOne:[DelayTime actionWithDuration:0.5] two: [CallFunc actionWithTarget:self selector:@selector(winGame)]]]; } Could u guys tell me why ?

    Read the article

  • How to dispatch a multimethod on the type of an array

    - by Arthur Ulfeldt
    I'm working on a multimethod that needs to update a hash for a bunch of different things in a sequence. Looked fairly straitforward until I tried to enter the 'type of an array of X'. (defmulti update-hash #(class %2)) (type (byte 1)) => java.lang.Byte (defmethod update-hash java.lang.Byte [md byte] (. md update byte)) (type (into-array [ (byte 1)])) => [Ljava.lang.Byte; (defmethod update-hash < WHAT GOES HERE > [md byte]

    Read the article

  • Understanding linear linked list

    - by ArtWorkAD
    Hi, I have some problems understanding the linear linked list data structure. This is how I define a list element: class Node{ Object data; Node link; public Node(Object pData, Node pLink){ this.data = pData; this.link = pLink; } } To keep it simple we say that a list are linked nodes so we do not need to define a class list (recursion principle). My problem is that I am really confused in understanding how nodes are connected, more precisely the sequence of the nodes when we connect them. Node n1 = new Node(new Integer(2), null); Node n2 = new Node(new Integer(1), n1); What is link? Is it the previous or the next element? Any other suggestions to help me understanding this data structure?

    Read the article

  • Does Visual Studio 2010 on x64 crash often? Or is it just on my PC?

    - by JK
    MY VS2010 crashes dozens of times a day. Compare that to 2008 and 2005 which were rock solid. Is 2010 known to be susceptible to crashing? Or could it be my environment? I'm using x64 as a dev box for the first time. The only plugin I has so far is Ankh. It crashes when doing different things. One I've noticed so far that always happens is if I press the key sequence alt-f-s-up (or any cursor key) it will crash every time.

    Read the article

  • Modify a given number to find the required sum?

    - by Gaurav
    A friend of mine sent me this question. I haven't really been able to come up with any kind of algorithm to solve this problem. You are provided with a no. say 123456789 and two operators * and +. Now without changing the sequence of the provided no. and using these operators as many times as you wish, evaluate the given value: eg: given value 2097 Solution: 1+2+345*6+7+8+9 Any ideas on how to approach problems like these?

    Read the article

  • Combining XSLT transforms

    - by Flynn1179
    Is there a way to combine two XSLT documents into a single XSLT document that does the same as transforming using the original two in sequence? i.e. Combining XSLTA and XSLTB into XSLTC such that XSLTB( XSLTA( xml )) == XSLTC( xml )? There's three reasons I'd like to be able to do this: Simplifies development; some operations need sequential transforms, and although I can generate a combined one by hand, it's a lot more difficult to maintain that two much simpler, separate transforms. Speed; one transform is in most cases hopefully faster than two. I'm currently working on a program that literally just transforms a data file in XML into an XHTML page capable of editing it using one XSLT, and a second XSLT that transforms the XHTML page back into the data file when it's saved. One test I hope to be able to do is to combine the two, and easily confirm that the 'combined' XSLT should leave the data unchanged.

    Read the article

  • Concatenating Strings in Obj C

    - by eco_bach
    Hi It seems that Objective C jumps thru hoops to make seemingly simple tasks extremely difficult. I simply need to create a sequence of strings, image1.jpg, image2.jpg, etc etc ie in a loop var imgString:String='image'+i+'.jpg; I assume a best practice is to use a NSMutableString with appendString method? What am I doing wrong?? NSMutableString *imgString; for(int i=1;i<=NUMIMAGES;i++){ imgString.appendString(@"image"+i+@".jpg"); } I get the following error error: request for member 'appendString' in something not a structure or union

    Read the article

  • Insert consecutive numbers

    - by Markus
    Hi. I have a table A (Acons, A1, A2, A3) in which I should insert information from another table B with columns (B1, B2, B3). The Acons is a column in which should contain some consecutive numbers (it is not an identity and I cannot make it identity). I know xmin - starting the from number the sequence has to be computed. How can I insert the rows into the table A, using a single Insert statement? I tried like the following, but it didn't work: DECLARE @i AS INT; SET @i = xmin; INSERT INTO A(Acons, A1, A2, A3) SELECT @i = (Bcons = (@i + 1)), B1, B2, B3 FROM B Unfortunatelly, the above solution does not work;

    Read the article

  • "Othello" game needs some clarification

    - by pappu
    I am trying to see if my understanding of "othello" fame is correct or not. According to the rules, we flip the dark/light sides if we get some sequence like X000X = XXXXX. The question I have is if in the process of flipping 0-X or X- 0, do we also need to consider the rows/columns/diagonals of newly flipped elements? e.g. consider board state as shown in above image(New element X is placed @ 2,3) When we update board, we mark elements from 2,3 to 6,3 as Xs but in this process elements like horizontal 4,3 to 4,5 and diagonal 2,3 to 4,5 are also eligible for update? so do we update those elements as well? or just the elements which have starting as 2,3 (i.e update rows/column/diagonal whose starting point is the element we are dealing with, in our case 2,3?) Please help me understand it

    Read the article

  • Repeating characters in VIM insert mode

    - by Cthutu
    Is there a way of repeating a character while in Vim's insert mode? For example, say I would like to insert 80 dashes, in something like emacs I would type: Ctrl+U 8 0 - The only way I know how to do it in VIM is to exit normal mode for the repeat argument, then go back into insert mode to type the dash, then exit to insert the actual dashes, AND then go back into insert mode to carry on typing. The sequence is a really long: <ESC> 8 0 a - <ESC> a It would be nice not to switch in and out of modes. Thanks

    Read the article

  • python writing a list to a file

    - by gfar90
    I need to write a list to a file in python. I know the list should be converted to a string with the join method, but since I have a tuple I got confused. I tried a lot to change my variables to strings etc, this is one of my first attempts: def perform(text): repository = [("","")] fdist = nltk.FreqDist(some_variable) for c in some_variable: repository.append((c, fdist[c])) return ' '.join(repository) but it gives me the following error: Traceback (most recent call last): File "", line 1, in qe = perform(entfile2) File "", line 14, in perform return ' '.join(repository) TypeError: sequence item 0: expected string, tuple found any ideas how to write the list 'repository' to a file? Thanks!

    Read the article

  • How to save an order (permutation) in an sql db

    - by Bendlas
    I have a tree structure in an sql table like so: CREATE TABLE containers ( container_id serial NOT NULL PRIMARY KEY, parent integer REFERENCES containers (container_id)) Now i want to define an ordering between nodes with the same parent. I Have thought of adding a node_index column, to ORDER BY, but that seem suboptimal, since that involves modifying the index of a lot of nodes when modifying the stucture. That could include adding, removing, reordering or moving nodes from some subtree to another. Is there a sql datatype for an ordered sequence, or an efficient way to emulate one? Doesn't need to be fully standard sql, I just need a solution for mssql and hopefully postgresql EDIT To make it clear, the ordering is arbitrary. Actually, the user will be able to drag'n'drop tree nodes in the GUI

    Read the article

  • Would vector of vectors be contiguous?

    - by user1150989
    I need to allocate a vector of rows where row contains a vector of rows. I know that a vector would be contiguous. I wanted to know whether a vector of vectors would also be contiguous. Example code is given below vector<long> firstRow; firstRow.push_back(0); firstRow.push_back(1); vector<long> secondRow; secondRow.push_back(0); secondRow.push_back(1); vector< vector < long> > data; data.push_back(firstRow); data.push_back(secondRow); Would the sequence in memory be 0 1 0 1?

    Read the article

  • Swap byte 2 and 4 from integer

    - by czar x
    I had this interview question - Swap byte 2 and byte4 within an integer sequence. Integer is a 4byte wide i.e. 32 bits My approach was to use char *pointer and a temp char to swap the bytes. For clarity i have broken the steps otherwise an character array can be considered. unsigned char *b2, *b4, tmpc; int n = 0xABCD; b2 = &n; b2++; b4 = &n; b4 +=3; ///swap the values; tmpc = *b2; *b2 = *b4; *b4 = tmpc; Any other methods?

    Read the article

  • Codeignitor Global Array Declaration

    - by Ajith
    I have a sequence of number like follows 1 - 25, 2 - 60, 3 - 80, 4 - 100 and so on which means that if input is 1 output will be 25 and so on...I need to store it in global array.I would like to use it in multiple pages also.In codeigniter where i can declare a global array and store all these? I am trying like as follows in constants.php $CONFIDENCEVALUE = array(); $CONFIDENCEVALUE[] = array('1'=>25,'2'=>'60','3'=>80,'4'=>100); If it is correct how can access these array value in required pages.Help me please.I am not an expert with codeignitor.Thanks

    Read the article

  • How to Get the Method/Function Call Trace for a Specific Run?

    - by JackWM
    Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

    Read the article

  • SQL Full Outer Join

    - by Torment March
    I have a table named 'Logs' with the following values : CheckDate CheckType CheckTime ------------------------------------------- 2011-11-25 IN 14:40:00 2011-11-25 OUT 14:45:00 2011-11-25 IN 14:50:00 2011-11-25 OUT 14:55:00 2011-11-25 IN 15:00:00 2011-11-25 OUT 15:05:00 2011-11-25 IN 15:15:00 2011-11-25 OUT 15:20:00 2011-11-25 IN 15:25:00 2011-11-25 OUT 15:30:00 2011-11-25 OUT 15:40:00 2011-11-25 IN 15:45:00 I want to use the previous table to produce a result of: CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 NULL 15:40:00 2011-11-25 15:45:00 NULL So far I have come up with this result set : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 15:45:00 NULL The problem is I cannot generate the log without CheckIns : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 NULL 15:40:00 The sequence of CheckIn - CheckOut pairing and order is in increasing time value.

    Read the article

  • Error occurs while using SPADE method in R

    - by Yuwon Lee
    I'm currently mining sequence patterns using SPADE algorithm in R. SPADE is included in "arulesSequence" package of R. I'm running R on my CentOS 6.3 64bit. For an exercise, I've tried an example presented in http://en.wikibooks.org/wiki/Data_Mining_Algorithms_In_R/Sequence_Mining/SPADE When I tried to do "cspade(x, parameter = list(support = 0.4), control = list(verbose = TRUE))" R says: parameter specification: support : 0.4 maxsize : 10 maxlen : 10 algorithmic control: bfstype : FALSE verbose : TRUE summary : FALSE preprocessing ... 1 partition(s), 0 MB [0.096s] mining transactions ... 0 MB [0.066s] reading sequences ...Error in asMethod(object) : 's' is not an integer vector When I try to run SPADE on my Window 7 32bit, it runs well without any error. Does anybody know why such errors occur?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Multiple Concurrent Changes Using SVN, GIT, and CVS

    - by KlaxSmashing
    At work, we are using SVN, CVS, and GIT because there any many projects that were started at various times. Anyway, a common sequence that occurs is as follows: Working on task A, making changes to project Has new task B, some bug or functionality needs to be done on project, independent of task A but may affect same set of files Check in task B Check in task A Unfortunately, what I do at this time is two maintain 2 working copies of each project. So I can always work on task B from a clean copy. As you can imagine, this is wasteful and also, does not scale well (task C, D, E, etc.) For each of these versioning systems, are there commands that can help me do the following: "Save" task A, reverting working copy to current repository Work on task B, check in changes "Restore" task A changes back to working copy

    Read the article

  • How to encode(represent) an ornament?

    - by Daniyar
    I would like to find a numeric representation of kazakh national ornaments for generating new ones. The ornaments essentially consist of combinations of relatively basic ornaments. Usually the ornaments are symmetrical. Here are few examples of basic elements: (The images are a bit distorted) And this is an example of a more complex ornament: How could I encode an ornament's representation in as few numbers as possible? So that I could write a program that would generate an ornament, given some sequence of numbers Any ideas are appreciated. As I write this, I have thought that generating images of snowlfakes may be somewhat relevant, although it's possibly just a fractal.

    Read the article

  • Creating a file path in C#

    - by Jason
    So I'm trying to create a path in C#. I use Environment.Machinename and store it a variable serverName. Then I create another string variable and have some other path extension in there. Here is my code so far: string serverName = Environment.MachineName; string folderName = "\\AlarmLogger"; No matter what I do I can't seem to obtain only one backslash prior to AlarmLogger. Any ideas how I can specify a path in C#? Edit: I'm wondering if my code doesn't seem to want to paste correctly. Anyways when i paste it I only see one backslash but my code has two. Because of the escape character sequence. But something like string test = @"\" + serverName + folderName doesn't seem to want to work for me.

    Read the article

< Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >