Search Results

Search found 33140 results on 1326 pages for 'skip list'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 755/1326 | < Previous Page | 751 752 753 754 755 756 757 758 759 760 761 762  | Next Page >

  • Can I make this two LINQ queries into one query only?

    - by Holli
    From a List of builtAgents I need all items with OptimPriority == 1 and only 5 items with OptimPriority == 0. I do this with two seperate queries but I wonder if I could make this with only one query. IEnumerable<Agent> priorityAgents = from pri in builtAgents where pri.OptimPriority == 1 select pri; IEnumerable<Agent> otherAgents = (from oth in builtAgents where oth.OptimPriority == 0 select oth).Take(5);

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What is the best credit card processing service?

    - by JerSchneid
    We're looking to add credit card payments to our system (and it needs to be fairly custom, handling variable "per use" charges each month). We would like the integration to be simple and secure (i.e. no storing of credit card data on our system). What, in your opinion, is the best credit card processing provider to offer this kind of security and flexibility. List only one provider per answer to let the voting system do it's thing.

    Read the article

  • Extract new image dimensions from timthumb

    - by jonthoughtit
    I'm using timthumb to resize my images because it scales them nicely if I only enter one of the dimensions. However I want to know if it's possible to extract the new resized image's dimensions so that I can add that dynamically to the img tag attributes. I tried this with no luck: $fullpath = '/lib/timthumb.php?src='.$image.'&w=100'; $my_image = array_values(getimagesize($fullpath)); list($width, $height, $type, $attr) = $my_image; Any ideas?

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • How can you represent a .NET DataType in a UML Diagram

    - by Blake Blackwell
    I am new to UML diagramming, but I'm trying to learn the ropes. Using a tool such as Visio or AgroUML how would you represent a .NET Datatype in your diagram? Two examples that I would like to do: DataTable List<MyObject> The only method I see right now is creating a class that represents a datatable. As far as representing collections, I can't find any method to do that. Thanks!

    Read the article

  • Formatting numbers in loop

    - by dave9909
    I want to list all numbers from 0000-9999 however I am having trouble holding the zero places. I tried: for(int i = 0; i <= 9999; ++i) { cout << i << "\n"; } but I get: 1,2,3,4..ect How can I make it 0001,0002,0003....0010, etc

    Read the article

  • Replace XML Bullet Points Found in Feed in Classic ASP

    - by StevieB
    Hey I am currently reading in a XML file which contains bullet list in the following container i.e. ? the average pension contribution rate for executive directors . I am having a problem with symbol directly before the text of each bullet point I want to remove it i.e Replace(text,"old","new") but i cant seem to find what value that bullet point actually is to replace of that makes sense. Thanks

    Read the article

  • Does my TPL partitioner cause a deadlock?

    - by Scott Chamberlain
    I am starting to write my first parallel applications. This partitioner will enumerate over a IDataReader pulling chunkSize records at a time from the data-source. protected class DataSourcePartitioner<object[]> : System.Collections.Concurrent.Partitioner<object[]> { private readonly System.Data.IDataReader _Input; private readonly int _ChunkSize; public DataSourcePartitioner(System.Data.IDataReader input, int chunkSize = 10000) : base() { if (chunkSize < 1) throw new ArgumentOutOfRangeException("chunkSize"); _Input = input; _ChunkSize = chunkSize; } public override bool SupportsDynamicPartitions { get { return true; } } public override IList<IEnumerator<object[]>> GetPartitions(int partitionCount) { var dynamicPartitions = GetDynamicPartitions(); var partitions = new IEnumerator<object[]>[partitionCount]; for (int i = 0; i < partitionCount; i++) { partitions[i] = dynamicPartitions.GetEnumerator(); } return partitions; } public override IEnumerable<object[]> GetDynamicPartitions() { return new ListDynamicPartitions(_Input, _ChunkSize); } private class ListDynamicPartitions : IEnumerable<object[]> { private System.Data.IDataReader _Input; int _ChunkSize; private object _ChunkLock = new object(); public ListDynamicPartitions(System.Data.IDataReader input, int chunkSize) { _Input = input; _ChunkSize = chunkSize; } public IEnumerator<object[]> GetEnumerator() { while (true) { List<object[]> chunk = new List<object[]>(_ChunkSize); lock(_Input) { for (int i = 0; i < _ChunkSize; ++i) { if (!_Input.Read()) break; var values = new object[_Input.FieldCount]; _Input.GetValues(values); chunk.Add(values); } if (chunk.Count == 0) yield break; } var chunkEnumerator = chunk.GetEnumerator(); lock(_ChunkLock) //Will this cause a deadlock? { while (chunkEnumerator.MoveNext()) { yield return chunkEnumerator.Current; } } } } IEnumerator IEnumerable.GetEnumerator() { return ((IEnumerable<object[]>)this).GetEnumerator(); } } } I wanted IEnumerable object it passed back to be thread safe (the .Net example was so I am assuming PLINQ and TPL could need it) will the lock on _ChunkLock near the bottom help provide thread safety or will it cause a deadlock? From the documentation I could not tell if the lock would be released on the yeld return. Also if there is built in functionality to .net that will do what I am trying to do I would much rather use that. And if you find any other problems with the code I would appreciate it.

    Read the article

  • Does an open source project need a news group?

    - by Daren Thomas
    I open-sourced a tool I created to scratch an itch. From the downloads for the installer on the project page I can see I'm not the only one interested. About 5 people seem to have upgraded from the previous version. But I know next to nothing about them. Do I need a news group? A mailing list? Or how would you start to build a (little) community?

    Read the article

  • Linux - Want To Check For Possible Duplicate Directories (Probably RegEx Needed)

    - by NoLongerHere
    Hi, I have a directory which contains several directories as follows: /Music/ /Music/JoeBlogs-Back_In_Black-1980 /Music/JoeBlogs-Back_In_Black-(Remastered)-2003 /Music/JoeBlogs-Back_In_Black-(ReIssue)-1987 /Music/JoeBlogs-Thunder_Man-1947 I want a script to go through and tell me when there are 'possible' duplicates, in the example above it would pick up the following as possible duplicates from the directory list: /Music/JoeBlogs-Back_In_Black-1980 /Music/JoeBlogs-Back_In_Black-(Remastered)-2003 /Music/JoeBlogs-Back_In_Black-(ReIssue)-1987 1) Is this possible? 2) If so please help!

    Read the article

  • What is the total amount of public IPv4 addresses?

    - by Earlz
    Yes, I am needing to know what the total number possible IPs in the public IPv4 space. I'm not sure where to even get a neat list of all the IP address ranges, so could someone point me to a resource to calculate this myself or calculate the total number of IPs for me? Also, by Public IPs I mean not counting reserved or private-range IP addresses.. Only the ones that can be access through the internet.

    Read the article

  • How do I force the download of a file which link is inside a GridView?

    - by murderdoll
    I have a Gridview that shows a list of files previously uploaded to the server with a HyperLink control to be able to download it, I need to force a download every time the user clicks on one of the provided links, so that the file does not open directly on the browser (they are usually images). Currently I have a side-server function that forces a download, but I do not know how to assign this function to each one of the links when the user clicks on it.

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • How to set the size of spinner

    - by Rakesh
    Hi Guys,I want to know how to set the size of spinner.When i added large values to spinner list,the spinner expands and as result it pushes the labelField to the further left. I want to know the how to set the spinner size to be a constant one

    Read the article

  • How to write a contains statement to match a member of a class?

    - by afuzzyllama
    If I have the following structure: Public Class UserData Public ID As String Public Name As String End Class How can I select it in a conditional like this? Dim myUsers As New List(Of UserData) If myUsers.Contains(.ID = "1") = True Then ... I know that myUsers.Contains(.ID = "1") is totally wrong, but I am curious how to do something like that? Is it possible? Is this a job for LINQ?

    Read the article

  • Silverlight MouseMove: find missing points during a movement

    - by Jalfp
    In an application in Silverlight I'm working on, I need to track the moves of the mouse. My problem is that using the MouseMove event, I don't have a continuous set of points if the user moves the mouse fast enough (if I add each point in a list I can have (10,10) en then (20,20)...) I'd like to have ALL points where the mouse has been during the move. Do you have any idea ?

    Read the article

  • shell command to find a process id and attach to it?

    - by lallous
    Hello I want to attach to a running process using 'ddd', what I manually do is: # ps -ax | grep PROCESS_NAME Then I get a list and the pid, then I type: # ddd PROCESS_NAME THE_PID Is there is a way to type just one command directly? Remark: When I type ps -ax | grep PROCESS_NAME <- grep will match both the process and grep command line itself.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 751 752 753 754 755 756 757 758 759 760 761 762  | Next Page >