Search Results

Search found 2610 results on 105 pages for 'dna sequence'.

Page 74/105 | < Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >

• In an If-Else Statement for a method return, should an Else be explicitly stated if it can instead b

  - by ccomet

  I have a method that checks certain things and returns a Boolean based on those checks. It involves a single branching If section that checks about 5 conditions in sequence. If any of those conditions return true, then the method will return true;. If none of the conditions return true, then the method will return false;. Since the code after the If section will only run if none of the conditions are true, then that code is logically identical to including an actual Else statement. So is it a better idea to actually write in the Else statement for this kind of situation?

  Read the article

• Flex: -frames.frame

  - by Michael Brewer-Davis

  Has anyone used this successfully or found further documentation than just the below (from the Adobe site): frames.frame label class_name [...] Specifies a SWF file frame label with a sequence of class names that are linked onto the frame. This option lets you add asset factories that stream in after the application that then publish their interfaces with the ModuleManager class. The advantage to doing this is that the application starts faster than it would have if the assets had been included in the code, but does not require moving the assets to an external SWF file. This is an advanced option.

  Read the article

• Berkeley DB tuple with unknown datatype

  - by Ronnie

  I'm working with a Berkeley database (in Java). I need to read a tuple where the sequence is a string, either an int or long, then another string. How can I determine if the tuple holds an int or a long? Depending on what the tuple holds, I'll do one of the following: String s1 = input.readString(); int num1 = input.readInt(); String s2= input.readString(); or String s1 = input.readString(); long num1 = input.readLong(); String s2= input.readString(); The int is 4 bytes and the long is 8 bytes. If the tuple holds an int and I read it in as a long, I get an invalid value as it converts the 4 byte int + 4 bytes of the following string into a long.

  Read the article

• What is the logic behind defining macros inside a struct?

  - by systemsfault

  As apparent in the title, I'm questioning the reason behind defining the macros inside a struct. I frequently see this approach in network programming for instance following snippet: struct sniff_tcp { u_short th_sport; /* source port */ u_short th_dport; /* destination port */ tcp_seq th_seq; /* sequence number */ tcp_seq th_ack; /* acknowledgement number */ u_char th_offx2; /* data offset, rsvd */ #define TH_OFF(th) (((th)->th_offx2 & 0xf0) >> 4) u_char th_flags; #define TH_FIN 0x01 #define TH_SYN 0x02 #define TH_RST 0x04 #define TH_PUSH 0x08 #define TH_ACK 0x10 #define TH_URG 0x20 #define TH_ECE 0x40 #define TH_CWR 0x80 #define TH_FLAGS (TH_FIN|TH_SYN|TH_RST|TH_ACK|TH_URG|TH_ECE|TH_CWR) u_short th_win; /* window */ u_short th_sum; /* checksum */ u_short th_urp; /* urgent pointer */ }; This example is from sniffex.c code in tcpdump's web site. Is this for enhancing readability and making code clearer.

  Read the article

• Concatenating Strings in Obj C

  - by eco_bach

  Hi It seems that Objective C jumps thru hoops to make seemingly simple tasks extremely difficult. I simply need to create a sequence of strings, image1.jpg, image2.jpg, etc etc ie in a loop var imgString:String='image'+i+'.jpg; I assume a best practice is to use a NSMutableString with appendString method? What am I doing wrong?? NSMutableString *imgString; for(int i=1;i<=NUMIMAGES;i++){ imgString.appendString(@"image"+i+@".jpg"); } I get the following error error: request for member 'appendString' in something not a structure or union

  Read the article

• How do I read UTF-8 characters via a pointer?

  - by Jen

  Suppose I have UTF-8 content stored in memory, how do I read the characters using a pointer? I presume I need to watch for the 8th bit indicating a multi-byte character, but how exactly do I turn the sequence into a valid Unicode character? Also, is wchar_t the proper type to store a single Unicode character? This is what I have in mind: wchar_t readNextChar (char** p) { char ch = *p++; if (ch & 128) { // This is a multi-byte character, what do I do now? // char chNext = *p++; // ... but how do I assemble the Unicode character? ... } ... }

  Read the article

• "Othello" game needs some clarification

  - by pappu

  I am trying to see if my understanding of "othello" fame is correct or not. According to the rules, we flip the dark/light sides if we get some sequence like X000X = XXXXX. The question I have is if in the process of flipping 0-X or X- 0, do we also need to consider the rows/columns/diagonals of newly flipped elements? e.g. consider board state as shown in above image(New element X is placed @ 2,3) When we update board, we mark elements from 2,3 to 6,3 as Xs but in this process elements like horizontal 4,3 to 4,5 and diagonal 2,3 to 4,5 are also eligible for update? so do we update those elements as well? or just the elements which have starting as 2,3 (i.e update rows/column/diagonal whose starting point is the element we are dealing with, in our case 2,3?) Please help me understand it

  Read the article

• Does Visual Studio 2010 on x64 crash often? Or is it just on my PC?

  - by JK

  MY VS2010 crashes dozens of times a day. Compare that to 2008 and 2005 which were rock solid. Is 2010 known to be susceptible to crashing? Or could it be my environment? I'm using x64 as a dev box for the first time. The only plugin I has so far is Ankh. It crashes when doing different things. One I've noticed so far that always happens is if I press the key sequence alt-f-s-up (or any cursor key) it will crash every time.

  Read the article

• Insert consecutive numbers

  - by Markus

  Hi. I have a table A (Acons, A1, A2, A3) in which I should insert information from another table B with columns (B1, B2, B3). The Acons is a column in which should contain some consecutive numbers (it is not an identity and I cannot make it identity). I know xmin - starting the from number the sequence has to be computed. How can I insert the rows into the table A, using a single Insert statement? I tried like the following, but it didn't work: DECLARE @i AS INT; SET @i = xmin; INSERT INTO A(Acons, A1, A2, A3) SELECT @i = (Bcons = (@i + 1)), B1, B2, B3 FROM B Unfortunatelly, the above solution does not work;

  Read the article

• Manipulating both unicode and ASCII character set in C#

  - by Murlex

  I have this mapping in my C# application string [,] unicode2Ascii = { { "&#3001;", "\x86" } }; ஹ - is the unicode value for a tamil literal "ஹ". This is the raw hex literal for the unicode value saved by MS Word as a byte sequence. I am trying to map these unicode value "strings" to a hex value under 255 (so as to accommodate non-unicode supported systems). I trying to use string.replace like this: S = S.replace(unicode2Ascii[0,0], unicode2Ascii[0,1]); However the resultant ouput has a ? instead of the actual hex 0x86 stored. Any pointer on how I could set the encoding for the second element of that array to something like windows-1252? Or is there a better way to do this conversion? thanks in advance

  Read the article

• How to dispatch a multimethod on the type of an array

  - by Arthur Ulfeldt

  I'm working on a multimethod that needs to update a hash for a bunch of different things in a sequence. Looked fairly straitforward until I tried to enter the 'type of an array of X'. (defmulti update-hash #(class %2)) (type (byte 1)) => java.lang.Byte (defmethod update-hash java.lang.Byte [md byte] (. md update byte)) (type (into-array [ (byte 1)])) => [Ljava.lang.Byte; (defmethod update-hash < WHAT GOES HERE > [md byte]

  Read the article

• python writing a list to a file

  - by gfar90

  I need to write a list to a file in python. I know the list should be converted to a string with the join method, but since I have a tuple I got confused. I tried a lot to change my variables to strings etc, this is one of my first attempts: def perform(text): repository = [("","")] fdist = nltk.FreqDist(some_variable) for c in some_variable: repository.append((c, fdist[c])) return ' '.join(repository) but it gives me the following error: Traceback (most recent call last): File "", line 1, in qe = perform(entfile2) File "", line 14, in perform return ' '.join(repository) TypeError: sequence item 0: expected string, tuple found any ideas how to write the list 'repository' to a file? Thanks!

  Read the article

• Combining XSLT transforms

  - by Flynn1179

  Is there a way to combine two XSLT documents into a single XSLT document that does the same as transforming using the original two in sequence? i.e. Combining XSLTA and XSLTB into XSLTC such that XSLTB( XSLTA( xml )) == XSLTC( xml )? There's three reasons I'd like to be able to do this: Simplifies development; some operations need sequential transforms, and although I can generate a combined one by hand, it's a lot more difficult to maintain that two much simpler, separate transforms. Speed; one transform is in most cases hopefully faster than two. I'm currently working on a program that literally just transforms a data file in XML into an XHTML page capable of editing it using one XSLT, and a second XSLT that transforms the XHTML page back into the data file when it's saved. One test I hope to be able to do is to combine the two, and easily confirm that the 'combined' XSLT should leave the data unchanged.

  Read the article

• Emacs: print key binding for a command or list all key bindings

  - by Yktula

  In Emacs (GNU 23.2, *nix), how can I: list the key sequences bound to a particular command? For example, how can we list all the key sequences that execute save-buffers-kill-emacs, with the output of key sequences bound to it? Assuming we can do this, listing the key sequences bound to goto-line should print the output: M-g g on a default install. list all key-bindings? Does C-h b do this? Would it print my own bindings? I am aware that executing the command directly can print a key sequence it can be activated with, but it doesn't always do so, and a few things happen, including: (1) the output doesn't remain for long, (2) the command is executed. I want a command that lists for me (preferably all) the bindings attached to a given command, without executing the command, or something like that.

  Read the article

• Need generated UML diagrams for C++ plugin modules

  - by archer1742

  I need various UML diagrams (sequence/collaboration, class, package, and system component) from some C++ files. However, these files are plugins in a larger programming framework. I have tried generating UML from Rational Rose 7 (2002 version), but I am not very experienced and I am unsure if RR simply cannot produce the diagram, I am doing something wrong, or the diagrams are not rendering correctly because the source files are plugins instead of standalone programs. I have also tried Star Modeler with little success and there seem to be no tutorials on how to generate these models. Is there a simple, bulletproof way to get UML diagrams for C++ files?

  Read the article

• Repeating characters in VIM insert mode

  - by Cthutu

  Is there a way of repeating a character while in Vim's insert mode? For example, say I would like to insert 80 dashes, in something like emacs I would type: Ctrl+U 8 0 - The only way I know how to do it in VIM is to exit normal mode for the repeat argument, then go back into insert mode to type the dash, then exit to insert the actual dashes, AND then go back into insert mode to carry on typing. The sequence is a really long: <ESC> 8 0 a - <ESC> a It would be nice not to switch in and out of modes. Thanks

  Read the article

• Trouble converting string/character to byte in lisp

  - by WanderingPhd

  I've some data that I'm reading in using read-line and I want to convert it into a byte-array. babel:string-to-octet works for the most part except when the character\byte is larger (above 200) in which case it returns two numbers. As an example, if the character is ú using babel:string-to-octet returns (195 185) instead of 250 which is what I'm looking for. I tried a number of encodings in babel but none of them seem to work. If I use read-byte or read-sequence it does read in 250. But for reasons of backward compatibility, I'm left with using read-line and I would like to know if there is something I'm missing when using babel:string-to-octet to convert ú to 250. I'm using ccl 1.8 btw.

  Read the article

• Swap byte 2 and 4 from integer

  - by czar x

  I had this interview question - Swap byte 2 and byte4 within an integer sequence. Integer is a 4byte wide i.e. 32 bits My approach was to use char *pointer and a temp char to swap the bytes. For clarity i have broken the steps otherwise an character array can be considered. unsigned char *b2, *b4, tmpc; int n = 0xABCD; b2 = &n; b2++; b4 = &n; b4 +=3; ///swap the values; tmpc = *b2; *b2 = *b4; *b4 = tmpc; Any other methods?

  Read the article

• Codeignitor Global Array Declaration

  - by Ajith

  I have a sequence of number like follows 1 - 25, 2 - 60, 3 - 80, 4 - 100 and so on which means that if input is 1 output will be 25 and so on...I need to store it in global array.I would like to use it in multiple pages also.In codeigniter where i can declare a global array and store all these? I am trying like as follows in constants.php $CONFIDENCEVALUE = array(); $CONFIDENCEVALUE[] = array('1'=>25,'2'=>'60','3'=>80,'4'=>100); If it is correct how can access these array value in required pages.Help me please.I am not an expert with codeignitor.Thanks

  Read the article

• How to save an order (permutation) in an sql db

  - by Bendlas

  I have a tree structure in an sql table like so: CREATE TABLE containers ( container_id serial NOT NULL PRIMARY KEY, parent integer REFERENCES containers (container_id)) Now i want to define an ordering between nodes with the same parent. I Have thought of adding a node_index column, to ORDER BY, but that seem suboptimal, since that involves modifying the index of a lot of nodes when modifying the stucture. That could include adding, removing, reordering or moving nodes from some subtree to another. Is there a sql datatype for an ordered sequence, or an efficient way to emulate one? Doesn't need to be fully standard sql, I just need a solution for mssql and hopefully postgresql EDIT To make it clear, the ordering is arbitrary. Actually, the user will be able to drag'n'drop tree nodes in the GUI

  Read the article

• Would vector of vectors be contiguous?

  - by user1150989

  I need to allocate a vector of rows where row contains a vector of rows. I know that a vector would be contiguous. I wanted to know whether a vector of vectors would also be contiguous. Example code is given below vector<long> firstRow; firstRow.push_back(0); firstRow.push_back(1); vector<long> secondRow; secondRow.push_back(0); secondRow.push_back(1); vector< vector < long> > data; data.push_back(firstRow); data.push_back(secondRow); Would the sequence in memory be 0 1 0 1?

  Read the article

• what the java command's -jar option really does

  - by JBoy

  Does the -jar option of the java command also compile the sources before running the main method? I believe so but i would like to have a better understanding of the internal process, from the man page you can clearly see a small workflow sequence: -jar Execute a program encapsulated in a JAR file. The first argument is the name of a JAR file instead of a startup class name. In order for this option to work, the manifest of the JAR file must contain a line of the form Main-Class: classname. Here, classname identifies the class having the public static void main(String[] args) method that serves as your application's starting point. See the Jar tool reference page and the Jar trail of the Java Tutorial @ But it does not mention that it compiles the sources.

  Read the article

• SQL Full Outer Join

  - by Torment March

  I have a table named 'Logs' with the following values : CheckDate CheckType CheckTime ------------------------------------------- 2011-11-25 IN 14:40:00 2011-11-25 OUT 14:45:00 2011-11-25 IN 14:50:00 2011-11-25 OUT 14:55:00 2011-11-25 IN 15:00:00 2011-11-25 OUT 15:05:00 2011-11-25 IN 15:15:00 2011-11-25 OUT 15:20:00 2011-11-25 IN 15:25:00 2011-11-25 OUT 15:30:00 2011-11-25 OUT 15:40:00 2011-11-25 IN 15:45:00 I want to use the previous table to produce a result of: CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 NULL 15:40:00 2011-11-25 15:45:00 NULL So far I have come up with this result set : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 15:45:00 NULL The problem is I cannot generate the log without CheckIns : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 NULL 15:40:00 The sequence of CheckIn - CheckOut pairing and order is in increasing time value.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• How to Get the Method/Function Call Trace for a Specific Run?

  - by JackWM

  Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

  Read the article

< Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >