Search Results

Search found 5784 results on 232 pages for 'points'.

Page 87/232 | < Previous Page | 83 84 85 86 87 88 89 90 91 92 93 94  | Next Page >

  • Worst technobabble you've ever heard

    - by pookleblinky
    Following the Egregious pop culture perversion of programming, what is the most outlandishly insane technobabble you have ever heard, either in fiction or real life? Extra points to those unfortunates whose real life stories beat Hollywood. Note: feel free to sketch out what would be necessary for such gibberish to actually work.

    Read the article

  • Problem in setting margin of an object on a grid

    - by Pawan
    Hi, I have inherited a class, say CstateUI from Control class. I am creating an object of CstateUI and setting up the margin of the object. For values of margin I take mouse click points from e.getPosition(grid). The problem is the first object is correctly rendered but on subsequent objects margin is not getting set accurately. Can you please tell me what possibly might be going wrong? Thanks in advance!

    Read the article

  • Automatically capitalize first letter of first word in a new sentence in LaTeX

    - by Tom Hagen
    I know one of LaTeX's bragging points is that it doesn't have this Microsoftish behavior. Nevertheless, it's sometimes useful. LaTeX already adds an extra space after you type a (non-backslashed) period, so it should be possible to make it automatically capitalize the following letter as well. Is there an obvious way to write a macro that does this, or is there a LaTeX package that does it already?

    Read the article

  • What is the meaning of the following?

    - by vj
    int sampleArray[] = {1,2,3,4,5}; I understand that the sampleArray now points to the first element of the array. However, what does it mean when I say &sampleArray ? Does it mean I am getting the address of the sampleArray variable? Or does it mean a two dimensional array variable? So, i can do this: int (*p)[5] = &sampleArray? Thanks

    Read the article

  • Amazon S3 enforcing access control

    - by KandadaBoggu
    I have several PDF files stored in Amazon S3. Each file is associated with a user and only the file owner can access the file. I have enforced this in my download page. But the actual PDF link points to Amazon S3 url, which is accessible to anybody. How do I enforce the access-control rules for this url?(without making my server a proxy for all the PDF download links)

    Read the article

  • Future proof Tweeting with PHP

    - by YsoL8
    Hello I'm looking to implement a system for tweeting directly from my site backend, which is written in PHP 5. I have a script from the internet that I can adapt, but I'm concerned that when Twitter switches to Oauth only, I'll be out in the cold. Basically, I'm hoping someone can point me toward a script/tutorial that will let me do the following: access twitter via the Oauth system Post Tweets and receive error codes Let me define an application/site name (I'm a bit fuzzy on whether Twitter allows this) Ideally I need all 3 points explained in detail. Thanks

    Read the article

  • Castle WCF DefaultServiceHostFactory in IIS: Accessing the ServiceHost

    - by user250837
    I am attempting to move from a self hosting architecture to hosting under IIS 6, primarily to take advantage of built in dynamic compression. I am using the Castle DefaultServiceHostFactory to provide the service to IIS in the .svc file. However, I need to programmatically specify certain end points and behaviours and I do not know how to retrieve the current ServiceHost. Is this be possible, or should I just look at other methods of compression independent of IIS?

    Read the article

  • Please help with iPhone Memory & Images, memory usage crashing app

    - by Andrew Gray
    I have an issue with memory usage relating to images and I've searched the docs and watched the videos from cs193p and the iphone dev site on memory mgmt and performance. I've searched online and posted on forums, but I still can't figure it out. The app uses core data and simply lets the user associate text with a picture and stores the list of items in a table view that lets you add and delete items. Clicking on a row shows the image and related text. that's it. Everything runs fine on the simulator and on the device as well. I ran the analyzer and it looked good, so i then starting looking at performance. I ran leaks and everything looked good. My issue is when running Object Allocations as every time i select a row and the view with the image is shown, the live bytes jumps up a few MB and never goes down and my app eventually crashes due to memory usage. Sorting the live bytes column, i see 2 2.72MB mallocs (5.45Mb total), 14 CFDatas (3.58MB total), 1 2.74MB malloc and everything else is real small. the problem is all the related info in instruments is really technical and all the problem solving examples i've seen are just missing a release and nothing complicated. Instruments shows Core Data as the responsible library for all but one (libsqlite3.dylib the other) with [NSSQLCore _prepareResultsFromResultSet:usingFetchPlan:withMatchingRows:] as the caller for all but one (fetchResultSetReallocCurrentRow the other) and im just not sure how to track down what the problem is. i've looked at the stack traces and opened the last instance of my code and found 2 culprits (below). I havent been able to get any responses at all on this, so if anyone has any tips or pointers, I'd really appreciate it!!!! //this is from view controller that shows the title and image - (void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.title = item.title; self.itemTitleTextField.text = item.title; if ([item.notes length] == 0) { self.itemNotesTextView.hidden = YES; } else { self.itemNotesTextView.text = item.notes; } //this is the line instruments points to UIImage *image = item.photo.image; itemPhoto.image = image; } - (void)tableView:(UITableView *)tableView commitEditingStyle:(UITableViewCellEditingStyle)editingStyle forRowAtIndexPath:(NSIndexPath *)indexPath { if (editingStyle == UITableViewCellEditingStyleDelete) { // Delete the managed object for the given index path NSManagedObjectContext *context = [fetchedResultsController managedObjectContext]; [context deleteObject:[fetchedResultsController objectAtIndexPath:indexPath]]; // Save the context. NSError *error = nil; if (![context save:&error]) //this is the line instruments points to { NSLog(@"Unresolved error %@, %@", error, [error userInfo]); exit(-1); } } }

    Read the article

  • Formatted input in c++

    - by julz666
    hey, i'm a noob to c++ (and coding in general) i'm looking for an easy way to take two doubles (at once) from the keyboard and store them in a struct i've created called "Point" and then ultimately store the Point into a vector of Points that's a member of a class (called "Polygon"). i know i could do it with a scanf but need to know how to do it with cin. hope that makes sense. thanks in advance julz

    Read the article

  • How to convert a string into a Point in C#

    - by NateD
    I have a list of strings of the format "x,y". I would like to make them all into Points. The best Point constructor I can find takes two ints. What is the best way in C# to turn "14,42" into new Point(14,42);? I know the Regex for doing that is /(\d+),(\d+)/, but I'm having a hard time turning those two match groups into ints in C#. any help you could offer would be appreciated.

    Read the article

  • Parsing language for both binary and character files

    - by Thorsten S.
    The problem: You have some data and your program needs specified input. For example strings which are numbers. You are searching for a way to transform the original data in a format you need. And the problem is: The source can be anything. It can be XML, property lists, binary which contains the needed data deeply embedded in binary junk. And your output format may vary also: It can be number strings, float, doubles.... You don't want to program. You want routines which gives you commands capable to transform the data in a form you wish. Surely it contains regular expressions, but it is very good designed and it offers capabilities which are sometimes much more easier and more powerful. Something like a super-grep which you can access (!) as program routines, not only as tool. It allows: joining/grouping/merging of results inserting/deleting/finding/replacing write macros which allows to execute a command chain repeatedly meta-grouping (lists-tables-hypertables) Example (No, I am not looking for a solution to this, it is just an example): You want to read xml strings embedded in a binary file with variable length records. Your tool reads the record length and deletes the junk surrounding your text. Now it splits open the xml and extracts the strings. Being Indian number glyphs and containing decimal commas instead of decimal points, your tool transforms it into ASCII and replaces commas with points. Now the results must be stored into matrices of variable length....etc. etc. I am searching for a good language / language-design and if possible, an implementation. Which design do you like or even, if it does not fulfill the conditions, wouldn't you want to miss ? EDIT: The question is if a solution for the problem exists and if yes, which implementations are available. You DO NOT implement your own sorting algorithm if Quicksort, Mergesort and Heapsort is available. You DO NOT invent your own text parsing method if you have regular expressions. You DO NOT invent your own 3D language for graphics if OpenGL/Direct3D is available. There are existing solutions or at least papers describing the problem and giving suggestions. And there are people who may have worked and experienced such problems and who can give ideas and suggestions. The idea that this problem is totally new and I should work out and implement it myself without background knowledge seems for me, I must admit, totally off the mark.

    Read the article

  • Good language to learn in order to build small websites

    - by mkoryak
    I want to start building websites and charging people for them! My problem is that the stack that know well does not lend itself to quick development, or cheap hosting. I am looking for languages that satisfy the following criteria: Fast to develop in Can find cheap hosting for it Bonus points if it can also be 'enterprisey'

    Read the article

  • ggplot2 pdf import in Adobe Illustrator missing font AdobePiStd

    - by Sander
    I created several simple ggplot2 plots and saved them to PDF files using the following commands: p <- ggplot(plotobject, aes(x=Pos, y=Pval),res=300) ggsave(plot=p,height=6,width=6,dpi=200, filename="~/example.pdf") If I now open this example.pdf in Adobe Illustrator I get the following error: The font AdobePiStd is missing. Affected text will be displayed using a substitute font. Is there a way in ggplot2 to specify a font (I presume this is for the dots/points) that Adobe will understand or otherwise is there a way to get this font working in Adobe?

    Read the article

  • MySQL - Order results by relevancy, LEFT JOINS and more

    - by XaviEsteve
    Hi guys, I am trying to get some results ordered by total votes (where client votes count 2 points and other people votes are 1 point). tab_names: +-----------+ | Name | id | +------+----+ | John | 1 | | Paul | 2 | +------+----+ tab_votes: +--------+-----------+ | idname | ip | +--------+-----------+ | 2 | 127.0.0.1 | | 2 | 127.0.0.1 | | 2 | 82.23.5.1 | | 1 | 127.0.0.1 | +--------+-----------+ This is the MySQL query I've got but doesn't work: SELECT * COUNT(v.idname) AS totalvotes, (SELECT COUNT(v.ip) FROM tab_votes WHERE v.ip LIKE '$ip') AS uservotes FROM tab_names n LEFT JOIN tab_votes v ON n.id = v.idname GROUP BY n.name ORDER BY uservotes DESC, totalvotes DESC LIMIT 40

    Read the article

  • draw rectangel using latitude\longitude on screen

    - by jamesM
    the existing Application is providing me 8 coordinates like NElatitude,NElongitude, NWlatitude,NWlongitude, SElatitude,SElongitude, SWlatitude,SWlongitudepoints and i have been asked draw rectangles on screen using this coordinates as a screen points. These rectangles should be with scaling. thank you for your help JamesM

    Read the article

  • Avoid writing SQL queries altogether in SSIS

    - by Jonn
    Working on a Data Warehouse project, the guy that gave us the tutorial advised that we stick to using SQL queries over defining a lot of data flow transformations, citing points like it'll consume a lot of memory on the ETL box so we'd rather leave the processing to the DB box. Is this really advisable? Where's the balance between relying on GUI tools over executing a bunch of SQL scripts on your Integration package? And honestly, I'd like to avoid writing SQL queries as much as I can.

    Read the article

  • Biggest Delphi nitpicks

    - by Mason Wheeler
    What sort of minor annoyances do you run into using Delphi? I'm not looking for major issues such as "I want a 64-bit compiler." Just little things that can be easily worked around but still should have been implemented better so you don't have to work around them? Marking this CW. I'm more interested in the answers than the points.

    Read the article

  • How do I get the available wifi APs and their signal strength in .net?

    - by LDomagala
    Is there any way to access all WiFi access points and their respective RSSI values using .NET? It would be really nice if I could do it without using unmanaged code or even better if it worked in mono as well as .NET. If it is possible i would appriciate a code sample. Thanks Here are a few similiar stackoverflow questions i found: -Get SSID of the wireless network I am connected to with C# .Net on Windows Vista -Managing wireless network connection in C# -Get BSSID (MAC address) of wireless access point from C#

    Read the article

  • Eclipse CDT debugger does not show console

    - by KáGé
    Hi, I'm trying to debug a C program using Eclipse CDT-s debugger and gdb on a Windows7 system, and everything seems fine, except for the console not showing up, which is bad, because my program needs input at some points from the keyboard. So how should I make Eclipse's debugger work properly? Thank you.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

< Previous Page | 83 84 85 86 87 88 89 90 91 92 93 94  | Next Page >