Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 754/1326 | < Previous Page | 750 751 752 753 754 755 756 757 758 759 760 761  | Next Page >

  • Remove duplicate values

    - by Pankaj
    Hello All I have a class ClientState Class ClientState { Public int ID{get;set;} public string State{get;set;} } List<ClientState> listClientState which contain all states of USA, Now may problem is listClientState contain some objects which have duplicates states. How can i filter listClientState to remove duplicate record

    Read the article

  • How can i resolve the N+1 Selects problem ?

    - by Maxime ARNSTAMM
    Hello everyone, I have trouble understanding how to avoid the n+1 select in jpa or hibernate. From what i read, there's the 'left join fetch', but i'm not sure if it still works with more than one list (oneToMany).. Could someone explain it to me, or give me a link with a clear complete explanation please ? I'm sorry if this is a noob question, but i can't find a real clear article or doc on this issue. Thanks

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • how do you pass in a collection to an MVC 2 partial view?

    - by femi
    hello , how do you pass in a collection to an MVC 2 partial view? I saw an example where they used the syntax; <% Html.RenderPartial("QuestionPartial", question); % this passes in only ONE question object.. what if i want to pass in several questions into the partial view and , say, i want to list them out...how would i pass in SEVERAL questions? thanks

    Read the article

  • Excel VBA / SQL Union

    - by Edge
    Hi, I am trying to Join 2 seperate columns from 2 different sheets to make a longer column from which i can then use a Vlookup from. Sheet1 A, B, C, D, E, F, G Sheet2 A, B, C, D, E, F, G I want to Join(Union) Columns B from sheet1 and C from sheet2 together and find the Distinct values of the new list. I have been working on this for weeks. Thanks

    Read the article

  • EmptyDataTemplate and EmptyDataText not working

    - by Farinha
    I can't seem to get either EmptyDataTemplate or EmptyDataText of a GridView to work. I'm fetching the GridView contents in de codebehind and attaching them with using DataBind(). I've tried having them as null and as an empty List, and in both cases the text I put into EmptyDataTemplate or EmptyDataText is not displayed. What am I doing wrong?

    Read the article

  • How to correctly highlight cursor line in VIM?

    - by Eye of Hell
    Hello. VIM can be configured to highlight current line via :hi cursorline guibg=green and set cursorline commands. But if I enable tabs display via: :hi specialkey guifg=grey guibg=grey :set listchars="tab" :set list Cursor line highlight will corrupt tabs display: Any hints how i can avoid corruption so may tabs are highlighted with one color and cursor line is highlighted with another color without any ^I displayed at intersection?

    Read the article

  • IIS Directory Browing

    - by Zinx
    Hi All, If I enable directory browsing in IIS it displays folder contents to user. Is there any way of controlling the way it shows the list. For example, I dont want to show full physical path of the folder. Is it possible to achieve? If yes, how? Thanks.

    Read the article

  • Redirect based on Accept-Language

    - by Anthony Faull
    I need to honor the web browser's list of language preferences. Supported languages are English and French. For example: http_accept_language="jp-JP;fr;en-US;en" redirects to a directory called /French/. How can I do this with rewrite rules in my .htaccess file?

    Read the article

  • Test assertions for tuples with floats

    - by Space_C0wb0y
    I have a function that returns a tuple that, among others, contains a float value. Usually I use assertAlmostEquals to compare those, but this does not work with tuples. Also, the tuple contains other data-types as well. Currently I am asserting every element of the tuple individually, but that gets too much for a list of such tuples. Is there any good way to write assertions for such cases?

    Read the article

  • Android: onListItemClick not getting called in ListActivity

    - by user521469
    I'm having problems with my first Android app. I have subclassed ListActivity, and I'm having no luck getting the overridden onListItemClick() to respond to click events. I've read focus can be a problem, but changing focus in the XML files does not seem to work. Here's the relevant bits of code. Anyone see what's I've buggered up? public class Notepadv1 extends ListActivity { private int mNoteNumber = 1; private NotesDbAdapter mDbHelper; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.notepad_list); mDbHelper = new NotesDbAdapter(this); mDbHelper.open(); fillData(); } private void fillData() { // Get all of the notes from the database and create the item list Cursor c = mDbHelper.fetchAllNotes(); startManagingCursor(c); String[] from = new String[] { NotesDbAdapter.KEY_TITLE }; int[] to = new int[] { R.id.text1 }; SimpleCursorAdapter notes = new SimpleCursorAdapter(this, R.layout.notes_row, c, from, to); setListAdapter(notes); } @Override public void onListItemClick (ListView l, View v, int position, long id){ super.onListItemClick(l, v, position, id); AlertDialog alert = new AlertDialog.Builder(this).create(); String message = "row clicked!"; alert.setMessage(message); alert.show(); } notepad_list.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@android:id/list" android:layout_width="wrap_content" android:layout_height="wrap_content" android:dividerHeight="6dp"/> <TextView android:id="@android:id/empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/no_notes" /> </LinearLayout> And notes_row.xml <?xml version="1.0" encoding="utf-8"?> <TextView android:id="@+id/text1" xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="60dp" android:focusable="false"/>

    Read the article

  • How do I restrict foreign keys choices to related objects only in django

    - by Jeff Mc
    I have a two way foreign relation similar to the following class Parent(models.Model): name = models.CharField(max_length=255) favoritechild = models.ForeignKey("Child", blank=True, null=True) class Child(models.Model): name = models.CharField(max_length=255) myparent = models.ForeignKey(Parent) How do I restrict the choices for Parent.favoritechild to only children whose parent is itself? I tried class Parent(models.Model): name = models.CharField(max_length=255) favoritechild = models.ForeignKey("Child", blank=True, null=True, limit_choices_to = {"myparent": "self"}) but that causes the admin interface to not list any children.

    Read the article

  • Import? Initialize? what do to?

    - by Jeremy B
    I'm working on homework and I'm close but I am having an issue. I just learned how to work with packages in eclipse so I have a class that is importing another class from a package (I think I said that right) The main prompts the user to enter an integer between -100 and 100 and I am having an issue with validating it. I know the issue is where I'm importing I'm just unsure the direction I need to go to fix it. This is a section of my main code. (my issue starts with the last couple lines if you want to skip ahead) import myUtils.util.Console; public class ConsoleTestApp { public static void main(String args[]) { // create the Console object Console c = new Console(); // display a welcome message c.println("Welcome to the Console Tester application"); c.println(); // int c.println("Int Test"); int i = c.getIntWithinRange("Enter an integer between -100 and 100: ", -101, 101); c.println(); I have a class called Console that is located in another package that I believe I have properly imported. here is the code I am stuck on in my console class. public int getIntWithinRange(String prompt, int min, int max) { int i = 0; boolean isValid = false; while (isValid == false) { System.out.println(prompt); if (sc.hasNextInt()) { //if user chooses menu option less than 1 the program will print an error message i = sc.nextInt(); if (i < min) { System.out.println("Error! Please enter an int greater than -100"); } else if (i > max) { System.out.println("Error! Please enter an int less than 100"); } else isValid = true; } else System.out.println("Error! Invalid number value"); sc.nextLine(); } // return the int return i; } when I run this I keep getting my last print which is an invalid number value. am I not importing the code from the main method in the other console properly?

    Read the article

  • Searching NSString in XML database, Iphone

    - by user358170
    My project is like a classifieds kind of stuff.. I have a search text box in the first page. When the user enters some text in that, i need to compare that text to the XML file from where all the data are being recieved, and should list out all the advertisements in the Table View (next page).. I had did this kind of search in sql database..but not with XML.. Just need some help..

    Read the article

  • Which JavaScript graphics library has the best performance?

    - by DNS
    I'm doing some research for a JavaScript project where the performance of drawing simple primitives (i.e. lines) is by far the top priority. The answers to this question provide a great list of JS graphics libraries. While I realize that the choice of browser has a greater impact than the library, I'd like to know whether there are any differences between them, before choosing one. Has anyone done a performance comparison between any of these?

    Read the article

  • Associate an Activity with an item in XML ListViews in Android

    - by John
    I have a ListView that is populated using an XML file. However, I want each item, when clicked, to start a new Activity related to that item. I understand how to use OnItemClick to start a Toast that shows the selected item's text. However, since the ListView is populated from an XML there is not a specific Id for each item in the list. So, how would I associate an Activity with each item in the ListView when the items do not have Ids?

    Read the article

  • Which XML library for what purposes?

    - by John Mee
    A search for "python" and "xml" returns a variety of libraries for combining the two. This list probably faulty: xml.dom xml.etree xml.sax xml.parsers.expat PyXML beautifulsoup? HTMLParser htmllib sgmllib Be nice if someone can offer a quick summary of when to use which, and why.

    Read the article

  • django sort by manytomany relationship

    - by Marconi
    I have the following model: class Service(models.Model): ratings = models.ManyToManyField(User) Now if I wanna get all the service with ratings sorted in descending order I did something: services_list = Service.objects.filter(ratings__gt=0).distinct() services_list = list(services_list) services_list.sort(key=lambda service: service.ratings.all().count(), reverse=True) As you can see its a three step process and I don't feel right about this. Anybody who knows a better way to do this?

    Read the article

  • Can I make this two LINQ queries into one query only?

    - by Holli
    From a List of builtAgents I need all items with OptimPriority == 1 and only 5 items with OptimPriority == 0. I do this with two seperate queries but I wonder if I could make this with only one query. IEnumerable<Agent> priorityAgents = from pri in builtAgents where pri.OptimPriority == 1 select pri; IEnumerable<Agent> otherAgents = (from oth in builtAgents where oth.OptimPriority == 0 select oth).Take(5);

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 750 751 752 753 754 755 756 757 758 759 760 761  | Next Page >