Search Results

Search found 2551 results on 103 pages for 'sequence'.

Page 72/103 | < Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >

• Does Visual Studio 2010 on x64 crash often? Or is it just on my PC?

  - by JK

  MY VS2010 crashes dozens of times a day. Compare that to 2008 and 2005 which were rock solid. Is 2010 known to be susceptible to crashing? Or could it be my environment? I'm using x64 as a dev box for the first time. The only plugin I has so far is Ankh. It crashes when doing different things. One I've noticed so far that always happens is if I press the key sequence alt-f-s-up (or any cursor key) it will crash every time.

  Read the article

• Berkeley DB tuple with unknown datatype

  - by Ronnie

  I'm working with a Berkeley database (in Java). I need to read a tuple where the sequence is a string, either an int or long, then another string. How can I determine if the tuple holds an int or a long? Depending on what the tuple holds, I'll do one of the following: String s1 = input.readString(); int num1 = input.readInt(); String s2= input.readString(); or String s1 = input.readString(); long num1 = input.readLong(); String s2= input.readString(); The int is 4 bytes and the long is 8 bytes. If the tuple holds an int and I read it in as a long, I get an invalid value as it converts the 4 byte int + 4 bytes of the following string into a long.

  Read the article

• Insert consecutive numbers

  - by Markus

  Hi. I have a table A (Acons, A1, A2, A3) in which I should insert information from another table B with columns (B1, B2, B3). The Acons is a column in which should contain some consecutive numbers (it is not an identity and I cannot make it identity). I know xmin - starting the from number the sequence has to be computed. How can I insert the rows into the table A, using a single Insert statement? I tried like the following, but it didn't work: DECLARE @i AS INT; SET @i = xmin; INSERT INTO A(Acons, A1, A2, A3) SELECT @i = (Bcons = (@i + 1)), B1, B2, B3 FROM B Unfortunatelly, the above solution does not work;

  Read the article

• Understanding linear linked list

  - by ArtWorkAD

  Hi, I have some problems understanding the linear linked list data structure. This is how I define a list element: class Node{ Object data; Node link; public Node(Object pData, Node pLink){ this.data = pData; this.link = pLink; } } To keep it simple we say that a list are linked nodes so we do not need to define a class list (recursion principle). My problem is that I am really confused in understanding how nodes are connected, more precisely the sequence of the nodes when we connect them. Node n1 = new Node(new Integer(2), null); Node n2 = new Node(new Integer(1), n1); What is link? Is it the previous or the next element? Any other suggestions to help me understanding this data structure?

  Read the article

• Concatenating Strings in Obj C

  - by eco_bach

  Hi It seems that Objective C jumps thru hoops to make seemingly simple tasks extremely difficult. I simply need to create a sequence of strings, image1.jpg, image2.jpg, etc etc ie in a loop var imgString:String='image'+i+'.jpg; I assume a best practice is to use a NSMutableString with appendString method? What am I doing wrong?? NSMutableString *imgString; for(int i=1;i<=NUMIMAGES;i++){ imgString.appendString(@"image"+i+@".jpg"); } I get the following error error: request for member 'appendString' in something not a structure or union

  Read the article

• Emacs: print key binding for a command or list all key bindings

  - by Yktula

  In Emacs (GNU 23.2, *nix), how can I: list the key sequences bound to a particular command? For example, how can we list all the key sequences that execute save-buffers-kill-emacs, with the output of key sequences bound to it? Assuming we can do this, listing the key sequences bound to goto-line should print the output: M-g g on a default install. list all key-bindings? Does C-h b do this? Would it print my own bindings? I am aware that executing the command directly can print a key sequence it can be activated with, but it doesn't always do so, and a few things happen, including: (1) the output doesn't remain for long, (2) the command is executed. I want a command that lists for me (preferably all) the bindings attached to a given command, without executing the command, or something like that.

  Read the article

• "Othello" game needs some clarification

  - by pappu

  I am trying to see if my understanding of "othello" fame is correct or not. According to the rules, we flip the dark/light sides if we get some sequence like X000X = XXXXX. The question I have is if in the process of flipping 0-X or X- 0, do we also need to consider the rows/columns/diagonals of newly flipped elements? e.g. consider board state as shown in above image(New element X is placed @ 2,3) When we update board, we mark elements from 2,3 to 6,3 as Xs but in this process elements like horizontal 4,3 to 4,5 and diagonal 2,3 to 4,5 are also eligible for update? so do we update those elements as well? or just the elements which have starting as 2,3 (i.e update rows/column/diagonal whose starting point is the element we are dealing with, in our case 2,3?) Please help me understand it

  Read the article

• Need generated UML diagrams for C++ plugin modules

  - by archer1742

  I need various UML diagrams (sequence/collaboration, class, package, and system component) from some C++ files. However, these files are plugins in a larger programming framework. I have tried generating UML from Rational Rose 7 (2002 version), but I am not very experienced and I am unsure if RR simply cannot produce the diagram, I am doing something wrong, or the diagrams are not rendering correctly because the source files are plugins instead of standalone programs. I have also tried Star Modeler with little success and there seem to be no tutorials on how to generate these models. Is there a simple, bulletproof way to get UML diagrams for C++ files?

  Read the article

• How to dispatch a multimethod on the type of an array

  - by Arthur Ulfeldt

  I'm working on a multimethod that needs to update a hash for a bunch of different things in a sequence. Looked fairly straitforward until I tried to enter the 'type of an array of X'. (defmulti update-hash #(class %2)) (type (byte 1)) => java.lang.Byte (defmethod update-hash java.lang.Byte [md byte] (. md update byte)) (type (into-array [ (byte 1)])) => [Ljava.lang.Byte; (defmethod update-hash < WHAT GOES HERE > [md byte]

  Read the article

• Trouble converting string/character to byte in lisp

  - by WanderingPhd

  I've some data that I'm reading in using read-line and I want to convert it into a byte-array. babel:string-to-octet works for the most part except when the character\byte is larger (above 200) in which case it returns two numbers. As an example, if the character is ú using babel:string-to-octet returns (195 185) instead of 250 which is what I'm looking for. I tried a number of encodings in babel but none of them seem to work. If I use read-byte or read-sequence it does read in 250. But for reasons of backward compatibility, I'm left with using read-line and I would like to know if there is something I'm missing when using babel:string-to-octet to convert ú to 250. I'm using ccl 1.8 btw.

  Read the article

• Combining XSLT transforms

  - by Flynn1179

  Is there a way to combine two XSLT documents into a single XSLT document that does the same as transforming using the original two in sequence? i.e. Combining XSLTA and XSLTB into XSLTC such that XSLTB( XSLTA( xml )) == XSLTC( xml )? There's three reasons I'd like to be able to do this: Simplifies development; some operations need sequential transforms, and although I can generate a combined one by hand, it's a lot more difficult to maintain that two much simpler, separate transforms. Speed; one transform is in most cases hopefully faster than two. I'm currently working on a program that literally just transforms a data file in XML into an XHTML page capable of editing it using one XSLT, and a second XSLT that transforms the XHTML page back into the data file when it's saved. One test I hope to be able to do is to combine the two, and easily confirm that the 'combined' XSLT should leave the data unchanged.

  Read the article

• python writing a list to a file

  - by gfar90

  I need to write a list to a file in python. I know the list should be converted to a string with the join method, but since I have a tuple I got confused. I tried a lot to change my variables to strings etc, this is one of my first attempts: def perform(text): repository = [("","")] fdist = nltk.FreqDist(some_variable) for c in some_variable: repository.append((c, fdist[c])) return ' '.join(repository) but it gives me the following error: Traceback (most recent call last): File "", line 1, in qe = perform(entfile2) File "", line 14, in perform return ' '.join(repository) TypeError: sequence item 0: expected string, tuple found any ideas how to write the list 'repository' to a file? Thanks!

  Read the article

• what the java command's -jar option really does

  - by JBoy

  Does the -jar option of the java command also compile the sources before running the main method? I believe so but i would like to have a better understanding of the internal process, from the man page you can clearly see a small workflow sequence: -jar Execute a program encapsulated in a JAR file. The first argument is the name of a JAR file instead of a startup class name. In order for this option to work, the manifest of the JAR file must contain a line of the form Main-Class: classname. Here, classname identifies the class having the public static void main(String[] args) method that serves as your application's starting point. See the Jar tool reference page and the Jar trail of the Java Tutorial @ But it does not mention that it compiles the sources.

  Read the article

• Repeating characters in VIM insert mode

  - by Cthutu

  Is there a way of repeating a character while in Vim's insert mode? For example, say I would like to insert 80 dashes, in something like emacs I would type: Ctrl+U 8 0 - The only way I know how to do it in VIM is to exit normal mode for the repeat argument, then go back into insert mode to type the dash, then exit to insert the actual dashes, AND then go back into insert mode to carry on typing. The sequence is a really long: <ESC> 8 0 a - <ESC> a It would be nice not to switch in and out of modes. Thanks

  Read the article

• Swap byte 2 and 4 from integer

  - by czar x

  I had this interview question - Swap byte 2 and byte4 within an integer sequence. Integer is a 4byte wide i.e. 32 bits My approach was to use char *pointer and a temp char to swap the bytes. For clarity i have broken the steps otherwise an character array can be considered. unsigned char *b2, *b4, tmpc; int n = 0xABCD; b2 = &n; b2++; b4 = &n; b4 +=3; ///swap the values; tmpc = *b2; *b2 = *b4; *b4 = tmpc; Any other methods?

  Read the article

• Codeignitor Global Array Declaration

  - by Ajith

  I have a sequence of number like follows 1 - 25, 2 - 60, 3 - 80, 4 - 100 and so on which means that if input is 1 output will be 25 and so on...I need to store it in global array.I would like to use it in multiple pages also.In codeigniter where i can declare a global array and store all these? I am trying like as follows in constants.php $CONFIDENCEVALUE = array(); $CONFIDENCEVALUE[] = array('1'=>25,'2'=>'60','3'=>80,'4'=>100); If it is correct how can access these array value in required pages.Help me please.I am not an expert with codeignitor.Thanks

  Read the article

• How to save an order (permutation) in an sql db

  - by Bendlas

  I have a tree structure in an sql table like so: CREATE TABLE containers ( container_id serial NOT NULL PRIMARY KEY, parent integer REFERENCES containers (container_id)) Now i want to define an ordering between nodes with the same parent. I Have thought of adding a node_index column, to ORDER BY, but that seem suboptimal, since that involves modifying the index of a lot of nodes when modifying the stucture. That could include adding, removing, reordering or moving nodes from some subtree to another. Is there a sql datatype for an ordered sequence, or an efficient way to emulate one? Doesn't need to be fully standard sql, I just need a solution for mssql and hopefully postgresql EDIT To make it clear, the ordering is arbitrary. Actually, the user will be able to drag'n'drop tree nodes in the GUI

  Read the article

• Would vector of vectors be contiguous?

  - by user1150989

  I need to allocate a vector of rows where row contains a vector of rows. I know that a vector would be contiguous. I wanted to know whether a vector of vectors would also be contiguous. Example code is given below vector<long> firstRow; firstRow.push_back(0); firstRow.push_back(1); vector<long> secondRow; secondRow.push_back(0); secondRow.push_back(1); vector< vector < long> > data; data.push_back(firstRow); data.push_back(secondRow); Would the sequence in memory be 0 1 0 1?

  Read the article

• How to Get the Method/Function Call Trace for a Specific Run?

  - by JackWM

  Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

  Read the article

• SQL Full Outer Join

  - by Torment March

  I have a table named 'Logs' with the following values : CheckDate CheckType CheckTime ------------------------------------------- 2011-11-25 IN 14:40:00 2011-11-25 OUT 14:45:00 2011-11-25 IN 14:50:00 2011-11-25 OUT 14:55:00 2011-11-25 IN 15:00:00 2011-11-25 OUT 15:05:00 2011-11-25 IN 15:15:00 2011-11-25 OUT 15:20:00 2011-11-25 IN 15:25:00 2011-11-25 OUT 15:30:00 2011-11-25 OUT 15:40:00 2011-11-25 IN 15:45:00 I want to use the previous table to produce a result of: CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 NULL 15:40:00 2011-11-25 15:45:00 NULL So far I have come up with this result set : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 15:45:00 NULL The problem is I cannot generate the log without CheckIns : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 NULL 15:40:00 The sequence of CheckIn - CheckOut pairing and order is in increasing time value.

  Read the article

• How to encode(represent) an ornament?

  - by Daniyar

  I would like to find a numeric representation of kazakh national ornaments for generating new ones. The ornaments essentially consist of combinations of relatively basic ornaments. Usually the ornaments are symmetrical. Here are few examples of basic elements: (The images are a bit distorted) And this is an example of a more complex ornament: How could I encode an ornament's representation in as few numbers as possible? So that I could write a program that would generate an ornament, given some sequence of numbers Any ideas are appreciated. As I write this, I have thought that generating images of snowlfakes may be somewhat relevant, although it's possibly just a fractal.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Multiple Concurrent Changes Using SVN, GIT, and CVS

  - by KlaxSmashing

  At work, we are using SVN, CVS, and GIT because there any many projects that were started at various times. Anyway, a common sequence that occurs is as follows: Working on task A, making changes to project Has new task B, some bug or functionality needs to be done on project, independent of task A but may affect same set of files Check in task B Check in task A Unfortunately, what I do at this time is two maintain 2 working copies of each project. So I can always work on task B from a clean copy. As you can imagine, this is wasteful and also, does not scale well (task C, D, E, etc.) For each of these versioning systems, are there commands that can help me do the following: "Save" task A, reverting working copy to current repository Work on task B, check in changes "Restore" task A changes back to working copy

  Read the article

• How to change the text int JLabel under the while or for loop?

  - by guilgamos

  I want to create a simple clock by using java. The code is very simply that i will give an example shown below for(int i=0;i<=60;i++) jLabel11.setText( Integer.toString(i) ); The problem is while I'm running my program the result didn't show the update in sequence. I mean it show only 60 digit immediately. It didn't show the change from 1 to 2 to 3 ... something like this. How can i fix this problem. Thank you in advance.

  Read the article

• How to transfer large file (File size > Heap Size) over the network?

  - by neo

  How to transfer large file (File size Heap/RAM Size) over the network ? Lets say I have file (size 10GB) I want to transfer it machine a (RAM 512mb) to machine b (RAM 512mb). Want achieve this using java code. First, is it possible ? Any recommendation on framework. If possible, can we speed this up using threading ? Important criteria: file's data sequence needs to be maintained during transfer. Any example will be great help.

  Read the article

< Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >