Search Results

Search found 21343 results on 854 pages for 'pass by reference'.

Page 794/854 | < Previous Page | 790 791 792 793 794 795 796 797 798 799 800 801  | Next Page >

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • Create a timer countdown using hours, minutes & seconds from a future date

    - by Tommy Coffee
    I am using some code I found on the internet that creates a countdown from a certain date. I am trying to edit the code so that it only gives me a countdown from an hour, minute, and second that I specify from a future date. I cannot just have code that counts down from a specified time, I need it to countdown to a specified date in the future. This is important so that if the browser is refreshed the countdown doesn't start over but continues where left off. I will be using cookies so the browser remembers what future date was specified when it was first run. Here is the HTML: <form name="count"> <input type="text" size="69" name="count2"> </form> And here is the javascript: window.onload = function() { //change the text below to reflect your own, var montharray=new Array("Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec") function countdown(yr,m,d){ var theyear=yr; var themonth=m; var theday=d var today=new Date() var todayy=today.getYear() if (todayy < 1000) todayy+=1900; var todaym=today.getMonth() var todayd=today.getDate() var todayh=today.getHours() var todaymin=today.getMinutes() var todaysec=today.getSeconds() var todaystring=montharray[todaym]+" "+todayd+", "+todayy+" "+todayh+":"+todaymin+":"+todaysec futurestring=montharray[m-1]+" "+d+", "+yr var dd=Date.parse(futurestring)-Date.parse(todaystring) var dday=Math.floor(dd/(60*60*1000*24)*1) var dhour=Math.floor((dd%(60*60*1000*24))/(60*60*1000)*1) var dmin=Math.floor(((dd%(60*60*1000*24))%(60*60*1000))/(60*1000)*1) var dsec=Math.floor((((dd%(60*60*1000*24))%(60*60*1000))%(60*1000))/1000*1) if(dday==0&&dhour==0&&dmin==0&&dsec==1){ document.forms.count.count2.value=current return } else document.forms.count.count2.value= dhour+":"+dmin+":"+dsec; setTimeout(function() {countdown(theyear,themonth,theday)},1000) } //enter the count down date using the format year/month/day countdown(2012,12,25) } I am sure there is superfluous code above since I only need an hour, minute, and second that I would like to pass to the countdown() function. The year, month and day is unimportant but as I said this is code I am trying to edit which I found on the internet. Any help would be very appreciated. Thank you!

    Read the article

  • Backtracking infinite loop

    - by Greenhorn
    This is Exercise 28.1.2 from HtDP. I've successfully implemented the neighbors function and all test cases pass. (define Graph (list (list 'A (list 'B 'E)) (list 'B (list 'E 'F)) (list 'C (list 'D)) (list 'D empty) (list 'E (list 'C 'F)) (list 'F (list 'D 'G)) (list 'G empty))) (define (first-line n alist) (cond [(symbol=? (first alist) n) alist] [else empty])) ;; returns empty if node is not in graph (define (neighbors n g) (cond [(empty? g) empty] [(cons? (first g)) (cond [(symbol=? (first (first g)) n) (first-line n (first g))] [else (neighbors n (rest g))])])) ; test cases (equal? (neighbors 'A Graph) (list 'A (list 'B 'E))) (equal? (neighbors 'B Graph) (list 'B (list 'E 'F))) (equal? (neighbors 'C Graph) (list 'C (list 'D))) (equal? (neighbors 'D Graph) (list 'D empty)) (equal? (neighbors 'E Graph) (list 'E (list 'C 'F))) (equal? (neighbors 'F Graph) (list 'F (list 'D 'G))) (equal? (neighbors 'G Graph) (list 'G empty)) (equal? (neighbors 'H Graph) empty) The problem comes when I copy-paste the code from Figure 77 of the text. It is supposed to determine whether a destination node is reachable from an origin node. However it appears that the code goes into an infinite loop except for the most trivial case where the origin and destination nodes are the same. ;; find-route : node node graph -> (listof node) or false ;; to create a path from origination to destination in G ;; if there is no path, the function produces false (define (find-route origination destination G) (cond [(symbol=? origination destination) (list destination)] [else (local ((define possible-route (find-route/list (neighbors origination G) destination G))) (cond [(boolean? possible-route) false] [else (cons origination possible-route)]))])) ;; find-route/list : (listof node) node graph -> (listof node) or false ;; to create a path from some node on lo-Os to D ;; if there is no path, the function produces false (define (find-route/list lo-Os D G) (cond [(empty? lo-Os) false] [else (local ((define possible-route (find-route (first lo-Os) D G))) (cond [(boolean? possible-route) (find-route/list (rest lo-Os) D G)] [else possible-route]))])) Does the problem lie in my code? Thank you.

    Read the article

  • Route Angular to New Controller after Login

    - by MizAkita
    I'm kind of stuck on how to route my angular app to a new controller after login. I have a simple app, that uses 'loginservice'... after logging in, it then routes to /home which has a different template from the index.html(login page). I want to use /home as the route that displays the partial views of my flightforms controllers. What is the best way to configure my routes so that after login, /home is the default and the routes are called into that particular templates view. Seems easy but I keep getting the /login page when i click on a link which is suppose to pass the partial view into the default.html template: var app= angular.module('myApp', ['ngRoute']); app.config(['$routeProvider', function($routeProvider) { $routeProvider.when('/login', { templateUrl: 'partials/login.html', controller: 'loginCtrl' }); $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); }]); flightforms.config(['$routeProvider', function($routeProvider){ //sub pages $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); $routeProvider.when('/status', { templateUrl: 'partials/subpages/home.html', controller: 'statusCtrl' }); $routeProvider.when('/observer-ao', { templateUrl: 'partials/subpages/aobsrv.html', controller: 'obsvaoCtrl' }); $routeProvider.when('/dispatch', { templateUrl: 'partials/subpages/disp.html', controller: 'dispatchCtrl' }); $routeProvider.when('/fieldmgr', { templateUrl: 'partials/subpages/fieldopmgr.html', controller: 'fieldmgrCtrl' }); $routeProvider.when('/obs-backoffice', { templateUrl: 'partials/subpages/obsbkoff.html', controller: 'obsbkoffCtrl' }); $routeProvider.when('/add-user', { templateUrl: 'partials/subpages/users.html', controller: 'userCtrl' }); $routeProvider.otherwise({ redirectTo: '/status' }); }]); app.run(function($rootScope, $location, loginService) { var routespermission=['/home']; //route that require login $rootScope.$on('$routeChangeStart', function(){ if( routespermission.indexOf($location.path()) !=-1) { var connected=loginService.islogged(); connected.then(function(msg) { if(!msg.data) $location.path('/login'); }); } }); }); and my controllers are simple. Here's a sample of what they look like: var flightformsControllers = angular.module('flightformsController', []); flightforms.controller('fieldmgrCtrl', ['$scope','$http','loginService', function($scope,loginService) { $scope.txt='You are logged in'; $scope.logout=function(){ loginService.logout(); } }]); Any ideas on how to get my partials to display in the /home default.html template would be appreciated.

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • How to change the JSON output format and how to support chinese character?

    - by sky
    Currently I using the following code to get my JSON output from MySQL. <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT message FROM posts', $session); $somethings = array(); while ($row = mysql_fetch_assoc($result)) { $somethings[] = $row; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> And the output is: <script type="text/javascript"> var somethings= [{"message":"Welcome to Yo~ :)"},{"message":"Try iPhone post!"},{"message":"????"}]; </script> Here is the question, how can I change my output into format like : <script type="text/javascript"> userAge = new Array('21','36','20'), userMid = new Array('liuple','anhu','jacksen'); </script> Which I'll be using later with following code : var html = ' <table class="map-overlay"> <tr> <td class="user">' + '<a class="username" href="/' + **userMid[index]** + '" target="_blank"><img alt="" src="' + getAvatar(signImgList[index], '72x72') + '"></a><br> <a class="username" href="/' + **userMid[index]** + '" target="_blank">' + userNameList[index] + '</a><br> <span class="info">' + **userSex[index]** + ' ' + **userAge[index]** + '?<br> ' + cityList[index] + '</span>' + '</td> <td class="content">' + picString + somethings[index] + '<br> <span class="time">' + timeList[index] + picTips + '</span></td> </tr> </table> '; Thanks for helping and reading!

    Read the article

  • .NET datetime issue with SQL stored procedure

    - by DanO
    I am getting the below error when executing my application on a Windows XP machine with .NET 2.0 installed. On my computer Windows 7 .NET 2.0 - 3.5 I am not having any issues. The target SQL server version is 2005. This error started occurring when I added the datetime to the stored procedure. I have been reading alot about using .NET datetime with SQL datetime and I still have not figured this out. If someone can point me in the right direction I would appreciate it. Here is the where I believe the error is coming from. private static void InsertRecon(string computerName, int EncryptState, TimeSpan FindTime, Int64 EncryptSize, DateTime timeWritten) { SqlConnection DBC = new SqlConnection("server=server;UID=InventoryServer;Password=pass;database=Inventory;connection timeout=30"); SqlCommand CMD = new SqlCommand(); try { CMD.Connection = DBC; CMD.CommandType = CommandType.StoredProcedure; CMD.CommandText = "InsertReconData"; CMD.Parameters.Add("@CNAME", SqlDbType.NVarChar); CMD.Parameters.Add("@ENCRYPTEXIST", SqlDbType.Int); CMD.Parameters.Add("@RUNTIME", SqlDbType.Time); CMD.Parameters.Add("@ENCRYPTSIZE", SqlDbType.BigInt); CMD.Parameters.Add("@TIMEWRITTEN", SqlDbType.DateTime); CMD.Parameters["@CNAME"].Value = computerName; CMD.Parameters["@ENCRYPTEXIST"].Value = EncryptState; CMD.Parameters["@RUNTIME"].Value = FindTime; CMD.Parameters["@ENCRYPTSIZE"].Value = EncryptSize; CMD.Parameters["@TIMEWRITTEN"].Value = timeWritten; DBC.Open(); CMD.ExecuteNonQuery(); } catch (System.Data.SqlClient.SqlException e) { PostMessage(e.Message); } finally { DBC.Close(); CMD.Dispose(); DBC.Dispose(); } } Unhandled Exception: System.ArgumentOutOfRangeException: The SqlDbType enumeration value, 32, is invalid. Parameter name: SqlDbType at System.Data.SqlClient.MetaType.GetMetaTypeFromSqlDbType(SqlDbType target) at System.Data.SqlClient.SqlParameter.set_SqlDbType(SqlDbType value) at System.Data.SqlClient.SqlParameter..ctor(String parameterName, SqlDbType dbType) at System.Data.SqlClient.SqlParameterCollection.Add(String parameterName, SqlDbType sqlDbType) at ReconHelper.getFilesInfo.InsertRecon(String computerName, Int32 EncryptState, TimeSpan FindTime, Int64 EncryptSize, DateTime timeWritten) at ReconHelper.getFilesInfo.Main(String[] args)

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • Get data from aspx.cs page to aspx page.

    - by Brad8118
    So I am using a jquery plug in that allows me to change the order of things in a list by dragging and dropping them. So my goal is to be able to grab a list of my objects (AlertInfo) and using it in a javascript function. I was able to use a json webservice call in a test project to pass the data to the page. But we don't have a webservice page now so I tried to grab it from a aspx.cs page and it hasn't worked. ///Aspx page: $.ajax({ type: "POST", url: "~/Alerts/GetAlerts", data: "{}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (msg) { var data = eval("(" + msg.d + ")"); jQuery.each(data, function (rec) { AlertList[AlertList.length] = new objAlert(this.id, this.title, this.details, JSONDateSerializationFix(this.startdate), JSONDateSerializationFix(this.enddate)); UpdateDisplayList(); }) }, error: function (msg) { alert("BRAD" + msg); } The issue is that the Alerts page in "URL /Alerts/GetAlerts" is Alerts.aspx.cs. I can't figure out if I can use this ajax command to call a method in a aspx.cs page. //Code behind page aspx.cs [WebMethod] //[ScriptMethod(ResponseFormat = ResponseFormat.Json)] public string GetAlerts() { List list = AlertInfo.GetTestAlerts(); return new JavaScriptSerializer().Serialize(list); } public List GetAlertsList() { List list = AlertInfo.GetTestAlerts(); return list; ; } So I was hoping that I could load data into an asp control (dataList) and then grab the data //code behind page protected void Page_Load(object sender, EventArgs e) { dataListAlertList.DataSource = GetAlertsList(); dataListAlertList.DataBind(); } public static List<AlertInfo> GetTestAlerts() { List<AlertInfo> list = new List<AlertInfo>(); list.Add(new AlertInfo("0", "Alert 1 Title", "Alert 1 Detail", "10/10/2010", "10/10/2011")); list.Add(new AlertInfo("1", "Alert 2 Title", "Alert 2 Detail", "10/10/2010", "10/10/2011")); return list; } //.aspx page $(document).ready(function () { var a1 = $("#dataListAlertList").val(); // do fun stuff now. } But I keep getting undefined....

    Read the article

  • BizTalk - generating schema from Oracle stored proc with table variable argument

    - by Ron Savage
    I'm trying to set up a simple example project in BizTalk that gets changes made to a table in a SQL Server db and updates a copy of that table in an Oracle db. On the SQL Server side, I have a stored proc named GetItemChanges() that returns a variable number of records. On the Oracle side, I have a stored proc named Update_Item_Region_Table() designed to take a table of records as a parameter so that it can process all the records returned from GetItemChanges() in one call. It is defined like this: create or replace type itemrec is OBJECT ( UPC VARCHAR2(15), REGION VARCHAR2(5), LONG_DESCRIPTION VARCHAR2(50), POS_DESCRIPTION VARCHAR2(30), POS_DEPT VARCHAR2(5), ITEM_SIZE VARCHAR2(10), ITEM_UOM VARCHAR2(5), BRAND VARCHAR2(10), ITEM_STATUS VARCHAR2(5), TIME_STAMP VARCHAR2(20), COSTEDBYWEIGHT INTEGER ); create or replace type tbl_of_rec is table of itemrec; create or replace PROCEDURE Update_Item_Region_table ( Item_Data tbl_of_rec ) IS errcode integer; errmsg varchar2(4000); BEGIN for recIndex in 1 .. Item_Data.COUNT loop update FL_ITEM_REGION_TEST set Region = Item_Data(recIndex).Region, Long_description = Item_Data(recIndex).Long_description, Pos_Description = Item_Data(recIndex).Pos_description, Pos_Dept = Item_Data(recIndex).Pos_dept, Item_Size = Item_Data(recIndex).Item_Size, Item_Uom = Item_Data(recIndex).Item_Uom, Brand = Item_Data(recIndex).Brand, Item_Status = Item_Data(recIndex).Item_Status, Timestamp = to_date(Item_Data(recIndex).Time_stamp, 'yyyy-mm-dd HH24:mi:ss'), CostedByWeight = Item_Data(recIndex).CostedByWeight where UPC = Item_Data(recIndex).UPC; log_message(Item_Data(recIndex).Region, '', 'Updated item ' || Item_Data(recIndex).UPC || '.'); end loop; EXCEPTION WHEN OTHERS THEN errcode := SQLCODE(); errmsg := SQLERRM(); log_message('CE', '', 'Error in Update_Item_Region_table(): Code [' || errcode || '], Msg [' || errmsg || '] ...'); END; In my BizTalk project I generate the schemas and binding information for both stored procedures. For the Oracle procedure, I specified a path for the GeneratedUserTypesAssemblyFilePath parameter to generate a DLL to contain the definition of the data types. In the Send Port on the server, I put the path to that Types DLL in the UserAssembliesLoadPath parameter. I created a map to translate the GetItemChanges() schema to the Update_Item_Region_Table() schema. When I run it the data is extracted and transformed fine but causes an exception trying to pass the data to the Oracle proc: *The adapter failed to transmit message going to send port "WcfSendPort_OracleDBBinding_HOST_DATA_Procedure_Custom" with URL "oracledb://dvotst/". It will be retransmitted after the retry interval specified for this Send Port. Details:"System.InvalidOperationException: Custom type mapping for 'HOST_DATA.TBL_OF_REC' is not specified or is invalid.* So it is apparently not getting the information about the custom data type TBL_OF_REC into the Types DLL. Any tips on how to make this work?

    Read the article

  • .NET threading: how can I capture an abort on an unstarted thread?

    - by Groxx
    I have a chunk of threads I wish to run in order, on an ASP site running .NET 2.0 with Visual Studio 2008 (no idea how much all that matters, but there it is), and they may have aborted-clean-up code which should be run regardless of how far through their task they are. So I make a thread like this: Thread t = new Thread(delegate() { try { /* do things */ System.Diagnostics.Debug.WriteLine("try"); } catch (ThreadAbortException) { /* cleanup */ System.Diagnostics.Debug.WriteLine("catch"); } }); Now, if I wish to abort the set of threads part way through, the cleanup may still be desirable later on down the line. Looking through MSDN implies you can .Abort() a thread that has not started, and then .Start() it, at which point it will receive the exception and perform normally. Or you can .Join() the aborted thread to wait for it to finish aborting. Presumably you can combine them. http://msdn.microsoft.com/en-us/library/ty8d3wta(v=VS.80).aspx To wait until a thread has aborted, you can call the Join method on the thread after calling the Abort method, but there is no guarantee the wait will end. If Abort is called on a thread that has not been started, the thread will abort when Start is called. If Abort is called on a thread that is blocked or is sleeping, the thread is interrupted and then aborted. Now, when I debug and step through this code: t.Abort(); // ThreadState == Unstarted | AbortRequested t.Start(); // throws ThreadStartException: "Thread failed to start." // so I comment it out, and t.Join(); // throws ThreadStateException: "Thread has not been started." At no point do I see any output, nor do any breakpoints on either the try or catch block get reached. Oddly, ThreadStartException is not listed as a possible throw of .Start(), from here: http://msdn.microsoft.com/en-us/library/a9fyxz7d(v=VS.80).aspx (or any other version) I understand this could be avoided by having a start parameter, which states if the thread should jump to cleanup code, and foregoing the Abort call (which is probably what I'll do). And I could .Start() the thread, and then .Abort() it. But as an indeterminate amount of time may pass between .Start and .Abort, I'm considering it unreliable, and the documentation seems to say my original method should work. Am I missing something? Is the documentation wrong? edit: ow. And you can't call .Start(param) on a non-parameterized Thread(Start). Is there a way to find out if a thread is parameterized or not, aside from trial and error? I see a private m_Delegate, but nothing public...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • Programmatically Binding to a Property

    - by M312V
    I know it's a generic title, but my question is specific. I think it will boil down to a question of practice. So, I have the following code: public class Component : UIElement { public Component() { this.InputBindings.Add(new MouseBinding(SomeCommandProperty, new MouseGesture(MouseAction.LeftClick))); } } I could easily aggregate the ViewModel that owns SomeCommandProperty into the Component class, but I'm currently waiving that option assuming there is another way. Component is a child of ComponentCollection which is child of a Grid which DataContext is the ViewModel. ComponentCollection as the name suggests contains a collection of Components. <Grid Name="myGrid"> <someNamespace:ComponentCollection x:Name="componentCollection"/> </Grid> It's the same scenario as the XAML below, but with TextBlock. I guess I'm trying to replicate what's being done in the XAML below programatically. Again, Component's top most ancestor's DataContext is set to ViewModel. <Grid Name="myGrid"> <TextBlock Text="SomeText"> <TextBlock.InputBindings> <MouseBinding Command="{Binding SomeCommandProperty}" MouseAction="LeftClick" /> </TextBlock.InputBindings> </TextBlock> </Grid> Update 1 Sorry, I'm unable to comment because I lack the reputation points. Basically, I have a custom control which inherit from a Panel which children are a collection of Component. It's not a hack, like I've mentioned, I could directly have access to SomeCommandProperty If I aggregate the ViewModel into Component. Doing so, however, feels icky. That is, having direct access to ViewModel from a Model. I guess the question I'm asking is. Given the situation that Component's parent UIElement's DataContext is set to ViewModel, is it possible to access SomeCommandProperty without Component owning a reference to the ViewModel that owns SomeCommandProperty? Programatically, that is. Using ItemsControl doesn't change the fact that I still need to bind SomeCommandProperty to each Items.

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • Passing variables from PHP to Javascript back to PHP using Ajax.

    - by ObjectiveJ
    I hope this makes sesne, please bare with me. So I have a PHP page that contains variables, I have some radial boxes, and on click of them, it calculates a price for the item you have clicked on. I do this by activating a js function that I have passed some variables to. Like so. PHP: <?php $result = mssql_query("SELECT * FROM Segments ORDER BY 'Squares'"); if (!$result) { echo 'query failed'; exit; } while ($row = mssql_fetch_array($result)) { ?> <span><?php echo $row["Squares"]; ?></span><input name="squares" type="radio" onclick="ajaxCases('<?php echo $row["Squares"]; ?>', '<?php echo $row["StartCaseID"]; ?>', '<?php echo $row["StartMatrixPrice"]; ?>')" value="<?php echo $row["Squares"]; ?>"<?php if ($row["Squares"] == "1") { ?> checked="checked" <?php }else{ ?> checked="" <?php } ?>/> <?php } ?> As you can see onclick it goes to a function called ajaxcases, this function looks like this. function ajaxCases(squares,start,price){ $('#step1').html('<p style="margin:100px 0px 0px 100px"><img src="images/ajax-loader-bigindic.gif" width="32" height="32" alt="" /></p>'); $('#step1').load("ajax-styles.php?squares="+squares); prevId1 = ""; document.varsForm.caseid.value=start; $('#step1price').html('<span style="margin:0px 0px 0px 30px"><img src="images/ajax-loader-price.gif" width="24" height="24" alt="" /></span>'); $('#step1price').load("ajax-step1-price.php?Squares="+Squares); return true; } This then goes to a php page called ajax-step1-price.php and I try to recall the variable Squares. However it doesn't work, I thought it was a GET however that returns undefined. In Summary: I would like to know how to pass a variable from PHP to JS then back to PHP, or if someone could just tell me where I am going wrong that would be greatly appreciated.

    Read the article

  • Nested attributes form for model which belongs_to few models

    - by ExiRe
    I have few models - User, Teacher and TeacherLeader. class User < ActiveRecord::Base attr_accessible ..., :teacher_attributes has_one :teacher has_one :teacher_leader accepts_nested_attributes_for :teacher_leader end class Teacher < ActiveRecord::Base belongs_to :user has_one :teacher_leader end class TeacherLeader < ActiveRecord::Base belongs_to :user belongs_to :teacher end I would like to fill TeacherLeader via nested attributes. So, i do such things in controller: class TeacherLeadersController < ApplicationController ... def new @user = User.new @teacher_leader = @user.build_teacher_leader @teachers_collection = Teacher.all.collect do |t| [ "#{t.teacher_last_name} #{t.teacher_first_name} #{t.teacher_middle_name}", t.id ] end @choosen_teacher = @teachers_collection.first.last unless @teachers_collection.empty? end end And also have such view (new.html.erb): <%= form_for @user, :url => teacher_leaders_url, :html => {:class => "form-horizontal"} do |f| %> <%= field_set_tag do %> <% f.fields_for :teacher_leader do |tl| %> <div class="control-group"> <%= tl.label :teacher_id, "Teacher names", :class => "control-label" %> <div class="controls"> <%= select_tag( :teacher_id, options_for_select( @teachers_collection, @choosen_teacher )) %> </div> </div> <% end %> <div class="control-group"> <%= f.label :user_login, "Login", :class => "control-label" %> <div class="controls"> <%= f.text_field :user_login, :placeholder => @everpresent_field_placeholder %> </div> </div> <div class="control-group"> <%= f.label :password, "Pass", :class => "control-label" %> <div class="controls"> <%= f.text_field :password, :placeholder => @everpresent_field_placeholder %> </div> </div> <% end %> <%= f.submit "Create", :class => "btn btn-large btn-success" %> <% end %> Problem is that select form here does NOT appear. Why? Do i do something wrong?

    Read the article

  • Trouble with ASP.NET MVC auto-scaffolder template

    - by DanM
    I'm trying to write an auto-scaffolder template for Index views. I'd like to be able to pass in a collection of models or view-models (e.g., IQueryable<MyViewModel>) and get back an HTML table that uses the DisplayName attribute for the headings (th elements) and Html.Display(propertyName) for the cells (td elements). Each row should correspond to one item in the collection. Here's what I have so far: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl" %> <% var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; // How do I make this generic? var properties = items.First().GetMetadata().Properties .Where(pm => pm.ShowForDisplay && !ViewData.TemplateInfo.Visited(pm)); %> <table> <tr> <% foreach(var property in properties) { %> <th> <%= property.DisplayName %> </th> <% } %> </tr> <% foreach(var item in items) { HtmlHelper itemHtml = ????; // What should I put in place of "????"? %> <tr> <% foreach(var property in properties) { %> <td> <%= itemHtml.Display(property.DisplayName) %> </td> <% } %> </tr> <% } %> </table> Two problems with this: I'd like it to be generic. So, I'd like to replace var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; with var items = (IQueryable<T>)Model; or something to that effect. A property Html is automatically created for me when the view is created, but this HtmlHelper applies to the whole collection. I need to somehow create an itemHtml object that applies just to the current item in the foreach loop. I'm not sure how to do this, however, because the constructors for HtmlHelper don't take a Model object. How do I solve these two problems?

    Read the article

  • Using jQuery to store basic text string in mySQL base?

    - by Kenny Bones
    Could someone point me in the right direction here? Basically, I've got this jQuery code snippet: $('.bggallery_images').click(function () { var newBG = "url('" + $(this).attr('src'); var fullpath = $(this).attr('src'); var filename = fullpath.replace('img/Bakgrunner/', ''); $('#wrapper').css('background-image', newBG); // Lagre til SQL $.ajax({ url: "save_to_db.php", // The url to your function to handle saving to the db data: filename, dataType: 'Text', type: 'POST', // Could also use GET if you prefer success: function (data) { // Just for testing purposes. alert('Background changed to: ' + data); } }); }); This is being run when I click a certain button. So it's actually within a click handler. If I understand this correctly, this snippet takes the source if the image I just clicked and strips it so I end up with only the filename. If I do an alert(filename), I get the filename only. So this is working ok. But then, it does an ajax call to a php file called "save_to_db.php" and sends data: filename. This is correct right? Then, it does a callback which does an alert + data. Does this seem correct so far? Cause my php file looks like this: <?php require("dbconnect2.php"); $uploadstring = $_POST['filename']; $sessionid = $_SESSION['id']; echo ($sessionid); mysql_query("UPDATE brukere SET brukerBakgrunn = '$uploadstring' WHERE brukerID=" .$_SESSION['id']); mysql_close(); ?> When I click the image, the jQuery snippet fires and I get the results of this php file as output for the alert box. I think that the variables somehow are empty. Because notice the echo($sessionid); which is a variable I've created just to test what the session ID is. And it returns nothing. What could be the issue here? Edit: I just tried to echo out the $uploadstring variable as well and it also returns nothing. It's like the jQuery snippet doesn't even pass the variable on to the php file?

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Need some help synch'ing outer loop counter with dialog.onconfirm()

    - by Chris Barnhill
    I am writing a game for Facebook. IN the following code, I have a problem. I have a for loop executing, and in that loop, I call a dialog and implement 'onconfirm' for the dialog. The problem is that I need to access th e loop counter inside of the onconfirm function. But because the onconfirm is called outside of the scope of the for loop, the counter value is no longer valid because it's been incremented. I need some way to pass the counter value to the dialog onconfirm as it was at the time the dialog was displayed, not after the loop has finished. Or maybe someone has a better solution. Any help would be appreciated. Thanks. function unloadCargo() { //debugger; var actionPrompt = document.getElementById('action-prompt'); actionPrompt.setTextValue('Unloading cargo...'); var ajax = new Ajax(); ajax.responseType = Ajax.JSON; ajax.ondone = function(data) { debugger; if(data.unloadableCargo.length == 0) { loadCargo(); } else { //console.log('unloadable cargo='+dump(data.unloadableCargo)); var i = 0; var j = 0; var ucCount = data.unloadableCargo.length; for(i = 0; i < ucCount; i++) { cargoDialog = new Dialog(); cargoDialog.showChoice('Unload Cargo', 'Unload ' + data.unloadableCargo[i].goods_name + ' at ' + data.unloadableCargo[i].city_name + ' for ' + data.unloadableCargo[i].payoff + 'M euros?'); cargoDialog.onconfirm = function() { //console.log('unloadable cargo onconfirm='+dump(data.unloadableCargo)); var ajax = new Ajax(); var param = {"city_id": data.unloadableCargo[i].city_id, "goods_id": data.unloadableCargo[i].goods_id, "payoff": data.unloadableCargo[i].payoff}; ajax.ondone = function(demandData) { var demands = document.getElementById('demands'); var innerXhtml = '<span>'; for(var j = 0; j < demandData.demands.length; j++) { innerXhtml = innerXhtml + ' <div class="demand-item"><div class="demand-city">' + demandData.demands[j].city + '</div><div class="demand-pay">' + demandData.demands[j].cost + '</div><div class="demand-goods">' + demandData.demands[j].goods + '</div></div>'; } innerXtml = innerXhtml + ' </span>'; demands.setInnerXHTML(innerXhtml); // update balance loadCargo(); } ajax.post(baseURL + "/turn/do-unload-cargo", param); } cargoDialog.oncancel = function() { loadCargo(); } } //loadCargo(); } } ajax.post(baseURL + '/turn/unload-cargo'); }

    Read the article

  • NHibernate and objects with value-semantics

    - by Groo
    Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

< Previous Page | 790 791 792 793 794 795 796 797 798 799 800 801  | Next Page >