Search Results

Search found 33140 results on 1326 pages for 'skip list'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 753/1326 | < Previous Page | 749 750 751 752 753 754 755 756 757 758 759 760  | Next Page >

  • How to set offset in GORM when using createCriteria?

    - by firnnauriel
    I'm just wondering if it's possible for 'createCriteria' to specify the paginateParams (i.e. offset) similar to dynamic finder (findAll, etc.) Note that this code is not working since 'offset' is not documented in http://www.grails.org/doc/1.2.1/ref/Domain%20Classes/createCriteria.html def c = SnbrItemActDistance.createCriteria() def results = c.list { eq('iid', newsId) ge('distance', cap) maxResults(count) offset(offset) order('distance', 'desc') }

    Read the article

  • Can Drupal terms in different Taxonomies be synonymous?

    - by DKinzer
    Let's say Taxonomy_A is associated to Node_Type_A Taxonomy_B is associated to Node_Type_B. AND Both Taxonomy_A and Taxonomy_B have a term called 'yellow'. Is it possible to make terms 'yellow' synonymous, so that if I'm looking at a list of 'yellow' stuff, I'm seeing content of both types (Node_Type_A, and Node_Type_B)?

    Read the article

  • WPF MVVM Cancel Edit

    - by terkri
    How can I implement cancelation of editing an object using MVVM. For example: I have a list of customers. I choose one customer an click the button "Edit", a dialog window(DataContext is binded to CustomerViewModel) opens and I start editing customer's fields. And then I decide to cancel editing, but the fields of the customer have been already changed, so how can I return a customer to its previous state in MVVM?

    Read the article

  • Summary of changes for each API level?

    - by MisterSquonk
    As the title says, are there any sources (web pages etc) of summarised changes at each API level? I have an app which I've put out to a small group of beta testers and I already fell foul of Environment.getExternalFilesDir(), which I hadn't noticed was introduced in API Level 8, when a couple of the guys tried it on Android v2.1 devices. The majority of my code should be pretty generic but it would be useful if I could find a condensed/summarised list/table or similar that I can quickly glance over.

    Read the article

  • which view/widget can support zooming in android?

    - by Sephy
    Hi everybody, I think my question is fairly clear, I would like to know if every kind of view can support zoom. I know that some have built in zoom controls like the MapView and the WebView, but how about a LinearLayout with some TextViews and ImageViews? I will edit this post to have a list of the answers.

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Unset/Change Binding in WPF

    - by captcalamares
    How can I unset the binding applied to an object so that I can apply another binding to it from a different location? Suppose I have two data templates binded to the same object reference. Data Template #1 is the default template to be loaded. I try to bind a button command to a Function1 from my DataContext class: <Button Content="Button 1" CommandParameter="{Binding }" Command="{Binding DataContext.Function1, RelativeSource={RelativeSource AncestorType={x:Type Window}}}"/> This actually works and the function gets binded. However, when I try to load Data Template # 2 to the same object (while trying to bind another button command to a different function (Function2) from my DataContext class): <Button Content="Button 2" CommandParameter="{Binding }" Command="{Binding DataContext.Function2, RelativeSource={RelativeSource AncestorType={x:Type Window}}}" /> It doesn't work and the first binding is still the one executed. Is there a workaround to this? EDIT (for better problem context): I defined my templates in my Window.Resources: <Window.Resources> <DataTemplate DataType="{x:Type local:ViewModel1}"> <local:View1 /> </DataTemplate> <DataTemplate DataType="{x:Type local:ViewModel2}"> <local:View2 /> </DataTemplate> </Window.Resources> The View1.xaml and the View2.xaml contain the button definitions that I described above (I want them to command the control of my process flow). ViewModel1 and ViewModel2 are my ViewModels that implement the interface IPageViewModel which is the type of my variable CurrentPageViewModel. In my XAML, I binded ContentControl to the variable CurrentPageViewModel: <ContentControl Content="{Binding CurrentPageViewModel}" HorizontalAlignment="Center"/> In my .CS, I have a list defined as List<IPageViewModel> PageViewModels, which I use to contain the instances of my two View Models: PageViewModels.Add(new ViewModel1()); PageViewModels.Add(new ViewModel2()); // Set starting page CurrentPageViewModel = PageViewModels[0]; When I try to change my CurrentPageViewModel to the other view model, this is when I want the new binding to work. Unfortunately, it doesn't. Am I doing things the right way?

    Read the article

  • SQL Update to the SUM of its joined values

    - by CL4NCY
    Hi, I'm trying to update a field in the database to the sum of its joined values: UPDATE P SET extrasPrice = SUM(E.price) FROM dbo.BookingPitchExtras AS E INNER JOIN dbo.BookingPitches AS P ON E.pitchID = P.ID AND P.bookingID = 1 WHERE E.[required] = 1 When I run this I get the following error: "An aggregate may not appear in the set list of an UPDATE statement." Any ideas?

    Read the article

  • Sort by ranking algorithm using will-paginate

    - by bearwithclaws
    I'm creating a digg-like site using Ruby on Rails that ranks the item (based on this algorithm). I'm using the will-paginate gem list the items in pages. The problem is, will-paginate only allows me to insert ':order =' based on the table data. I would like to make will-paginate to sort by a number which is calculated using a function based on different fields on the table (e.g number of votes, age hours). How can I do that?

    Read the article

  • Google maps sometimes does not return a geocoded value for string

    - by XGreen
    Hi Guys, I have the following code: It basically looks into a HTML list and geocodes and markets each item. it does it correctly 8 out of ten but sometimes I get an error I set for show in the console. I can't think of anything. Any thoughts is much appreciated. $(function () { var map = null; var geocoder = null; function initialize() { if (GBrowserIsCompatible()) { // Specifies that the element with the ID map is the container for the map map = new GMap2(document.getElementById("map")); // Sets an initial map positon (which mainly gets ignored after reading the adderesses list) map.setCenter(new GLatLng(37.4419, -122.1419), 13); // Instatiates the google Geocoder class geocoder = new GClientGeocoder(); map.addControl(new GSmallMapControl()); // Sets map zooming controls on the map map.enableScrollWheelZoom(); // Allows the mouse wheel to control the map while on it } } function showAddress(address, linkHTML) { if (geocoder) { geocoder.getLatLng(address, function (point) { if (!point) { console.log('Geocoder did not return a location for ' + address); } else { map.setCenter(point, 8); var marker = new GMarker(point); map.addOverlay(marker); // Assigns the click event to each marker to open its balloon GEvent.addListener(marker, "click", function () { marker.openInfoWindowHtml(linkHTML); }); } } ); } } // end of show address function initialize(); // This iterates through the text of each address and tells the map // to show its location on the map. An internal error is thrown if // the location is not found. $.each($('.addresses li a'), function () { var addressAnchor = $(this); showAddress(addressAnchor.text(), $(this).parent().html()); }); }); which looks into this HTML: <ul class="addresses"> <li><a href="#">Central London</a></li> <li><a href="#">London WC1</a></li> <li><a href="#">London Shoreditch</a></li> <li><a href="#">London EC1</a></li> <li><a href="#">London EC2</a></li> <li><a href="#">London EC3</a></li> <li><a href="#">London EC4</a></li> </ul>

    Read the article

  • How to export shell variable within perl script

    - by lamcro
    I have a shell script, with a list of shell variables, which is executed before entering a programming environment. I want to use a perl script to enter the programming environment: system("environment_defaults.sh"); system("obe"); but I when I enter the environment the variables are not set.

    Read the article

  • How to use Linq To Sql to get Users who has less than 2 photos?

    - by Mike108
    The scenario is I want to get the users who has less than 2 photos. There are two table: [Users] (UserId, UserName) [UserPhotos] (PhotoId, PhotoName, UserId) UserId is a Foreign Key but I do not want to use association like user.Photos. A user may have none photo in the [UserPhotos] table. How to use Linq To Sql to get List<User> who has less than 2 photos?

    Read the article

  • BFS algorithm problem

    - by Gorkamorka
    The problem is as follows: A wanderer begins on the grid coordinates (x,y) and wants to reach the coordinates (0,0). From every gridpoint, the wanderer can go 8 steps north OR 3 steps south OR 5 steps east OR 6 steps west (8N/3S/5E/6W). How can I find the shortest route from (X,Y) to (0,0) using breadth-first search? Clarifications: Unlimited grid Negative coordinates are allowed A queue (linked list or array) must be used No obstacles present

    Read the article

  • 2 roles, admin and user. Is using anything other than basic http auth overkill?

    - by juststarting
    I'm building my first website with rails,it consists of a blog, a few static pages and a photo gallery. The admin section has namespaced controllers. I also want to create a mailing list, collecting contact info, (maybe a spree store in the future too.) Should I just use basic http authentication and check if the user is admin? Or is a plugin like authlogic better, then define user roles even though there would only be two; admin and user?

    Read the article

  • IIS Directory Browing

    - by Zinx
    Hi All, If I enable directory browsing in IIS it displays folder contents to user. Is there any way of controlling the way it shows the list. For example, I dont want to show full physical path of the folder. Is it possible to achieve? If yes, how? Thanks.

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • How do I restrict foreign keys choices to related objects only in django

    - by Jeff Mc
    I have a two way foreign relation similar to the following class Parent(models.Model): name = models.CharField(max_length=255) favoritechild = models.ForeignKey("Child", blank=True, null=True) class Child(models.Model): name = models.CharField(max_length=255) myparent = models.ForeignKey(Parent) How do I restrict the choices for Parent.favoritechild to only children whose parent is itself? I tried class Parent(models.Model): name = models.CharField(max_length=255) favoritechild = models.ForeignKey("Child", blank=True, null=True, limit_choices_to = {"myparent": "self"}) but that causes the admin interface to not list any children.

    Read the article

  • Which JavaScript graphics library has the best performance?

    - by DNS
    I'm doing some research for a JavaScript project where the performance of drawing simple primitives (i.e. lines) is by far the top priority. The answers to this question provide a great list of JS graphics libraries. While I realize that the choice of browser has a greater impact than the library, I'd like to know whether there are any differences between them, before choosing one. Has anyone done a performance comparison between any of these?

    Read the article

  • How do I make Subversion (SVN) send email on checkins?

    - by Joe Ludwig
    I've always found checkin mails to be very useful for keeping track of what work other people are doing in the codebase. How do I set up SVN to email a distribution list on each checkin? Edit: I'm running clients on Windows and the server on Linux. The answers below for various platforms will likely be useful to other people though.

    Read the article

  • COM library for Explorer-like system views

    - by chrisd
    To provide a Windows Explorer-like view of the user's system, we have been using the shell controls from LogicNP (formerly Sky Software), but these have deficiencies, e.g., no support for Win7 libraries. The vendor has not responded to our inquiries about updates, so we're looking to replace the package. Requirements: ActiveX (no managed code or MFC) Tree and list views of the system Per-item checkboxes 32- and 64-bit versions Any recommendations for a replacement product? TIA.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 749 750 751 752 753 754 755 756 757 758 759 760  | Next Page >