Search Results

Search found 28784 results on 1152 pages for 'start'.

Page 815/1152 | < Previous Page | 811 812 813 814 815 816 817 818 819 820 821 822  | Next Page >

• multi directional scrolling site

  - by user557318

  Ive been asked if i am able to program a multi directional scrolling site like this- COS only using wordpress. Initially i thought i may be flash but the source seems like it could be simple, possibly with elements of jquery. . . . . I am unable to find any themes that even come close to it. And initially i wanted to know how it has been achieved to see if i am able to start the design work any ideas how this has been achieved. More to the point if the multi scrolling could be applied on wordpress

  Read the article

• How to publish to Facebook fan/business pages (not user profiles)

  - by Jeff Putz

  I'm trying to figure out if fan/business pages are conceptually similar to regular user pages. My end goal is to publish events from a third-party Web site (new content, announcements, etc.) into the FB page that promotes the third-party site. I'm not sure where to start exactly. Been looking at the .NET Facebook SDK, and it seems focused on FB apps and authentication. Not sure where I should be looking. Help is appreciated!

  Read the article

• Looking for a tutorial and/or example for the following: Annotation based Spring 3 with JPA and/or h

  - by Conor

  I want to learn Spring. I'd like to start with Spring 3. I want a simple tutorial and/or example. So no full blown web example please. Also - not a trivial example - so something incorporating persistence (e.g. JPA or hibernate) would be nice. Also - I don't want to get bogged down writing XML. So - Annotation based Spring 3 with JPA and/or hibernate. Yes - there is a good reference for Spring 3.0, but it's XML based. I can't find anything else useful. Thanks in advance.

  Read the article

• Sql Server related question

  - by stefan

  Hi guys, I have this thing that i need to do and some advices will be greatly appreciated. I have a Sql server table with some phone calls.For each phone call i have the start and end time. What i need to accomplish: a stored procedure which for a certain period of time, let's say 5 hours at a x interval, lets say 2 minutes returns the number of connected calls. Something like: Interval Nr of Calls Connected 01-01-2010 12:00:00 - 01-01-2010 12:05:00 30 01-01-2010 12:05:01 - 01-01-2010 12:10:00 10 ............. Which will be the fastest way to do that? Thank you for your help

  Read the article

• Basic iphone timer example

  - by Rob

  Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

  Read the article

• UISearchBarDisplayController - Fixed SearchBar

  - by slik

  I've been trying to get UISearchBarDisplayController to not animate, and stay fixed below the navigation bar. Is this even possible, I've been getting some weird results. This is all configured through a storyboard. I am just trying to figure out If I should just create my own implementation of UISearchBarDisplayController since it kinda seems a little impossible to customize it to my need. Clicking the search box When I start searching the top has extra paddding (20pt). It's assuming its on top of the origin y: 0 to prevent overlapping of status bar. I can't click outside or the cancel, x buttons. What happens If I click cancel, before searching

  Read the article

• WIN32 visual c++

  - by mrbuxley

  I would like to write a simple program in c++. After the program is done i would like to get my answers in form of a graph or picture that would give some certain information if i click on a certain area. i have only written console apllications in c++ before and don't really have a clue where to start with the graphic part of it all. Can I write the first part of the program in console mode and some how run it under the WIN32 later? for ex what will happen to the cout<<"foo"; commands? Is there a simpler approach to do some very basic graphic programming.

  Read the article

• Keeping Score in XNA Game

  - by Seven

  Hi. I'm following an XNA tutorial and have the following code for collision detecting (detecting when a bullet collides with a target). Basically I'm looking to increment a score variable to display the score to the screen without re-writing the whole program. No matter where I place it in this method it seems to start incrementing from the number of targets, not from zero. Is there something simple I'm missing here? Any help would be greatly appreciated. Thanks. private CollisionType CheckCollision(BoundingSphere sphere) { if (completeCityBox.Contains(sphere) != ContainmentType.Contains) return CollisionType.Boundary; for (int i = 0; i < targetList.Count; i++) { if (targetList[i].Contains(sphere) != ContainmentType.Disjoint) { targetList.RemoveAt(i); i--; AddTargets(); return CollisionType.Target; } } return CollisionType.None; }

  Read the article

• Does this pattern have a name?

  - by LK7jb

  Disclaimer: I'm trying to learn proper OO programming/design, so I'm pretty new to this stuff. I guess this is a general design patterns question, but I'll base my example on a game engine or something that renders objects to the display. Consider the following: How can this sort of separation between physical objects (e.g., cubes, spheres, etc.) and the rendering mechanism be achieved in an extensible manner? This design is not set in stone, and perhaps I've got something wrong from the start. I'm just curious as to how a problem like this is solved in real world code.

  Read the article

• How to add up amount of data from an external file in C# (Stream Reader)

  - by user2985995

  I'm new to this site, and pretty new to programming, at the moment I'm trying to display a count amount for the users names on my donation list, and then I also want to have a sum to work out the total amount of money the donation list contains, If someone could help me with creating a way to add up amount of donors on the donations.txt file that would be great help, I have no idea where to start, but so far this is my coding: string sName; double dAmount; string sTotalNames; double dAmountTotal; double dAmountAverage; using (StreamReader sr = new StreamReader("Donations.txt")) { while (sr.Peek() != -1) { sName = sr.ReadLine(); Console.WriteLine(sName); dAmount = Convert.ToDouble(sr.ReadLine()); Console.WriteLine(dAmount); } Console.WriteLine("Press any key to close"); Console.ReadKey(); }

  Read the article

• FTP: check whether file is closed

  - by Andrey

  Hello! My FTP client (apache commons ftpclient) needs to download file from FTP. The problem is that an external service may not have finished writing to this file before I start downloading. Is there any way to determine via FTP whether the file is already closed (i.e. there is no writing handlers opened)? The problem is that I cannot synchronize with that external service. But I mustn't download file which is not finished yet (a large JPEG). Thanks in advance!

  Read the article

• Feedback + Bad output

  - by user1770094

  So I've got an assignment I think I'm more or less done with, but there is something which is messing up the output badly somewhere down the line, or even the calculation, and I don't see where the problem is. The assignment is to make a game in which a certain ammount of players run up through a tunnel towards a spot,where they will stop and spin around it,and then their dizziness is supposed to make them randomly either progress towards goal or regress back towards start.And each time they get another spot closer to goal,they get another "marking",and it goes on like this until one of them reaches goal. The program includes three files: one main.cpp,one header file and another cpp file. The header file: #ifndef COMPETITOR_H #define COMPETITOR_H #include <string> using namespace std; class Competitor { public: void setName(); string getName(); void spin(); void move(); int checkScore(); void printResult(); private: string name; int direction; int markedSpots; }; #endif // COMPETITOR_H The second cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void Competitor::setName() { cin>>name; } string Competitor::getName() { return name; } void Competitor::spin() { srand(time(NULL)); direction = rand()%1+0; } void Competitor::move() { if(direction == 1) { markedSpots++; } else if(direction == 0 && markedSpots != 0) { markedSpots--; } } int Competitor::checkScore() { return markedSpots; } void Competitor::printResult() { if(direction == 1) { cout<<" is heading towards goal and has currently "<<markedSpots<<" markings."; } else if(direction == 0) { cout<<"\n"<<getName()<<" is heading towards start and has currently "<<markedSpots<<" markings."; } } The main cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void inputAndSetNames(Competitor comps[],int nrOfComps); void makeTwist(Competitor comps[],int nrOfComps); void makeMove(Competitor comps[],int nrOfComps); void showAll(Competitor comps[],int nrOfComps); int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces); int main() { int nrOfTwistPlaces; int nrOfComps; int noWinner = -1; int laps = 0; cout<<"How many spinning places should there be? "; cin>>nrOfTwistPlaces; cout<<"How many competitors should there be? "; cin>>nrOfComps; Competitor * comps = new Competitor[nrOfComps]; inputAndSetNames(comps, nrOfComps); do { laps++; cout<<"\nSpin "<<laps<<":"; makeTwist(comps, nrOfComps); makeMove(comps, nrOfComps); showAll(comps, nrOfComps); }while(noWinner == -1); delete [] comps; return 0; } void inputAndSetNames(Competitor comps[],int nrOfComps) { cout<<"Type in the names of the "<<nrOfComps<<" competitors:\n"; for(int i=0;i<nrOfComps;i++) { comps[i].setName(); } cout<<"\n"; } void makeTwist(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].spin(); } } void makeMove(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].move(); } } void showAll(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].printResult(); } cout<<"\n\n"; system("pause"); } int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces) { int end = 0; int score = 0; for(int i=0;i<nrOfComps;i++) { score = comps[i].checkScore(); if(score == nrOfTwistPlaces) { end = 1; } else end = -1; } return end; } I'd be grateful if you would point out other mistakes if you see any.Thanks in advance.

  Read the article

• database encryption questions

  - by 5YrsLaterDBA

  We are using Sybase SQL Anywhere 11. We need to encrypt some of our tables in our database. I followed the instruction and did it. We selected the "strong" option with encryptionKey and AES256_FIPS algorithm. But there are something I am not clear about them. It will require encryptonKey when we create the database, remove the database and start the database server but it will NOT require encryptionKey when we stop the database server and connect to the server to create tables and add data. Why there is NO encryptionKey asked when we connect to it or try to stop the server? I am doing something wrong? don't know how to test the encryption? I still can see all plain text in the encrypted tables when I use Sybase Central tool. If somebody knows the database user name and password, he/she can connect to the database and read the content without the encryptionKey. is this right?

  Read the article

• Default http/admin port in dropwizard project

  - by mithrandir

  I have a dropwizard project and I have maintained a config.yml file at the ROOT of the project (basically at the same level as pom.xml). Here I have specified the HTTP port to be used as follows: http: port:9090 adminPort:9091 I have the following code in my TestService.java file public class TestService extends Service<TestConfiguration> { @Override public void initialize(Bootstrap<TestConfiguration> bootstrap) { bootstrap.setName("test"); } @Override public void run(TestConfiguration config, Environment env) throws Exception { // initialize some resources here.. } public static void main(String[] args) throws Exception { new TestService().run(new String[] { "server" }); } } I expect the config.yml file to be used to determine the HTTP port. However the app always seems to start with the default ports 8080 and 8081. Also note that I am running this from eclipse. Any insights as to what am I doing wrong here ?

  Read the article

• jquery: animate function problem

  - by Syom

  i start learning jquery just yesterday. i have a div element with some content, and i want to hide it by changing it's height: here is the script <script type="text/javascript"> $(document).ready(function(){ $("#hide").click(function(){ $("#cont").animate({ height: '0' },1500); $("#cont").hide(); }); }); </script> <input type="button" value="hide" id="hide"> <div id="cont"> text here... </div> but it doesn't work, becouse it automaticaly sets display:block to #cont element, so after animation it starts to show. when i try to set display:none to #cont element, it doesn't happen. could you help me? thanks

  Read the article

• C#: reading in a text file more 'intelligently'

  - by DarthSheldon

  I have a text file which contains a list of alphabetically organized variables with their variable numbers next to them formatted something like follows: aabcdef 208 abcdefghijk 1191 bcdefga 7 cdefgab 12 defgab 100 efgabcd 999 fgabc 86 gabcdef 9 h 11 ijk 80 ... ... I would like to read each text as a string and keep it's designated id# something like read "aabcdef" and store it into an array at spot 208. The 2 issues I'm running into are: I've never read from file in C#, is there a way to read, say from start of line to whitespace as a string? and then the next string as an int until the end of line? given the nature and size of these files I do not know the highest ID value of each file (not all numbers are used so some files could house a number like 3000, but only actually list 200 variables) So how could I make a flexible way to store these variables when I don't know how big the array/list/stack/etc.. would need to be.

  Read the article

• Tests that are 2-3 times bigger than the testable code

  - by HeavyWave

  Is it normal to have tests that are way bigger than the actual code being tested? For every line of code I am testing I usually have 2-3 lines in the unit test. Which ultimately leads to tons of time being spent just typing the tests in (mock, mock and mock more). Where are the time savings? Do you ever avoid tests for code that is along the lines of being trivial? Most of my methods are less than 10 lines long and testing each one of them takes a lot of time, to the point where, as you see, I start questioning writing most of the tests in the first place. I am not advocating not unit testing, I like it. Just want to see what factors people consider before writing tests. They come at a cost (in terms of time, hence money), so this cost must be evaluated somehow. How do you estimate the savings created by your unit tests, if ever?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• C# 4.0 how to pass variables to threads?

  - by Aviatrix

  How would i pass some parameters to a new thread that runs a function from another class ? What i'm trying to do is to pass an array or multiple variables to a function that sits in another class and its called by a new thread. i have tried to do it like this Functions functions = new Functions(); string[] data; Thread th = new Thread(new ParameterizedThreadStart(functions.Post())); th.Start(data); but it shows error "No overload for method 'Post' takes 0 arguments" Any ideas ?

  Read the article

• Creating a Linux Desktop Envoriment

  - by Alon

  Suppose I want to create my own desktop envoriment for Linux, without X. Like Google with the Android did. Where do I start? Is it actually a normal application that just draws stuff, and starts after the kernel boot? And how does it draw it? Using OpenGL or is there something more generic? And graphics drivers, how is it going? You should develop custom graphics drivers for your desktop or it comes with the Linux kernel? Note: It's for normal PCs and not embedded devices. Thanks.

  Read the article

• Installed service starting and then stopping immediatly

  - by djerry

  Hey guys, I am trying to install a service with a setup project. So through a normal setup/msi file, the service should be installed in services. So it works, but when i press start, i get the error/fault shown in the picture below. Does anyone know what causes it and most of all how i can solve it? I've read the message, but can't seem to find the origin. I don't know the most common things that would cause this error. Thanks in advance. ps: Other post is not helping to solve the problem

  Read the article

• Are there Vi/Vim users who aren't touch typists?

  - by michael

  I'm trying to write a Vim tutorial and I'd like to start by dismissing a few misconceptions, as well as giving some recommendations. I don't know if I should dismiss touch-typing as a misconception, or include it as a recommended prerequisite. At the time I learned the editor, I had already been touch typing for a couple of years, so I have absolutely no idea what would be the experience of a two-fingered typist in Vim. Are you a vim two-fingered typist? what has your experience been like?

  Read the article

• gtk-sharp-2.0 hide/show external applications(processes)

  - by ziuciek

  Hi, maybe the topic isn't quite precise.. i want to write in c# (gtk#-2.0) an app which opens another app hidden and later shows that app. For now i know only how to open hidden app... in windows...: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Diagnostics; namespace do_kasacji { class Program { static void Main(string[] args) { ProcessStartInfo info = new ProcessStartInfo(); info.WindowStyle = ProcessWindowStyle.Minimized; info.FileName = "notepad"; using (Process pr = Process.Start(info)) { pr.WaitForExit(); } } } } Anyone knows how to change it so hat it would run in linux?

  Read the article

• Android HTTP get methods

  - by Nick

  I have written a number of applications for blackberry and am just starting in Android. It seems to me that android has a lot more built in functions. I am starting by recreating some of my BB apps on Android and on one I take a few xml sites and parse them out. On blackberry I implemented this by creating a class that extended a thread. I would construct a new instance of this class with the parameters of my http request and it would call a function back in my main class, sending it the results. I am tempted to reuse my code, but am curious if android has something better built in. I have been looking at the handler class as well as possible using a service. Bascially, I would like to start a new thread that will return a document of a specific url. Thanks!

  Read the article

• Removing exception

  - by Nikhil K

  I have used this code for extracting urls from web page.But in the line of 'foreach' it is showing Object reference not set to an instance of an object exception. What is the problem? how can i correct that? WebClient client = new WebClient(); string url = "http://www.google.co.in/search?hl=en&q=java&start=10&sa=N"; string source = client.DownloadString(url); HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(source); foreach (HtmlNode link in doc.DocumentNode.SelectNodes("//a[@href and @rel='nofollow']")) { Console.WriteLine(link.Attributes["href"].Value); }

  Read the article

< Previous Page | 811 812 813 814 815 816 817 818 819 820 821 822  | Next Page >