Search Results

Search found 28784 results on 1152 pages for 'start'.

Page 813/1152 | < Previous Page | 809 810 811 812 813 814 815 816 817 818 819 820  | Next Page >

• JQuery .each() backwards

  - by Jack Mills

  Hi, I'm using JQuery to select some elements on a page and then move them around in the DOM. The problem I'm having is I need to select all the elements in the reverse order that JQuery naturally wants to select them. For example: <ul> <li>Item 1</li> <li>Item 2</li> <li>Item 3</li> <li>Item 4</li> <li>Item 5</li> </ul> I want to select all the li items and use the .each() command on them but I want to start with Item 5, then Item 4 etc. Is this possible? Thanks

  Read the article

• Call an AsyncTask inside a Thread

  - by Arun

  I am working in an android application and I want to call an AsyncTask from my UI main thread. For that I want to call my AsyncTask from a thread. This is the method that I call from my main UI thread. This is working correctly CommonAysnk mobjCommonAysnk = new CommonAysnk(this, 1); mobjCommonAysnk.execute(); CommonAysnk is my AsyncTask class.I want to pass my activity and an integer parameter to the AsyncTask constructor. How can I call this from a thread as shown below method. Thread t = new Thread() { public void run() { try { CommonAysnk mobjCommonAysnk = new CommonAysnk(this, 1); mobjCommonAysnk.execute(); } catch (Exception ex) { }}}; t.start(); When I tried to call it from a Thread and I am not able to pass the activity parameter correctly. How can we sole this. Thanks

  Read the article

• How to add up amount of data from an external file in C# (Stream Reader)

  - by user2985995

  I'm new to this site, and pretty new to programming, at the moment I'm trying to display a count amount for the users names on my donation list, and then I also want to have a sum to work out the total amount of money the donation list contains, If someone could help me with creating a way to add up amount of donors on the donations.txt file that would be great help, I have no idea where to start, but so far this is my coding: string sName; double dAmount; string sTotalNames; double dAmountTotal; double dAmountAverage; using (StreamReader sr = new StreamReader("Donations.txt")) { while (sr.Peek() != -1) { sName = sr.ReadLine(); Console.WriteLine(sName); dAmount = Convert.ToDouble(sr.ReadLine()); Console.WriteLine(dAmount); } Console.WriteLine("Press any key to close"); Console.ReadKey(); }

  Read the article

• Hibernate criterion Projection alias not being used

  - by sbzoom

  Do Hibernate Projection aliases even work? I could swear it just doesn't. At least, it doesn't do what I would expect it to do. Here is the java: return sessionFactory.getCurrentSession().createCriteria( PersonProgramActivity.class ).setProjection( Projections.projectionList().add( Projections.alias( Projections.sum( "numberOfPoints" ), "number_of_points" ) ).add( Projections.groupProperty( "person.id" ) ) ).setFirstResult( start ).setFetchSize( size ).addOrder( Order.desc( "numberOfPoints" ) ).list(); Here is the SQL that it generates: select sum(this_.number_of_points) as y0_, this_.person_id as y1_ from PERSON_PROGRAM_ACTIVITY this_ group by this_.person_id order by this_.number_of_points desc It doesn't seem to use the alias at all. I would think setting the alias would mean that "sum(this_.number_of_points)" would be aliased as "number_of_points" and not "y0_". Is there some trick I am missing? Thanks.

  Read the article

• Facing problem in configuring Reporting Server

  - by idrees99

  Hi all, I am using Sql server 2005 express edition and i want to Install and configure Reporting server on my local machine.Now i have installed the reporting server but the issue is that i am unable to configure it properly.when ever i go to start the reporting services it gives me the following message: THE SQL SERVER REPORTING SERVICE(SQLEXPRESS)service on Local computer started and then stopped. Some services stop automatically if they have no work to do, for example, the performance Logs and Alerts service. I am using WindowsXp Professional. plz help me out as i have just started using sql server and i dont have any idea.

  Read the article

• database encryption questions

  - by 5YrsLaterDBA

  We are using Sybase SQL Anywhere 11. We need to encrypt some of our tables in our database. I followed the instruction and did it. We selected the "strong" option with encryptionKey and AES256_FIPS algorithm. But there are something I am not clear about them. It will require encryptonKey when we create the database, remove the database and start the database server but it will NOT require encryptionKey when we stop the database server and connect to the server to create tables and add data. Why there is NO encryptionKey asked when we connect to it or try to stop the server? I am doing something wrong? don't know how to test the encryption? I still can see all plain text in the encrypted tables when I use Sybase Central tool. If somebody knows the database user name and password, he/she can connect to the database and read the content without the encryptionKey. is this right?

  Read the article

• Windows service installed successfully but not responding after started.

  - by Ridhi

  I have a windows service written in C#, .Net framework 2.0. I installed it on three machines and it worked fine but on one machine (with .Net framework 2.0) the setup has installed the service successfully but the service is not responding after I start it. I check for this by checking whether a log file is created at a specific path insribed in the config file or not. This log file is created everytime the timer elapses the interval time. I'm unable to figure out the reason. Have checked all the parameters but unable to get any solution to this. The funny thing is that the same setup is running well on other machines. P.S.: I have admin access on all the servers I'm installing this service on.

  Read the article

• Is It possible to change dynamically delay on a Scheduled Poller in Camel via JMX?

  - by sebbrousse

  I would like to set/change the delay of a File consumer at runtime through JMX. I am able to change the value of the property but it doesn't seem to be taken into account until I restart the consumer. Example with the camel-archetype-java and its basic file example: Run It Change the delay of the File Consumer by calling the setDelay Operation with the JConsole Delay property of the Consumer is changed but logs show it continues to poll at 500ms by default Stop/Start the consumer New value of delay is used by the consumer Do I need anothers steps or active any configuration to make it work at runtime?

  Read the article

• Is "programmatically" a word? [closed]

  - by Lo'oris

  I can't find it on any of the online dictionaries I know: dict.org, word reference, urban dictionary, oxford paravia, garzanti. To my ears of a non-native speaker, it sounds horrible. Actually it sounds like a word made-up by another non-native speaker that wanted to say something, didn't know how, and just hacked in a word of his language. The only place I've read it other then user-created-content is the android documentation, so this might or might not be related. Do you happen to know where did it start to be used, why by did it spread so much, what does it really mean?

  Read the article

• using drupal 6 or 7 for a new PHP web application?

  - by ajsie

  if i create a new web application tomorrow, should i use Drupal 6 or 7? i have never used drupal before so i have to start learning it first (very familiar with PHP) so i can understand the basics and how to extend it. my concerns for using 7: no modules contributed yet? so i dont have all the fancy stuff i can add like in Drupal 6? no good documentation and lack of web tutorials? how could i learn about it if there is not that much support? too early in the development process? it's not stable enough? i would like to use 7 cause i dont want to relearn everything and 7 is indeed just around the corner. but im afraid that it lacks all other stuff version 6 has. could someone guide me into right direction? thanks

  Read the article

• HTML5 drag upload in new window

  - by user463604

  I have setup an HTML5 drag and drop upload into my site. The problem that I have is when a user is uploading a large file, they must wait for the upload to finish before navigating and using the rest of the site. So, what I'd like to do is allow the user to drag files to the main site and then have it automatically open a new window and start the upload there so they can still use the rest of the site while the upload is happening. Anyone have and advice on how to accomplish this or if it can even be done?

  Read the article

• SqlDataAdapter.Fill suddenly taking a long time

  - by WraithNath

  I have an application with a central DataTier that can execute a query to a data table using an SQLDataAdapter. None of this code has changed but now all queries are taking at least 10x as long to execute a query returning even one record. The only difference is that I have been using the app in a VM but the issue has started mid way through using the application. eg, the speed issue has not manifested itself from the start of using the VM, rather half way through. Has anyone else had an issue with the SQL Data Adapter taking a long time to fill for no reason? executing the query in Management studio it runs in less than a second. Firewalls are disabled

  Read the article

• Initializing a array after declaration

  - by robUK

  Hello, gcc 4.4.3 c89 I have the following code as a sample of what I am trying to do. I don't know the actual size of the array, until I enter the function. However, I don't think I can set the array size after I have declared it. I need it global as some other functions will need to access the device names. Many thanks for any suggestions, /* global */ char *devices_names[]; void fill_devices(size_t num_devices) { devices_names[num_devices]; /* start filling */ }

  Read the article

• How much Java should I have learnt before trying Android programming?

  - by Sidney Yin

  Hi - I have been seeking beginner learning books in Android, and of course found out that I should learn Java first. So I began studying Java and now I am quite comfortable with objects, classes, inheritance, interfaces, and just moved onto Layouts in Swing as well as Swing Features. But I am starting to wonder.... do I know enough about Java now? Can I start programming Android yet? Of course I can keep going in Java, but have been itching to begin programming Android apps. Any definitive answer here about how much Java I need to know before Android? Thanks so much!

  Read the article

• fetching savedInstanceState values, nullpointerexception

  - by Johan

  @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main2); savedInstanceState.putString("foo", "bar"); } @Override public void onRestoreInstanceState(Bundle savedInstanceState) { super.onRestoreInstanceState(savedInstanceState); String myString = savedInstanceState.getString("foo"); Log.i("debug", "saved data: " + myString); } Im trying to preserve some values in an activity, but i recieve the following error: 06-23 23:09:44.038: E/AndroidRuntime(17584): java.lang.RuntimeException: Unable to start activity ComponentInfo{se.johanberntsson.activitytest/se.johanberntsson.activitytest.TestActivity}: java.lang.NullPointerException What did I miss here? Thanks

  Read the article

• Wordpress Custom Type permalink containing Taxonomy slug

  - by treznik

  I'm trying to create a permalink pattern for a Custom Type, that includes one of its taxonomies. The taxonomy name is known from the start (so I'm not trying to add or mix all of its taxonomies, just a specific one), but the value will by dynamic, of course. Normally, the Custom Type permalink is built using the rewrite arg with the slug param, but I don't see how I could add a dynamic variable in there. http://codex.wordpress.org/Function_Reference/register_post_type I'm guessing a custom solution is required, but I'm not sure what the best unintrusive approach would be. Is there a known practice for this or has anyone built something similar recently? I'm using WP 3.2.1 btw.

  Read the article

• How to programmatically switch to a specific window in compiz?

  - by FossilBit

  Is there a command to tell compiz that we want to bring in front and set focus to a specific window? How should we identify the window in that command? The reason behind this question is the following use-case: Suppose we have a wiki to keep notes of anything interesting we find out. It would be very convenient to have a keyboard shortcut to bring the browser window with our Wiki page in front and start typing immediately then with another key combination switch to the application we were working before I know that "ALT+TAB" switches between the last two used windows but cannot support more complex combinations of applications. E.g Browser+Eclipse+ Wiki If there is a command like the one described, it is easy to add a shortcut to it from KDE or GNOME interface Thanx ...

  Read the article

• sql query is too slow, how to improve speed

  - by user1289282

  I have run into a bottleneck when trying to update one of my tables. The player table has, among other things, id, skill, school, weight. What I am trying to do is: SELECT id, skill FROM player WHERE player.school = (current school of 4500) AND player.weight = (current weight of 14) to find the highest skill of all players returned from the query UPDATE player SET starter = 'TRUE' WHERE id = (highest skill) move to next weight and repeat when all weights have been completed move to next school and start over all schools completed, done I have this code implemented and it works, but I have approximately 4500 schools totaling 172000 players and the way I have it now, it would take probably a half hour or more to complete (did not wait it out), which is way too slow. How to speed this up? Short of reducing the scale of the system, I am willing to do anything that gets the intended result. Thanks! *the weights are the standard folk style wrestling weights ie, 103, 113, 120, 126, 132, 138, 145, 152, 160, 170, 182, 195, 220, 285 pounds

  Read the article

• Creating a page selector with JSP/JSTL

  - by zakSyed

  I am working on a project where I am required to build a page somewhat similar to the one you see when you visit a website like blockbuster. When you click on browse more you are taken to a page with a bar on top with different page numbers and a drop down to select the number of pages you want to view on that page. I want to include a feature like that on my page but I am not sure where to start. In my page I have list of 200 items which I want to display page by page. I was suggested to use custom tags, but is there a more simpler or efficient way to create that functionality. My web application uses Spring MVC framework and is coded entirely in Java. Any suggestions will be appreciated.

  Read the article

• How to read output of android process command

  - by kevdliu

  I am trying to get the output of android shell command 'getprop' with java since getprop() always returns null no matter what. I tried this from developer.android.com: Process process = null; try { process = new ProcessBuilder() .command("/system/bin/getprop", "build.version") .redirectErrorStream(true) .start(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } InputStream in = process.getInputStream(); //String prop = in.toString(); System.out.println(in); process.destroy(); However what is printed is not the output but a bunch of characters and numbers (dont have the exact output right now). How can i get the output of the process? Thanks!

  Read the article

• Why Hadoop is tightly bound to linux?

  - by user1676346

  I am new with Hadoop. What are the specific reasons why Hadoop is so tightly bound with Linux, and the cluster it runs upon is homogeneous? I'm looking for really specific details that can tell me why Hadoop does not work well with windows, and if there are some libraries some specific scripts that are involved? My project is to deploy Hadoop without using Cygwin. I have already seen the article from Hayes Davis where he explained how to install Hadoop without Cygwin, but he said that there are some bugs. I might start from scratch to properly configure Hadoop on Windows, but if any one can explain what, specifically, are the reasons that Hadoop doesn't work well on windows that would be very helpful.

  Read the article

• AtomicInteger for limited sequnce generation

  - by satish

  How can we use AtomicInteger for limited sequence generation say the sequence number has to be between 1 to 60. Once the sequece reaches 60 it has to start again from 1. I wrote this code though not quite sure wether this is thread safe or not? public int getNextValue() { int v; do { v = val.get(); if ( v == 60) { val.set(1); } } while (!val.compareAndSet(v , v + 1)); return v + 1; }

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• The *right* JSON content type?

  - by Oli

  Right I've been messing around with JSON for some time, just pushing it out as text and it hasn't hurt anybody (I know of), but I'd like to start doing things properly. I have seen so many purported "standards" for the JSON content type: application/json application/x-javascript text/javascript text/x-javascript text/x-json But which is right? Or best? I gather that there are security and browser support issues varying between them... (I know there's a similar question, What MIME type if JSON is being returned by a REST API?, but I'd like a slightly more targeted answer.)

  Read the article

• Returning a href within a string

  - by user701254

  How can I return a href within a string, I can access the start position but not sure how to get last position : Here is what I have so far : String str = "sadf ad fas dfa http:\\www.google.com sdfa sadf as dfas"; int index = str.indexOf("http"); String href = str.substring(index , ???); What should the end index be ? Note, this is targeted at j2me & I need to minimise download footprint so I cannot use regular expressions or third party regular expressions libraries.

  Read the article

< Previous Page | 809 810 811 812 813 814 815 816 817 818 819 820  | Next Page >