Search Results

Search found 28784 results on 1152 pages for 'start'.

Page 812/1152 | < Previous Page | 808 809 810 811 812 813 814 815 816 817 818 819  | Next Page >

• How to update JLabel in Swing?

  - by Roman

  I am trying to use Swing Timer and I wanted to start from a very simple program. I have a window with text: "You have n seconds", where n changes from 10 to 0 every second. I know how to generate a window with text. And I understand how Timer works (it starts an action periodically). But I cannot figure out how to combing this two things. Should I use that: JLabel label = new JLabel(myMessage); and then with timer I need to update the "myMessage" variable? But I think I need to "force" my window to "update" itself (to display a new value stored in "myMessage").

  Read the article

• how to adjust sliding of scroll according to the value calculated by me?

  - by cng

  I am working on scroll. I have made a program wherein if the scroll box is in particular range of the panel then it automatically moves to a particular position in the slider. For eg, I have a panel of size 500. the scroll has height of 100. Now the total intervals are 5. Now if i slide the scroll box at a position 225 then i want that it automatically slides to the start of that interval that is at position 200. or if i slide to position 450 then instead of staying there it goes to position 400. Is it possible?

  Read the article

• How long people take to learn a new programming language?

  - by Cawas

  In general aspects, this might be a good reference for everyone. Having an idea of how long people take in average for properly learning how to code can give a very good idea on how dense or long is the path. Someone who never programmed should take weeks or months, even years maybe while someone who's already experienced in the area and know at least 2 different languages might take days, hours or even minutes to start coding. But other than being able to write code that runs, there are ways to write the same program, and it's much harder to get deep knowledge on that than actually being able to program. And sometimes languages differ a lot from one to another on that aspect as well. For instance, we should never have to worry with code-injection in JavaScript like we do in C. So, is there any place we can see some good numbers for how long it takes to learn a language, maybe divided into level of knowledge categories, languages and paradigms, etc?

  Read the article

• sql query is too slow, how to improve speed

  - by user1289282

  I have run into a bottleneck when trying to update one of my tables. The player table has, among other things, id, skill, school, weight. What I am trying to do is: SELECT id, skill FROM player WHERE player.school = (current school of 4500) AND player.weight = (current weight of 14) to find the highest skill of all players returned from the query UPDATE player SET starter = 'TRUE' WHERE id = (highest skill) move to next weight and repeat when all weights have been completed move to next school and start over all schools completed, done I have this code implemented and it works, but I have approximately 4500 schools totaling 172000 players and the way I have it now, it would take probably a half hour or more to complete (did not wait it out), which is way too slow. How to speed this up? Short of reducing the scale of the system, I am willing to do anything that gets the intended result. Thanks! *the weights are the standard folk style wrestling weights ie, 103, 113, 120, 126, 132, 138, 145, 152, 160, 170, 182, 195, 220, 285 pounds

  Read the article

• Can JavaScript be overused?

  - by ledhed2222

  Hello stackoverflow, I'm a "long time reader first time poster", glad to start participating in this forum. My experience is with Java, Python, and several audio programming languages; I'm quite new to the big bad web technologies: HTML/CSS/JavaScript. I'm making two personal sites right now and am wondering if I'm relying on JavaScript too much. I'm making a site where all pages have a bit of markup in common--stuff like the nav bar and some sliced background images--so I thought I'd make a pageInit() function to insert the majority of the HTML for me. This way if I make a change later, I just change the script rather than all the pages. I figure if users are paranoid enough to have JavaScript turned off, I'll give them an alert or something. Is this bad practice? Can JavaScript be overused? Thanks in advance.

  Read the article

• Multiple HTTP request - Rails

  - by bradleyg

  My application checks a number of domains to see if they are valid (approx 100). I have the following code to check a single domain: def self.test_url uri, limit = 10 if limit == 0 return get_error_messages("001") end begin url = URI.parse(uri) response = Net::HTTP.start(url.host, url.port).request_head('/') rescue SocketError => e return get_error_messages("002") end case response when Net::HTTPRedirection then test_url(response['location'], limit - 1) else return get_error_messages(response.code) end end The code checks for the response code while taking into account redirects. This works fine. The only problem I have is when I put this in a loop I want it to run in parallel. So I don't have to wait for domain 1 to respond before I can request domain 2. I have managed this in PHP using curl_multi to run the requests in parallel. Is there a similar thing I can do in Rails?

  Read the article

• Find first cell in a row that contains a number?

  - by Dexter

  I'm working in Excel with an exported table such as this: |-------------------------------------------------------------------------------| | | A | B | C | D | E | F | G | H | I | |---|-------------------|-----|-----|-----|-----|-----|-------|-----|-----------| | 1 | Domain | JAN | FEB | MAR | APR | MAY | Start | End | Change | |---|-------------------|-----|-----|-----|-----|-----|-------|-----|-----------| | 2 | www.mydomain1.com | | 1 | 4 | 3 | 1 | 1 | 1 | 0 | |---|-------------------|-----|-----|-----|-----|-----|-------|-----|-----------| | 3 | www.mydomain2.com | 2 | 4 | 12 | 18 | 23 | 2 | 23 | 21 | |---|-------------------|-----|-----|-----|-----|-----|-------|-----|-----------| | 4 | www.mydomain3.com | | | 14 | 12 | | 14 | xxx | NOT FOUND | |-------------------------------------------------------------------------------| I'm trying to compare the current state (last cell) to the original cell (first cell with a value). In column I, I have the formula =IF(G2 = "xxx", "NOT FOUND", IF(H2 = "xxx", "NOT FOUND", H2 - G2)) In column H, I have the formula =IF(F2 = "", "xxx", F2) In column G, I need to find the first cell with a number. If there isn't one in that range, I need G to be "xxx". I suppose I only need to check for the first cell in the range (B2 to F2) that contains a value, not just a number. I tried using an Index and Match combo, but I couldn't quite understand it.

  Read the article

• best way to create tables with ORM?

  - by ajsie

  assume that i start coding an application from scratch, is the best way to create tables when using an ORM (doctrine), to manually create tables in mysql and then generate models from the tables, or is it the other way around, that is to create the models in php and then generate tables from models? and if i already have a database, will the models created be optimal? cause i have heard some say that its best to create the database from scratch when using ORM, so that the relations are optimized for OOD. share your thoughts!

  Read the article

• jQuery catch img

  - by Happy

  We have a script used for each .item: $(".item").each(function(){ item_link = "http://..."; block = $('.block', this); $.get(item_link, function(data) { var src = $('img.slide', data).attr('src'); block.html(src); }); }); item_link variable is uniquie for each query. There can be 100 .item or more. The problem is - server has limit on connections at the same time, that why some .item get var src, some not. The best solution is to use just one .get at the same time. I think there should be some counter, if .get is finished - it gives message "I'm finished, you can start" to the next .get and so on. How to do that? Thanks.

  Read the article

• How to add up amount of data from an external file in C# (Stream Reader)

  - by user2985995

  I'm new to this site, and pretty new to programming, at the moment I'm trying to display a count amount for the users names on my donation list, and then I also want to have a sum to work out the total amount of money the donation list contains, If someone could help me with creating a way to add up amount of donors on the donations.txt file that would be great help, I have no idea where to start, but so far this is my coding: string sName; double dAmount; string sTotalNames; double dAmountTotal; double dAmountAverage; using (StreamReader sr = new StreamReader("Donations.txt")) { while (sr.Peek() != -1) { sName = sr.ReadLine(); Console.WriteLine(sName); dAmount = Convert.ToDouble(sr.ReadLine()); Console.WriteLine(dAmount); } Console.WriteLine("Press any key to close"); Console.ReadKey(); }

  Read the article

• Sql Server related question

  - by stefan

  Hi guys, I have this thing that i need to do and some advices will be greatly appreciated. I have a Sql server table with some phone calls.For each phone call i have the start and end time. What i need to accomplish: a stored procedure which for a certain period of time, let's say 5 hours at a x interval, lets say 2 minutes returns the number of connected calls. Something like: Interval Nr of Calls Connected 01-01-2010 12:00:00 - 01-01-2010 12:05:00 30 01-01-2010 12:05:01 - 01-01-2010 12:10:00 10 ............. Which will be the fastest way to do that? Thank you for your help

  Read the article

• How to do simultaneous builds in two Git branches?

  - by james creasy

  I've looked at git-new-workdir, but I don't want the history to be shared because the branches have a release-main relationship. That is, changes in the release branch I want to propagate to the main line, but changes in the main line I don't want in the release line. A common pattern for me is to fix a bug in the release line, integrate it to the main line, then start builds in both branches at the same time. Is there a way to do this with git-new-workdir, do I need to clone, or is there a better solution? Thanks

  Read the article

• Struggling with how to compare hours with different time zones in Java?

  - by Riki

  Hi! I have 2 date object in the database that represent the company's working hours. I only need the hours but since I have to save date. it appears like this: Date companyWorkStartHour; Date companyWorkEndHour; start hours: 12-12-2001-13:00:00 finish hours: 12-12-2001-18:00:00 I have the timezone of the company and of the user. (my server may be in another timezone). TimeZone userTimeZone; TimeZone companyTimeZone; I need to check if the user's current time (considering his timezone) is within the company working hours (considering the company's time zone). How can I do it? I am struggling for over a week with Java calendar and with no success!

  Read the article

• How to step into the world of J2EE?

  - by Michael Lai

  I am new to J2ee. I have experience in Java core, JSP,Servlet, XML, HTML, What should i learn to step into the world of J2EE? Framework(Spring, Hibernate, Struts)? But the framework is too abstract for me.I saw lots of job post which requires frameworks, some jobs require EJB,JPA. I do not where to start. Any experts can give me hints on that? I found the tutorial of J2EE 5 published by ORACLE is not easy to understand. Too much jargon....

  Read the article

• Problem with CFNetRegister

  - by xtrahotsauce

  I'm trying to work with CFNetServices by trying to start up and publish a service asynchronously. I'm trying to use the example code from here: http://developer.apple.com/mac/library/documentation/Networking/Conceptual/NSNetServiceProgGuide/Articles/CFNetServices.html#//apple_ref/doc/uid/30001276-SW3, but CFNetRegisterWithOptions always fails. (CFNetRegister is deprecated now). When I print out the error struct, it looks like this: (gdb) p error $1 = { domain = 10, error = -72004 } Which doesn't seem correct to me. Does anyone know what might be wrong? Thanks!

  Read the article

• Scheduler for asp.net ?

  - by user359706

  Is there a schedule control in asp.net. What I need: column display: users Rows display : months and days. On clicking cell will open a popup In popup we can : - select a status in a dropdownList, - if the status is "be close" = two calendars ( date start and end) - then apply a color for the selected period. I know I would not find an exact need control, but I want a component that would be closest. Somethink like http://www.daypilot.org/ or http://www.codeproject.com/KB/webforms/EventCalendarControl.aspx. hoping to be clearly understandable. thank you for your help will be precious to me.

  Read the article

• Read options from file

  - by Devel

  I would like to write a function which will read values from a text file and write them to variables. For example my file is: mysql_server localhost mysql_user root mysql_passworg pospaz mysql_database testgenerator log log.txt username admin password abcd and I have the same variables as the first word in the line. So how to make the function read data from file and do sth like this: char *mysql_server = localhost; char *mysql_user = root; ... I have no idea even how to start writing it...

  Read the article

• Hibernate criterion Projection alias not being used

  - by sbzoom

  Do Hibernate Projection aliases even work? I could swear it just doesn't. At least, it doesn't do what I would expect it to do. Here is the java: return sessionFactory.getCurrentSession().createCriteria( PersonProgramActivity.class ).setProjection( Projections.projectionList().add( Projections.alias( Projections.sum( "numberOfPoints" ), "number_of_points" ) ).add( Projections.groupProperty( "person.id" ) ) ).setFirstResult( start ).setFetchSize( size ).addOrder( Order.desc( "numberOfPoints" ) ).list(); Here is the SQL that it generates: select sum(this_.number_of_points) as y0_, this_.person_id as y1_ from PERSON_PROGRAM_ACTIVITY this_ group by this_.person_id order by this_.number_of_points desc It doesn't seem to use the alias at all. I would think setting the alias would mean that "sum(this_.number_of_points)" would be aliased as "number_of_points" and not "y0_". Is there some trick I am missing? Thanks.

  Read the article

• Find all possible partitions of n elements with k-sized subsets, where two elements share same set o

  - by ypnos

  I have n=32 elements that need to be partitioned into 8 sets, each set has to hold exactly k=4 elements. I need to find all possible partitions with the constraint that each pair of elements only shares the same set once. So if I start with [1 2 3 4] [5 6 7 8] [...], all consecutive partitions cannot hold e.g. [1 2 X X] or [X X 1 3]. sets are unordered. Close to this problem are the stirling numbers of the second kind. However, they only solve the problem for arbitrarily sized sets.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Date range advanced count calculation in TSQL

  - by cihata87

  I am working on call center project and I have to calculate the call arrivals at the same time between specific time ranges. I have to write a procedure which has parameters StartTime, EndTime and Interval For Example: Start Time: 11:00 End Time: 12:00 Interval: 20 minutes so program should divide the 1-hour time range into 3 parts and each part should count the arrivals which started and finished in this range OR arrivals which started and haven't finished yet Should be like this: 11:00 - 11:20 15 calls at the same time(TimePeaks) 11:20 - 11:40 21 calls ... 11:40 - 12:00 8 calls ... Any suggestions how to calculate them?

  Read the article

• Jquey: select tag onchange function problem

  - by Syom

  i start learning jquery few days ago, and i like it very much. but now i have a problem, that can't solve alone. i have two selects <select id="select1"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> <select id="select2"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> i need to set #select2 the same value with #select1, when #select1 changes i've red some questions about select tag here, but i need to set "selected" attribute to that option, which have the same value. how can i do it? Thanks

  Read the article

• Ajax request. Which callback is executed first complete or success?

  - by Gutzofter

  I could spike this to find out, but I'm going to use SO. In my unit tests (qunit) I use the asynchShould (alias for asynchTest) test. Part of the assertion is to wait for the completion/success of the request. Like this: asyncShould('talk to customer list server', 1, function() { stop(2000); var forCustomerList = newCustomerListRequest(); forCustomerList.page = 'helpers/helper.php'; forCustomerList.data += '&action=customerListServer&DB=11001'; var originalSuccess = forCustomerList.success; forCustomerList.success = function(msg) { if (msg.flash !== undefined && msg.data !== undefined && msg.status !== undefined) { ok(true, 'json structure correct') } else { ok(false, 'json structure not correct'); } originalSuccess(msg); start(); }; testController.getServerData(forCustomerList); })

  Read the article

• Java ME Runnable object takes up memory although not made an instance yet

  - by user1646684

  I am facing a strange problem with memory in Java ME. here is a part of my code: int variable=1; while (true) { if (variable==2) { display = Display.getDisplay(this); MyCanvas mc = new MyCanvas(this); // MyCanvas is a runnable object mcT = new Thread(mc); // new thread for MyCanvas mc.repaint(); display.setCurrent(mc); mcT.start(); // run thread } if (variable==1) { // Do some other stuff } } The problem is that although still the variable is set to 1, so it does not come through the if (variable==2) condition the program consumes 300kB more memory than when I delete the code after condition if (variable==2). As far as I know the code should by executed and the objects shall be created only when I set variable to value 2. But it consumes the memory also when the code after condition "if (variable==2)" is not executed. Why does this happen?

  Read the article

• Creating a page selector with JSP/JSTL

  - by zakSyed

  I am working on a project where I am required to build a page somewhat similar to the one you see when you visit a website like blockbuster. When you click on browse more you are taken to a page with a bar on top with different page numbers and a drop down to select the number of pages you want to view on that page. I want to include a feature like that on my page but I am not sure where to start. In my page I have list of 200 items which I want to display page by page. I was suggested to use custom tags, but is there a more simpler or efficient way to create that functionality. My web application uses Spring MVC framework and is coded entirely in Java. Any suggestions will be appreciated.

  Read the article

< Previous Page | 808 809 810 811 812 813 814 815 816 817 818 819  | Next Page >