Search Results

Search found 28784 results on 1152 pages for 'start'.

Page 815/1152 | < Previous Page | 811 812 813 814 815 816 817 818 819 820 821 822  | Next Page >

  • Feedback + Bad output

    - by user1770094
    So I've got an assignment I think I'm more or less done with, but there is something which is messing up the output badly somewhere down the line, or even the calculation, and I don't see where the problem is. The assignment is to make a game in which a certain ammount of players run up through a tunnel towards a spot,where they will stop and spin around it,and then their dizziness is supposed to make them randomly either progress towards goal or regress back towards start.And each time they get another spot closer to goal,they get another "marking",and it goes on like this until one of them reaches goal. The program includes three files: one main.cpp,one header file and another cpp file. The header file: #ifndef COMPETITOR_H #define COMPETITOR_H #include <string> using namespace std; class Competitor { public: void setName(); string getName(); void spin(); void move(); int checkScore(); void printResult(); private: string name; int direction; int markedSpots; }; #endif // COMPETITOR_H The second cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void Competitor::setName() { cin>>name; } string Competitor::getName() { return name; } void Competitor::spin() { srand(time(NULL)); direction = rand()%1+0; } void Competitor::move() { if(direction == 1) { markedSpots++; } else if(direction == 0 && markedSpots != 0) { markedSpots--; } } int Competitor::checkScore() { return markedSpots; } void Competitor::printResult() { if(direction == 1) { cout<<" is heading towards goal and has currently "<<markedSpots<<" markings."; } else if(direction == 0) { cout<<"\n"<<getName()<<" is heading towards start and has currently "<<markedSpots<<" markings."; } } The main cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void inputAndSetNames(Competitor comps[],int nrOfComps); void makeTwist(Competitor comps[],int nrOfComps); void makeMove(Competitor comps[],int nrOfComps); void showAll(Competitor comps[],int nrOfComps); int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces); int main() { int nrOfTwistPlaces; int nrOfComps; int noWinner = -1; int laps = 0; cout<<"How many spinning places should there be? "; cin>>nrOfTwistPlaces; cout<<"How many competitors should there be? "; cin>>nrOfComps; Competitor * comps = new Competitor[nrOfComps]; inputAndSetNames(comps, nrOfComps); do { laps++; cout<<"\nSpin "<<laps<<":"; makeTwist(comps, nrOfComps); makeMove(comps, nrOfComps); showAll(comps, nrOfComps); }while(noWinner == -1); delete [] comps; return 0; } void inputAndSetNames(Competitor comps[],int nrOfComps) { cout<<"Type in the names of the "<<nrOfComps<<" competitors:\n"; for(int i=0;i<nrOfComps;i++) { comps[i].setName(); } cout<<"\n"; } void makeTwist(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].spin(); } } void makeMove(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].move(); } } void showAll(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].printResult(); } cout<<"\n\n"; system("pause"); } int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces) { int end = 0; int score = 0; for(int i=0;i<nrOfComps;i++) { score = comps[i].checkScore(); if(score == nrOfTwistPlaces) { end = 1; } else end = -1; } return end; } I'd be grateful if you would point out other mistakes if you see any.Thanks in advance.

    Read the article

  • Problems to make programming more interesting for school students [closed]

    - by Jomoos
    I have to teach Java programming to school students and all are around the age of 15. None of them had any previous experience in programming. That is, I have to start from the very basics. I do like to make the sessions more interesting, and to make them love programming. I do need simple problems or puzzles -- not complex ones, simple ones -- that can increase their curiosity, and made them think and love programming. I do like to have problems for all of the concepts (like branching, looping, encapsulation, inheritance, composition, etc.,). Notes: I do have a time-frame of 1 hour for each session. Computers are not available. Maybe I can bring my laptop and show a demo to them. There are 7 students in the class.

    Read the article

  • the problem of redirecting stdout in c#

    - by Mher
    Could you please explain why the shell redirection doesn't work with System.Diagnostics.Process class? I am trying to redirect the output streams to file with the following snippet: Process p = new Process(); p.StartInfo = new ProcessStartInfo(); p.StartInfo.FileName = "java.exe"; p.StartInfo.Arguments = @"> c:\Temp\test.log 2>&1"; p.StartInfo.UseShellExecute = true; p.Start(); The similar code works without problems with Python. Reading the output streams programmatically doesn't seem a preferable solution in my case because there will be a bunch of processes launched by my application.

    Read the article

  • multi directional scrolling site

    - by user557318
    Ive been asked if i am able to program a multi directional scrolling site like this- COS only using wordpress. Initially i thought i may be flash but the source seems like it could be simple, possibly with elements of jquery. . . . . I am unable to find any themes that even come close to it. And initially i wanted to know how it has been achieved to see if i am able to start the design work any ideas how this has been achieved. More to the point if the multi scrolling could be applied on wordpress

    Read the article

  • Dividing n-bit binary integers

    - by Julian
    Was wondering if anyone could help me with creating a pseudocode for how to go about dividing n-bit binary integers. Here is what I'm thinking could possibly work right now, could someone correct this if I'm wrong: divide (x,y) if x=0: return (0,0) //(quotient, remainder) (q,r) = divide(floor(x/2), y) q=2q, r=2r if x is odd: r = r+1 if r >= y: r = r-y, q = q+1 return (q,r) Would you guys say that this general pseudocode algorithm would accomplish the intended task of dividing n-bit numbers or am I missing something in my psuedocode before I start coding up something that's wrong?

    Read the article

  • Is "programmatically" a word? [closed]

    - by Lo'oris
    I can't find it on any of the online dictionaries I know: dict.org, word reference, urban dictionary, oxford paravia, garzanti. To my ears of a non-native speaker, it sounds horrible. Actually it sounds like a word made-up by another non-native speaker that wanted to say something, didn't know how, and just hacked in a word of his language. The only place I've read it other then user-created-content is the android documentation, so this might or might not be related. Do you happen to know where did it start to be used, why by did it spread so much, what does it really mean?

    Read the article

  • Tests that are 2-3 times bigger than the testable code

    - by HeavyWave
    Is it normal to have tests that are way bigger than the actual code being tested? For every line of code I am testing I usually have 2-3 lines in the unit test. Which ultimately leads to tons of time being spent just typing the tests in (mock, mock and mock more). Where are the time savings? Do you ever avoid tests for code that is along the lines of being trivial? Most of my methods are less than 10 lines long and testing each one of them takes a lot of time, to the point where, as you see, I start questioning writing most of the tests in the first place. I am not advocating not unit testing, I like it. Just want to see what factors people consider before writing tests. They come at a cost (in terms of time, hence money), so this cost must be evaluated somehow. How do you estimate the savings created by your unit tests, if ever?

    Read the article

  • Looking for a tutorial and/or example for the following: Annotation based Spring 3 with JPA and/or h

    - by Conor
    I want to learn Spring. I'd like to start with Spring 3. I want a simple tutorial and/or example. So no full blown web example please. Also - not a trivial example - so something incorporating persistence (e.g. JPA or hibernate) would be nice. Also - I don't want to get bogged down writing XML. So - Annotation based Spring 3 with JPA and/or hibernate. Yes - there is a good reference for Spring 3.0, but it's XML based. I can't find anything else useful. Thanks in advance.

    Read the article

  • Autostart application/process in WP7

    - by sv88erik
    How is it possible to auto start my application or run a process when the user turns on the phone. If you look at ex. Outloock WP7 included in the operating system then updates the icon so that you can see that there are new mail. This is a process in the background running. But I've read a bit about this now, but can not find out that this is possible using the SDK from Microsoft? Is it not possible?? If possible, how does one do that? Notice: I do not want any solution that involves jailbreak.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • database encryption questions

    - by 5YrsLaterDBA
    We are using Sybase SQL Anywhere 11. We need to encrypt some of our tables in our database. I followed the instruction and did it. We selected the "strong" option with encryptionKey and AES256_FIPS algorithm. But there are something I am not clear about them. It will require encryptonKey when we create the database, remove the database and start the database server but it will NOT require encryptionKey when we stop the database server and connect to the server to create tables and add data. Why there is NO encryptionKey asked when we connect to it or try to stop the server? I am doing something wrong? don't know how to test the encryption? I still can see all plain text in the encrypted tables when I use Sybase Central tool. If somebody knows the database user name and password, he/she can connect to the database and read the content without the encryptionKey. is this right?

    Read the article

  • WP7 How to use a Storyboard

    - by Subby
    I wish to stop using the DispatcherTimer to show animations as that is extremely unpredictable. Instead, I want to start using a Storyboard as that is apparently the best and efficient way to animate controls. I have tried searching for Tutorials but have not, unfortunately, stumbled on one yet. Can anyone please advice me where I can begin? For example, "moving an image across the screen" and then "moving many images at the same time whilst rotating them". Any help is highly appreciated.

    Read the article

  • Are there Vi/Vim users who aren't touch typists?

    - by michael
    I'm trying to write a Vim tutorial and I'd like to start by dismissing a few misconceptions, as well as giving some recommendations. I don't know if I should dismiss touch-typing as a misconception, or include it as a recommended prerequisite. At the time I learned the editor, I had already been touch typing for a couple of years, so I have absolutely no idea what would be the experience of a two-fingered typist in Vim. Are you a vim two-fingered typist? what has your experience been like?

    Read the article

  • Removing exception

    - by Nikhil K
    I have used this code for extracting urls from web page.But in the line of 'foreach' it is showing Object reference not set to an instance of an object exception. What is the problem? how can i correct that? WebClient client = new WebClient(); string url = "http://www.google.co.in/search?hl=en&q=java&start=10&sa=N"; string source = client.DownloadString(url); HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(source); foreach (HtmlNode link in doc.DocumentNode.SelectNodes("//a[@href and @rel='nofollow']")) { Console.WriteLine(link.Attributes["href"].Value); }

    Read the article

  • How do I write a bash script to replace words in files and then rename files?

    - by Jason
    Hi All, I have a folder structure, as shown below: I need to create a bash script that does 4 things: It searches all the files in the generic directory and finds the string 'generic' and makes it into 'something' As above, but changes "GENERIC" to "SOMETHING" As above, but changes "Generic" to "Something" Renames any filename that has "generic" in it with "something" Right now I am doing this process manually by using the search and replace in net beans. I dont know much about bash scripting, but i'm sure this can be done. I'm thinking of something that I would run and it would take "Something" as the input. Where would I start? what functions should I use? overall guidance would be great. thanks. I am using Ubuntu 10.5 desktop edition.

    Read the article

  • Installed service starting and then stopping immediatly

    - by djerry
    Hey guys, I am trying to install a service with a setup project. So through a normal setup/msi file, the service should be installed in services. So it works, but when i press start, i get the error/fault shown in the picture below. Does anyone know what causes it and most of all how i can solve it? I've read the message, but can't seem to find the origin. I don't know the most common things that would cause this error. Thanks in advance. ps: Other post is not helping to solve the problem

    Read the article

  • Default http/admin port in dropwizard project

    - by mithrandir
    I have a dropwizard project and I have maintained a config.yml file at the ROOT of the project (basically at the same level as pom.xml). Here I have specified the HTTP port to be used as follows: http: port:9090 adminPort:9091 I have the following code in my TestService.java file public class TestService extends Service<TestConfiguration> { @Override public void initialize(Bootstrap<TestConfiguration> bootstrap) { bootstrap.setName("test"); } @Override public void run(TestConfiguration config, Environment env) throws Exception { // initialize some resources here.. } public static void main(String[] args) throws Exception { new TestService().run(new String[] { "server" }); } } I expect the config.yml file to be used to determine the HTTP port. However the app always seems to start with the default ports 8080 and 8081. Also note that I am running this from eclipse. Any insights as to what am I doing wrong here ?

    Read the article

  • jquery: animate function problem

    - by Syom
    i start learning jquery just yesterday. i have a div element with some content, and i want to hide it by changing it's height: here is the script <script type="text/javascript"> $(document).ready(function(){ $("#hide").click(function(){ $("#cont").animate({ height: '0' },1500); $("#cont").hide(); }); }); </script> <input type="button" value="hide" id="hide"> <div id="cont"> text here... </div> but it doesn't work, becouse it automaticaly sets display:block to #cont element, so after animation it starts to show. when i try to set display:none to #cont element, it doesn't happen. could you help me? thanks

    Read the article

  • Android HTTP get methods

    - by Nick
    I have written a number of applications for blackberry and am just starting in Android. It seems to me that android has a lot more built in functions. I am starting by recreating some of my BB apps on Android and on one I take a few xml sites and parse them out. On blackberry I implemented this by creating a class that extended a thread. I would construct a new instance of this class with the parameters of my http request and it would call a function back in my main class, sending it the results. I am tempted to reuse my code, but am curious if android has something better built in. I have been looking at the handler class as well as possible using a service. Bascially, I would like to start a new thread that will return a document of a specific url. Thanks!

    Read the article

  • 1030 Got error 28 from storage engine

    - by ScoRpion...
    I am working on a project where i need to create a database with 300 tables for each user who wants to see the demo application. it was working fine but today when i was testing with a new user to see a demo it showed me this error message 1030 Got error 28 from storage engine After spending some time googling i found it is an error that is related to space of database or temporary files. I tried to fix it but i failed. now i am not even able to start mysql. How can i fix this and i would also like to increase the size to maximum so that i won't face the same issue again and again.

    Read the article

  • Creating a Linux Desktop Envoriment

    - by Alon
    Suppose I want to create my own desktop envoriment for Linux, without X. Like Google with the Android did. Where do I start? Is it actually a normal application that just draws stuff, and starts after the kernel boot? And how does it draw it? Using OpenGL or is there something more generic? And graphics drivers, how is it going? You should develop custom graphics drivers for your desktop or it comes with the Linux kernel? Note: It's for normal PCs and not embedded devices. Thanks.

    Read the article

  • C# 4.0 how to pass variables to threads?

    - by Aviatrix
    How would i pass some parameters to a new thread that runs a function from another class ? What i'm trying to do is to pass an array or multiple variables to a function that sits in another class and its called by a new thread. i have tried to do it like this Functions functions = new Functions(); string[] data; Thread th = new Thread(new ParameterizedThreadStart(functions.Post())); th.Start(data); but it shows error "No overload for method 'Post' takes 0 arguments" Any ideas ?

    Read the article

  • Progress Dialog on open activity

    - by GeeXor
    hey guys, i've a problem with progress dialog on opening an activity (called activity 2 in example). The activity 2 has a lot of code to execute in this OnCreate event. final ProgressDialog myProgressDialog = ProgressDialog.show(MyApp.this,getString(R.string.lstAppWait), getString(R.string.lstAppLoading), true); new Thread() { public void run() { runOnUiThread(new Runnable() { @Override public void run() { showApps(); } }); myProgressDialog.dismiss(); } }.start(); The showApps function launch activity 2. if i execute this code on my button click event on activity 1, i see the progress, but she doesn't move and afeter i have a black screen during 2 or 3 seconds the time for android to show the activity. If i execute this code in the OnCreate of Activity2 and if i replace the showApps by the code on OnCreate, Activity1 freeze 2 seconds, i don't see the progress dialog, and freeze again 2 seconds on activity 2 before seeing the result. An idea ?

    Read the article

  • using drupal 6 or 7 for a new PHP web application?

    - by ajsie
    if i create a new web application tomorrow, should i use Drupal 6 or 7? i have never used drupal before so i have to start learning it first (very familiar with PHP) so i can understand the basics and how to extend it. my concerns for using 7: no modules contributed yet? so i dont have all the fancy stuff i can add like in Drupal 6? no good documentation and lack of web tutorials? how could i learn about it if there is not that much support? too early in the development process? it's not stable enough? i would like to use 7 cause i dont want to relearn everything and 7 is indeed just around the corner. but im afraid that it lacks all other stuff version 6 has. could someone guide me into right direction? thanks

    Read the article

  • How to test processing a list of files within a directory using RSpec?

    - by John Topley
    I'm pretty new to the world of RSpec. I'm writing a RubyGem that processes a list of files within a specified directory and any sub-directories. Specifically, it will use Find.find and append the files to an Array for later output. I'd like to write a spec to test this behaviour but don't really know where to start in terms of faking a directory of files and stubbing Find.find etc. This is what little I have so far: it "should return a list of files within the specified directory" do end Any help much appreciated!

    Read the article

< Previous Page | 811 812 813 814 815 816 817 818 819 820 821 822  | Next Page >