Search Results

Search found 28784 results on 1152 pages for 'start'.

Page 815/1152 | < Previous Page | 811 812 813 814 815 816 817 818 819 820 821 822  | Next Page >

• multi directional scrolling site

  - by user557318

  Ive been asked if i am able to program a multi directional scrolling site like this- COS only using wordpress. Initially i thought i may be flash but the source seems like it could be simple, possibly with elements of jquery. . . . . I am unable to find any themes that even come close to it. And initially i wanted to know how it has been achieved to see if i am able to start the design work any ideas how this has been achieved. More to the point if the multi scrolling could be applied on wordpress

  Read the article

• 1030 Got error 28 from storage engine

  - by ScoRpion...

  I am working on a project where i need to create a database with 300 tables for each user who wants to see the demo application. it was working fine but today when i was testing with a new user to see a demo it showed me this error message 1030 Got error 28 from storage engine After spending some time googling i found it is an error that is related to space of database or temporary files. I tried to fix it but i failed. now i am not even able to start mysql. How can i fix this and i would also like to increase the size to maximum so that i won't face the same issue again and again.

  Read the article

• C# creating a custom user interface

  - by CSharpInquisitor

  Hi, I have a SQL database holding a number of numeric and text values that get updated regularly. The exact number/type/names of these data points can change depending on the source of the database writes. I would like to create a user interface editor, where the user can add database points to the UI and arrange them and format them as they want. If a new point is added to the database they can right click on the UI and say "add this point" and choose from a list of database points. I'm looking for some pointers on where to start on creating this editor application, could something clever be done using XAML to dynamically create std WPF controls at runtime? Thanks in advance for any help, Si

  Read the article

• Feedback + Bad output

  - by user1770094

  So I've got an assignment I think I'm more or less done with, but there is something which is messing up the output badly somewhere down the line, or even the calculation, and I don't see where the problem is. The assignment is to make a game in which a certain ammount of players run up through a tunnel towards a spot,where they will stop and spin around it,and then their dizziness is supposed to make them randomly either progress towards goal or regress back towards start.And each time they get another spot closer to goal,they get another "marking",and it goes on like this until one of them reaches goal. The program includes three files: one main.cpp,one header file and another cpp file. The header file: #ifndef COMPETITOR_H #define COMPETITOR_H #include <string> using namespace std; class Competitor { public: void setName(); string getName(); void spin(); void move(); int checkScore(); void printResult(); private: string name; int direction; int markedSpots; }; #endif // COMPETITOR_H The second cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void Competitor::setName() { cin>>name; } string Competitor::getName() { return name; } void Competitor::spin() { srand(time(NULL)); direction = rand()%1+0; } void Competitor::move() { if(direction == 1) { markedSpots++; } else if(direction == 0 && markedSpots != 0) { markedSpots--; } } int Competitor::checkScore() { return markedSpots; } void Competitor::printResult() { if(direction == 1) { cout<<" is heading towards goal and has currently "<<markedSpots<<" markings."; } else if(direction == 0) { cout<<"\n"<<getName()<<" is heading towards start and has currently "<<markedSpots<<" markings."; } } The main cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void inputAndSetNames(Competitor comps[],int nrOfComps); void makeTwist(Competitor comps[],int nrOfComps); void makeMove(Competitor comps[],int nrOfComps); void showAll(Competitor comps[],int nrOfComps); int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces); int main() { int nrOfTwistPlaces; int nrOfComps; int noWinner = -1; int laps = 0; cout<<"How many spinning places should there be? "; cin>>nrOfTwistPlaces; cout<<"How many competitors should there be? "; cin>>nrOfComps; Competitor * comps = new Competitor[nrOfComps]; inputAndSetNames(comps, nrOfComps); do { laps++; cout<<"\nSpin "<<laps<<":"; makeTwist(comps, nrOfComps); makeMove(comps, nrOfComps); showAll(comps, nrOfComps); }while(noWinner == -1); delete [] comps; return 0; } void inputAndSetNames(Competitor comps[],int nrOfComps) { cout<<"Type in the names of the "<<nrOfComps<<" competitors:\n"; for(int i=0;i<nrOfComps;i++) { comps[i].setName(); } cout<<"\n"; } void makeTwist(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].spin(); } } void makeMove(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].move(); } } void showAll(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].printResult(); } cout<<"\n\n"; system("pause"); } int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces) { int end = 0; int score = 0; for(int i=0;i<nrOfComps;i++) { score = comps[i].checkScore(); if(score == nrOfTwistPlaces) { end = 1; } else end = -1; } return end; } I'd be grateful if you would point out other mistakes if you see any.Thanks in advance.

  Read the article

• Tests that are 2-3 times bigger than the testable code

  - by HeavyWave

  Is it normal to have tests that are way bigger than the actual code being tested? For every line of code I am testing I usually have 2-3 lines in the unit test. Which ultimately leads to tons of time being spent just typing the tests in (mock, mock and mock more). Where are the time savings? Do you ever avoid tests for code that is along the lines of being trivial? Most of my methods are less than 10 lines long and testing each one of them takes a lot of time, to the point where, as you see, I start questioning writing most of the tests in the first place. I am not advocating not unit testing, I like it. Just want to see what factors people consider before writing tests. They come at a cost (in terms of time, hence money), so this cost must be evaluated somehow. How do you estimate the savings created by your unit tests, if ever?

  Read the article

• Delegate Method only Firing after 5 or so Button Presses?

  - by CoDEFRo

  I'm having the most bizarre problem which I'm not even close to figuring out. I have a button which fires a delegate method. Once upon a time it was working fine, but after making some changes to my code, now the delegate method only fires after I push the button x amount of times (the changes I made to the code had nothing to do with the infrastructure that connects the delegate together). It varies, it can be 5 times to 10 times. I used the analyzer to check for memory leaks and there aren't any. There is too much code for me to paste here (I don't even know where to start or where the problem could be), but I'm wondering if anyone has experienced this problem before, or what could be causing it? This is very odd and have no clue what could be causing it.

  Read the article

• Looking for a tutorial and/or example for the following: Annotation based Spring 3 with JPA and/or h

  - by Conor

  I want to learn Spring. I'd like to start with Spring 3. I want a simple tutorial and/or example. So no full blown web example please. Also - not a trivial example - so something incorporating persistence (e.g. JPA or hibernate) would be nice. Also - I don't want to get bogged down writing XML. So - Annotation based Spring 3 with JPA and/or hibernate. Yes - there is a good reference for Spring 3.0, but it's XML based. I can't find anything else useful. Thanks in advance.

  Read the article

• Dividing n-bit binary integers

  - by Julian

  Was wondering if anyone could help me with creating a pseudocode for how to go about dividing n-bit binary integers. Here is what I'm thinking could possibly work right now, could someone correct this if I'm wrong: divide (x,y) if x=0: return (0,0) //(quotient, remainder) (q,r) = divide(floor(x/2), y) q=2q, r=2r if x is odd: r = r+1 if r >= y: r = r-y, q = q+1 return (q,r) Would you guys say that this general pseudocode algorithm would accomplish the intended task of dividing n-bit numbers or am I missing something in my psuedocode before I start coding up something that's wrong?

  Read the article

• database encryption questions

  - by 5YrsLaterDBA

  We are using Sybase SQL Anywhere 11. We need to encrypt some of our tables in our database. I followed the instruction and did it. We selected the "strong" option with encryptionKey and AES256_FIPS algorithm. But there are something I am not clear about them. It will require encryptonKey when we create the database, remove the database and start the database server but it will NOT require encryptionKey when we stop the database server and connect to the server to create tables and add data. Why there is NO encryptionKey asked when we connect to it or try to stop the server? I am doing something wrong? don't know how to test the encryption? I still can see all plain text in the encrypted tables when I use Sybase Central tool. If somebody knows the database user name and password, he/she can connect to the database and read the content without the encryptionKey. is this right?

  Read the article

• the problem of redirecting stdout in c#

  - by Mher

  Could you please explain why the shell redirection doesn't work with System.Diagnostics.Process class? I am trying to redirect the output streams to file with the following snippet: Process p = new Process(); p.StartInfo = new ProcessStartInfo(); p.StartInfo.FileName = "java.exe"; p.StartInfo.Arguments = @"> c:\Temp\test.log 2>&1"; p.StartInfo.UseShellExecute = true; p.Start(); The similar code works without problems with Python. Reading the output streams programmatically doesn't seem a preferable solution in my case because there will be a bunch of processes launched by my application.

  Read the article

• WP7 How to use a Storyboard

  - by Subby

  I wish to stop using the DispatcherTimer to show animations as that is extremely unpredictable. Instead, I want to start using a Storyboard as that is apparently the best and efficient way to animate controls. I have tried searching for Tutorials but have not, unfortunately, stumbled on one yet. Can anyone please advice me where I can begin? For example, "moving an image across the screen" and then "moving many images at the same time whilst rotating them". Any help is highly appreciated.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Autostart application/process in WP7

  - by sv88erik

  How is it possible to auto start my application or run a process when the user turns on the phone. If you look at ex. Outloock WP7 included in the operating system then updates the icon so that you can see that there are new mail. This is a process in the background running. But I've read a bit about this now, but can not find out that this is possible using the SDK from Microsoft? Is it not possible?? If possible, how does one do that? Notice: I do not want any solution that involves jailbreak.

  Read the article

• How do I write a bash script to replace words in files and then rename files?

  - by Jason

  Hi All, I have a folder structure, as shown below: I need to create a bash script that does 4 things: It searches all the files in the generic directory and finds the string 'generic' and makes it into 'something' As above, but changes "GENERIC" to "SOMETHING" As above, but changes "Generic" to "Something" Renames any filename that has "generic" in it with "something" Right now I am doing this process manually by using the search and replace in net beans. I dont know much about bash scripting, but i'm sure this can be done. I'm thinking of something that I would run and it would take "Something" as the input. Where would I start? what functions should I use? overall guidance would be great. thanks. I am using Ubuntu 10.5 desktop edition.

  Read the article

• Are there Vi/Vim users who aren't touch typists?

  - by michael

  I'm trying to write a Vim tutorial and I'd like to start by dismissing a few misconceptions, as well as giving some recommendations. I don't know if I should dismiss touch-typing as a misconception, or include it as a recommended prerequisite. At the time I learned the editor, I had already been touch typing for a couple of years, so I have absolutely no idea what would be the experience of a two-fingered typist in Vim. Are you a vim two-fingered typist? what has your experience been like?

  Read the article

• Android HTTP get methods

  - by Nick

  I have written a number of applications for blackberry and am just starting in Android. It seems to me that android has a lot more built in functions. I am starting by recreating some of my BB apps on Android and on one I take a few xml sites and parse them out. On blackberry I implemented this by creating a class that extended a thread. I would construct a new instance of this class with the parameters of my http request and it would call a function back in my main class, sending it the results. I am tempted to reuse my code, but am curious if android has something better built in. I have been looking at the handler class as well as possible using a service. Bascially, I would like to start a new thread that will return a document of a specific url. Thanks!

  Read the article

• Removing exception

  - by Nikhil K

  I have used this code for extracting urls from web page.But in the line of 'foreach' it is showing Object reference not set to an instance of an object exception. What is the problem? how can i correct that? WebClient client = new WebClient(); string url = "http://www.google.co.in/search?hl=en&q=java&start=10&sa=N"; string source = client.DownloadString(url); HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(source); foreach (HtmlNode link in doc.DocumentNode.SelectNodes("//a[@href and @rel='nofollow']")) { Console.WriteLine(link.Attributes["href"].Value); }

  Read the article

• jquery: animate function problem

  - by Syom

  i start learning jquery just yesterday. i have a div element with some content, and i want to hide it by changing it's height: here is the script <script type="text/javascript"> $(document).ready(function(){ $("#hide").click(function(){ $("#cont").animate({ height: '0' },1500); $("#cont").hide(); }); }); </script> <input type="button" value="hide" id="hide"> <div id="cont"> text here... </div> but it doesn't work, becouse it automaticaly sets display:block to #cont element, so after animation it starts to show. when i try to set display:none to #cont element, it doesn't happen. could you help me? thanks

  Read the article

• Default http/admin port in dropwizard project

  - by mithrandir

  I have a dropwizard project and I have maintained a config.yml file at the ROOT of the project (basically at the same level as pom.xml). Here I have specified the HTTP port to be used as follows: http: port:9090 adminPort:9091 I have the following code in my TestService.java file public class TestService extends Service<TestConfiguration> { @Override public void initialize(Bootstrap<TestConfiguration> bootstrap) { bootstrap.setName("test"); } @Override public void run(TestConfiguration config, Environment env) throws Exception { // initialize some resources here.. } public static void main(String[] args) throws Exception { new TestService().run(new String[] { "server" }); } } I expect the config.yml file to be used to determine the HTTP port. However the app always seems to start with the default ports 8080 and 8081. Also note that I am running this from eclipse. Any insights as to what am I doing wrong here ?

  Read the article

• Installed service starting and then stopping immediatly

  - by djerry

  Hey guys, I am trying to install a service with a setup project. So through a normal setup/msi file, the service should be installed in services. So it works, but when i press start, i get the error/fault shown in the picture below. Does anyone know what causes it and most of all how i can solve it? I've read the message, but can't seem to find the origin. I don't know the most common things that would cause this error. Thanks in advance. ps: Other post is not helping to solve the problem

  Read the article

• Creating a Linux Desktop Envoriment

  - by Alon

  Suppose I want to create my own desktop envoriment for Linux, without X. Like Google with the Android did. Where do I start? Is it actually a normal application that just draws stuff, and starts after the kernel boot? And how does it draw it? Using OpenGL or is there something more generic? And graphics drivers, how is it going? You should develop custom graphics drivers for your desktop or it comes with the Linux kernel? Note: It's for normal PCs and not embedded devices. Thanks.

  Read the article

• C# 4.0 how to pass variables to threads?

  - by Aviatrix

  How would i pass some parameters to a new thread that runs a function from another class ? What i'm trying to do is to pass an array or multiple variables to a function that sits in another class and its called by a new thread. i have tried to do it like this Functions functions = new Functions(); string[] data; Thread th = new Thread(new ParameterizedThreadStart(functions.Post())); th.Start(data); but it shows error "No overload for method 'Post' takes 0 arguments" Any ideas ?

  Read the article

• gtk-sharp-2.0 hide/show external applications(processes)

  - by ziuciek

  Hi, maybe the topic isn't quite precise.. i want to write in c# (gtk#-2.0) an app which opens another app hidden and later shows that app. For now i know only how to open hidden app... in windows...: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Diagnostics; namespace do_kasacji { class Program { static void Main(string[] args) { ProcessStartInfo info = new ProcessStartInfo(); info.WindowStyle = ProcessWindowStyle.Minimized; info.FileName = "notepad"; using (Process pr = Process.Start(info)) { pr.WaitForExit(); } } } } Anyone knows how to change it so hat it would run in linux?

  Read the article

• Progress Dialog on open activity

  - by GeeXor

  hey guys, i've a problem with progress dialog on opening an activity (called activity 2 in example). The activity 2 has a lot of code to execute in this OnCreate event. final ProgressDialog myProgressDialog = ProgressDialog.show(MyApp.this,getString(R.string.lstAppWait), getString(R.string.lstAppLoading), true); new Thread() { public void run() { runOnUiThread(new Runnable() { @Override public void run() { showApps(); } }); myProgressDialog.dismiss(); } }.start(); The showApps function launch activity 2. if i execute this code on my button click event on activity 1, i see the progress, but she doesn't move and afeter i have a black screen during 2 or 3 seconds the time for android to show the activity. If i execute this code in the OnCreate of Activity2 and if i replace the showApps by the code on OnCreate, Activity1 freeze 2 seconds, i don't see the progress dialog, and freeze again 2 seconds on activity 2 before seeing the result. An idea ?

  Read the article

• Considerations when porting a MS VC++ program (single machine) to a rocks cluster

  - by Mel

  I am trying to port a MS VC++ program to run on a rocks cluster! I am not very good with linux but I am eager to learn and I imagine porting it wouldn't be an impossible task for me. However, I do not understand how to take advantage of the cluster nodes. because it seems that the code execute only runs on the front end server (obviously). I have read a little about MPI and its seems like I should use MPI to comminicate between nodes. The program is currently written such that I have a main thread that synchronizes all worker threads. The main thread also recieves commands to manipulate the simulation or query its state. If the simulation is properly setup, communication between executing threads can be significantly minimized. What I don't understand is how do I start the process on the compute nodes and how do I handle failures in nodes? And maybe there should be other things I should also consider when porting my program to run in a cluster?

  Read the article

< Previous Page | 811 812 813 814 815 816 817 818 819 820 821 822  | Next Page >