Search Results

Search found 28784 results on 1152 pages for 'start'.

Page 814/1152 | < Previous Page | 810 811 812 813 814 815 816 817 818 819 820 821  | Next Page >

  • fetching savedInstanceState values, nullpointerexception

    - by Johan
    @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main2); savedInstanceState.putString("foo", "bar"); } @Override public void onRestoreInstanceState(Bundle savedInstanceState) { super.onRestoreInstanceState(savedInstanceState); String myString = savedInstanceState.getString("foo"); Log.i("debug", "saved data: " + myString); } Im trying to preserve some values in an activity, but i recieve the following error: 06-23 23:09:44.038: E/AndroidRuntime(17584): java.lang.RuntimeException: Unable to start activity ComponentInfo{se.johanberntsson.activitytest/se.johanberntsson.activitytest.TestActivity}: java.lang.NullPointerException What did I miss here? Thanks

    Read the article

  • Apache crash on launch - W2008 Server

    - by user1634444
    I installed Xampp on my Windows Server 2008. It worked fine, untill I decided to install some updates. Now Apache doesn't start any more and I get these errors; [Wed Aug 29 23:31:20.328125 2012] [core:warn] [pid 1540:tid 312] AH00098: pid file C:/xampp/apache/logs/httpd.pid overwritten -- Unclean shutdown of previous Apache run? [Wed Aug 29 23:31:20.968750 2012] [ssl:warn] [pid 1540:tid 312] AH01873: Init:Session Cache is not configured [hint: SSLSessionCache] I'm trying to install Cacti on the server to monitor everything... Don't think it's relevant, but just saying

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • AtomicInteger for limited sequnce generation

    - by satish
    How can we use AtomicInteger for limited sequence generation say the sequence number has to be between 1 to 60. Once the sequece reaches 60 it has to start again from 1. I wrote this code though not quite sure wether this is thread safe or not? public int getNextValue() { int v; do { v = val.get(); if ( v == 60) { val.set(1); } } while (!val.compareAndSet(v , v + 1)); return v + 1; }

    Read the article

  • Strings - Filling In Leading Zeros Wtih A Zero

    - by headscratch
    I'm reading an array of hard-coded strings of numeric characters - all positions are filled with a character, even for the leading zeros. Thus, can confidently parse it using substring(start, end) to convert to numeric. Example: "0123 0456 0789" However, a string coming from a database does not fill in the leading zero with a 'zero character', it simply fetches the '123 456 789', which is correct for an arithmetic number but not for my needs and makes for parsing trouble. Before writing conditionals to check for leading zeros and adding them to the string if needed, is there a simple way of specifying they be filled with a character ? I'm not finding this in my Java book... I could have done the three conditionals in the time it took to post this but, this is more about 'education'... Thanks

    Read the article

  • C# - Saving a DataGridView to file and loading

    - by Rekar
    Hello, To start off, what I have is a simple Winforms app, with just a save and load button, and with a datagridview control to hold data. What I am looking to do is input some data into the control, hit the save button, and it save all the data to a file locally on the computer, and when I hit load, it loads the file and populates the control appropriately, keeping all rows, columns, and data the same as when saved. Although it sounds fairly simple to me, I cant seem to figure a good way to save and load the data. Can I get a few pointers or examples to get myself started? Thank you.

    Read the article

  • HTML5 drag upload in new window

    - by user463604
    I have setup an HTML5 drag and drop upload into my site. The problem that I have is when a user is uploading a large file, they must wait for the upload to finish before navigating and using the rest of the site. So, what I'd like to do is allow the user to drag files to the main site and then have it automatically open a new window and start the upload there so they can still use the rest of the site while the upload is happening. Anyone have and advice on how to accomplish this or if it can even be done?

    Read the article

  • Need Regex for to match special situations

    - by Daniel
    I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

    Read the article

  • .net load balancing for server

    - by user1439111
    Some time ago I wrote server software which is currently running at it's max. (3k users average). So I decided to rewrite certain parts so I can run the software at another server to balance it's load. I can't simply start another instance of the server since there is some data which has to be available to all users. So I was thinking of creating a small manager and all the servers connect and send their (relevant)data to the manager. But it also got me thinking about another problem. The manager could also reach it's limits which is exactly what i'm trying to prevent in the future. So I would like to know how I could fix this problem. (I have already tried to optimize critical parts of the software but I can't optimize it forever)

    Read the article

  • JQuery .each() backwards

    - by Jack Mills
    Hi, I'm using JQuery to select some elements on a page and then move them around in the DOM. The problem I'm having is I need to select all the elements in the reverse order that JQuery naturally wants to select them. For example: <ul> <li>Item 1</li> <li>Item 2</li> <li>Item 3</li> <li>Item 4</li> <li>Item 5</li> </ul> I want to select all the li items and use the .each() command on them but I want to start with Item 5, then Item 4 etc. Is this possible? Thanks

    Read the article

  • Cross version line matching.

    - by BCS
    I'm considering how to do automatic bug tracking and as part of that I'm wondering what is available to match source code line numbers (or more accurate numbers mapped from instruction pointers via something like addr2line) in one version of a program to the same line in another. (Assume everything is in some kind of source control and is available to my code) The simplest approach would be to use a diff tool/lib on the files and do some math on the line number spans, however this has some limitations: It doesn't handle cross file motion. It might not play well with lines that get changed It doesn't look at the information available in the intermediate versions. It provides no way to manually patch up lines when the diff tool gets things wrong. It's kinda clunky Before I start diving into developing something better: What already exists to do this? What features do similar system have that I've not thought of?

    Read the article

  • How much Java should I have learnt before trying Android programming?

    - by Sidney Yin
    Hi - I have been seeking beginner learning books in Android, and of course found out that I should learn Java first. So I began studying Java and now I am quite comfortable with objects, classes, inheritance, interfaces, and just moved onto Layouts in Swing as well as Swing Features. But I am starting to wonder.... do I know enough about Java now? Can I start programming Android yet? Of course I can keep going in Java, but have been itching to begin programming Android apps. Any definitive answer here about how much Java I need to know before Android? Thanks so much!

    Read the article

  • TimePicker Android and a Database

    - by user1820528
    I have a database with a table which contains a start time and an end time. The user has to select both through the Android app, and then I have to retrieve the two times into my database. For now, I have 2 TimePicker in my xml file, and I have 2 TimePicker in my java file TimePicker start_time = (TimePicker) findViewById(R.id.timePickerStart); Can someone help me know how I should retrieve the times, and use them in java (add a listener, etc.). And also, should I use TimeStamp or Date in the database ? My purpose is to send a notification (Toast?) to the user at those times. So should I retrieve the hour and the minute separately ? I'm sorry for asking so many questions, but I'm really lost here :( Thank you!

    Read the article

  • Use SQL to clone data in two tables that have a 1-1 relationship in each table

    - by AmoebaMan17
    Using MS SQL 2005, Table 1 ID | T1Value | T2ID | GroupID ---------------------------------- 1 | a | 10 | 1 2 | b | 11 | 1 3 | c | 12 | 1 4 | a | 22 | 2 Table 2 ID | T2Value ---------------- 10 | H 11 | J 12 | K 22 | H I want to clone the data for GroupID == 1 into a new GroupID so that I result with the following: Table 1 ID | T1Value | T2ID | GroupID ---------------------------------- 1 | a | 10 | 1 2 | b | 11 | 1 3 | c | 12 | 1 4 | a | 22 | 2 5 | a | 23 | 3 6 | b | 24 | 3 7 | c | 25 | 3 Table 2 ID | T2Value ---------------- 10 | H 11 | J 12 | K 22 | H 23 | H 24 | J 25 | K I've found some SQL clone patterns that allow me to clone data in the same table well... but as I start to deal with cloning data in two tables at the same time and then linking up the new rows correctly... that's just not something I feel like I have a good grasp of. I thought I could do some self-joins to deal with this, but I am worried in the cases where the non-key fields have the same data in multiple rows.

    Read the article

  • gtk-sharp-2.0 hide/show external applications(processes)

    - by ziuciek
    Hi, maybe the topic isn't quite precise.. i want to write in c# (gtk#-2.0) an app which opens another app hidden and later shows that app. For now i know only how to open hidden app... in windows...: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Diagnostics; namespace do_kasacji { class Program { static void Main(string[] args) { ProcessStartInfo info = new ProcessStartInfo(); info.WindowStyle = ProcessWindowStyle.Minimized; info.FileName = "notepad"; using (Process pr = Process.Start(info)) { pr.WaitForExit(); } } } } Anyone knows how to change it so hat it would run in linux?

    Read the article

  • Mapview on tablet: How can I center the map with an offset?

    - by Waza_Be
    Hint: Here is a similar post with HTML. In the current tablet implementation of my app, I have a fullscreen MapView with some informations displayed in a RelativeLayout on a left panel, like this: (My layout is quite trivial, and I guess there is no need to post it for readability) The problem comes when I want to center the map on a specific point... If I use this code: mapController.setCenter(point); I will of course get the point in the center of the screen and not in the center of the empty area. I have really no idea where I could start to turn the offset of the left panel into map coordinates... Thanks a lot for any help or suggestion

    Read the article

  • Java ME Runnable object takes up memory although not made an instance yet

    - by user1646684
    I am facing a strange problem with memory in Java ME. here is a part of my code: int variable=1; while (true) { if (variable==2) { display = Display.getDisplay(this); MyCanvas mc = new MyCanvas(this); // MyCanvas is a runnable object mcT = new Thread(mc); // new thread for MyCanvas mc.repaint(); display.setCurrent(mc); mcT.start(); // run thread } if (variable==1) { // Do some other stuff } } The problem is that although still the variable is set to 1, so it does not come through the if (variable==2) condition the program consumes 300kB more memory than when I delete the code after condition if (variable==2). As far as I know the code should by executed and the objects shall be created only when I set variable to value 2. But it consumes the memory also when the code after condition "if (variable==2)" is not executed. Why does this happen?

    Read the article

  • Basic iphone timer example

    - by Rob
    Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

    Read the article

  • What makes Groovy+Grails a more productive setup than J2EE?

    - by Pradyumna
    I'm coming across references to 'Grails' and 'Groovy' quite often these days.. mostly on how great a productivity booster it is as opposed to standard J2EE, or things like JSF, Struts etc.. And there's also an impressive set of case studies in support of this on their web site too. So I just thought I would explore some of it.. As I start off on this, I was curious if there was any material (link, blog, article, paper..) that explains what are the special features in Grails+Groovy (and not found elsewhere, in the J2EE world) that makes it a more productive environment to work in? Thanks!

    Read the article

  • Google App Engine: Difficulty with Users API (or maybe just a Python syntax problem)

    - by Rosarch
    I have a simple GAE app that includes a login/logout link. This app is running on the dev server at the moment. The base page handler gets the current user, and creates a login/logout url appropriately. It then puts this information into a _template_data dictionary, for convenience of subclasses. class BasePage(webapp.RequestHandler): _user = users.get_current_user() _login_logout_link = None if _user: _login_logout_link = users.create_logout_url('/') else: _login_logout_link = users.create_login_url('/') _template_data = {} _template_data['login_logout_link'] = _login_logout_link _template_data['user'] = _user def render(self, templateName, templateData): path = os.path.join(os.path.dirname(__file__), 'Static/Templates/%s.html' % templateName) self.response.out.write(template.render(path, templateData)) Here is one such subclass: class MainPage(BasePage): def get(self): self.render('start', self._template_data) The login/logout link is displayed fine, and going to the correct devserver login/logout page. However, it seems to have no effect - the server still seems to think the user is logged out. What am I doing wrong here?

    Read the article

  • android question about service and the method onstartcommand

    - by user516883
    In a service class there is a method to start the service. If that service gets done executing does it runs onstartcommand from the beginning? Is onstartcommand sorta like a loop as long as the service is running. For example i have onstartcommand { int x = 0; if(x == 0){ } else{ } } After that is complete does it run it again. If you know that answer please explain. I have read google explanation of services and it did not explain that part very well. Is onstartcommand sorta like a loop as long as the service is runnning

    Read the article

  • the problem of redirecting stdout in c#

    - by Mher
    Could you please explain why the shell redirection doesn't work with System.Diagnostics.Process class? I am trying to redirect the output streams to file with the following snippet: Process p = new Process(); p.StartInfo = new ProcessStartInfo(); p.StartInfo.FileName = "java.exe"; p.StartInfo.Arguments = @"> c:\Temp\test.log 2>&1"; p.StartInfo.UseShellExecute = true; p.Start(); The similar code works without problems with Python. Reading the output streams programmatically doesn't seem a preferable solution in my case because there will be a bunch of processes launched by my application.

    Read the article

  • Do you have to call .Save() when modifying a application setting that is bound to a control property

    - by Jordan S
    I am programming in .NET I have an application setting of type string. On my form I have a textbox. I bound the text property of the textbox to my application setting. If I type something in the textbox it changes the value that is held in the Application setting but the next time I start the program it goes back to the default value. Do I need to call Properties.Settings.Default.Save(); after the text is entered for the new value to be saved? Shouldn't it do this automatically? Is there a way I can make it do it automatically?

    Read the article

  • Autostart application of WP7

    - by sv88erik
    How is it possible to auto start my application or run a process when the user turns on the phone. If you look at ex. Outloock WP7 included in the operating system then updates the icon so that you can see that there are new mail. This is a process in the back round running. But I've read a bit about this now, but can not find out that this is possible using the SDK from microsoft? Is it not possible?? If possible, how does one do that?

    Read the article

  • Memory is leaked only in some machines.

    - by Jorge Córdoba
    We've got a situation where our application is leaking memory while doing some periodic action. The test scenario is composed of a series of processes across two relatively complex WPF windows. The weird thing about the situation is that memory only gets leaked on SOME machines, while others, having exactly the same hardware, can be working for really long times (repeating the process every minute) having their memory almost unchanged (once the GC gets rid of used memory, etc). This is .NET + WPF. Any ideas about where to start looking? What can cause leaks in only some machines? (we're talking about a 30 machine test scenario). I have few experience with WPF, could the graphic card had anything to do with it?

    Read the article

< Previous Page | 810 811 812 813 814 815 816 817 818 819 820 821  | Next Page >