Search Results

Search found 9273 results on 371 pages for 'complex strings'.

Page 93/371 | < Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >

  • fastest in objC: IsEqualToString:@"" or length > 0?

    - by Cœur
    I'd like to know which one is fastest for testing a non-empty NSString for iOS 4.0+ (iPhone 3G). Note: the strings to test will be 99% of the time from 2 to 100 chars length. if ([foo length] > 0) or if ([foo isEqualToString:@""] == NO && foo != nil) I think it depends if isEqualToString: compares the length first (and in that case first way is faster) or if isEqualToString: compares first character of strings first (and in that case second way might be faster). ps: I already know isEqualToString: is faster than isEqual: which is itself faster than compare:.

    Read the article

  • String.split() - matching leading empty String prior to first delimiter?

    - by tehblanx
    I need to be able to split an input String by commas, semi-colons or white-space (or a mix of the three). I would also like to treat multiple consecutive delimiters in the input as a single delimiter. Here's what I have so far: String regex = "[,;\\s]+"; return input.split(regex); This works, except for when the input string starts with one of the delimiter characters, in which case the first element of the result array is an empty String. I do not want my result to have empty Strings, so that something like, ",,,,ZERO; , ;;ONE ,TWO;," returns just a three element array containing the capitalized Strings. Is there a better way to do this than stripping out any leading characters that match my reg-ex prior to invoking String.split? Thanks in advance!

    Read the article

  • Efficient questions

    - by rayman
    Hi, I have to manage xml's and Strings in my app. by efficenty and memory saving, is collection(ArrayList) will be much more 'expensive' then array of Strings? another issue is: i could use the content as regular String, or XML.. is working with XML also makes it more 'expensive' ? when i say i expensive i talk about taking system sources. please tell me by any of your exprience if the diffrences are significant? thanks, ray.

    Read the article

  • Converting image to byte/encoding it? - RichTextBox

    - by user1667191
    I have strings that are "Images", although they are in "String" format. Here's how one of the strings look like: {\pict\wmetafile8\picw820\pich900\picwgoal465\pichgoal510 010009000003ac1000000000f60900000000f6090000..etc.. It goes on like this for a few more lines. The guy that got this said he converted the image by pasting it in a richtextbox and getting that string. How can I go about getting the same result? Sorry for the lack of info. Just not sure how this is called.

    Read the article

  • Whats the difference between a C++ and a Cocoa Project in Xcode?

    - by david
    I need to work with TagLib for my project. I've created a framework (and I tried using it as a lib) but the compiler cannot find #include < strings on compiling (No such file or Directory). I've created a test C++ project and it #includes < strings just fine. I've looked at the project settings and I cannot find a difference between them. But the standard cocoa projects obviously so not have the search path set to include C++ libraries (Or am I completely getting it wrong?). I've searched for a solution but no one else seems to have run into this problem.

    Read the article

  • Get the top nth values from a rectangular array

    - by user355925
    I am reading a txt file for strings that represent integers. The file is space delimited. I have created an array[10,2]. Everytime the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. i.e. txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. The result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

    Read the article

  • Assign grid.arrange to object

    - by Tyler Rinker
    I want to arrange plots with grid.arrange to make more complex coplots and then use grid.arrange to combine these complex coplots. I am using the following solution (http://stackoverflow.com/a/13295880/1000343) in this task to arrange mutliple plots and ensure they have equal widths. Here is a demo of the code: library(ggplot2); library(gridExtra) gA <- ggplotGrob(A) gB <- ggplotGrob(B) maxWidth = grid::unit.pmax(gA$widths[2:5], gB$widths[2:5]) gA$widths[2:5] <- as.list(maxWidth) gB$widths[2:5] <- as.list(maxWidth) x <- grid.arrange(gA, gB, ncol=1) y <- grid.arrange(gA, gB, ncol=1) grid.arrange(x, y, ncol=2) To be clear in my case x and y are slightly different plots with different values. I know grid.arrange isn't returning the plot as other grid based functions.

    Read the article

  • (C++) While reading a file (ifstream), is there any way to direct it to make a new line?

    - by Enzo
    While reading a file (ifstream), is there any way to direct it to make a new line? For instance, I would like for THIS to happen: myfilearray[1]array[2]endl; Obviously, the "endl" just isn't allowed. Is there another way to do this? Edit---thanks for the quick responses guys! From a text file, I'm trying to store two strings from that file into arrays and then do the same with the next line (or until I desire, using a for loop) Using strings is important to me as it will make my future program a lot more flexible.

    Read the article

  • Pass variable number of variables to a class in PHP

    - by user325282
    I need to pass a variable number of strings to instantiate different classes. I can always do a switch on the size of the array: switch(count($a)) { case 1: new Class(${$a[0]}); break; case 2: new Class(${$a[0]}, ${$a[1]}); break; etc... There has to be a better way to do this. If I have an array of strings ("variable1", "variable2", 'variable3", ...), how can I instantiate a Class without manually accounting for every possibility?

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • In-memory data structure that supports boolean querying

    - by sanity
    I need to store data in memory where I map one or more key strings to an object, as follows: "green", "blue" -> object1 "red", "yellow" -> object2 I need to be able to efficiently receive a list of objects, where the strings match some boolean criteria, such as: ("red" OR "green") AND NOT "blue" I'm working in Java, so the ideal solution would be an off-the-shelf Java library. I am, however, willing to implement something from scratch if necessary. Anyone have any ideas? I'd rather avoid the overhead of an in-memory database if possible, I'm hoping for something comparable in speed to a HashMap (or at least the same order of magnitude).

    Read the article

  • How do you like to define your module-wide variables in drupal 6?

    - by sprugman
    I'm in my module file. I want to define some complex variables for use throughout the module. For simple things, I'm doing this: function mymodule_init() { define('SOME_CONSTANT', 'foo bar'); } But that won't work for more complex structures. Here are some ideas that I've thought of: global: function mymodule_init() { $GLOBALS['mymodule_var'] = array('foo' => 'bar'); } variable_set: function mymodule_init() { variable_set('mymodule_var', array('foo' => 'bar')); } property of a module class: class MyModule { static $var = array('foo' => 'bar'); } Variable_set/_get seems like the most "drupal" way, but I'm drawn toward the class setup. Are there any drawbacks to that? Any other approaches out there?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • .NET Regex - need matching string for parsing...

    - by TomTom
    Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • facelet - nested <ui:insert>

    - by user321350
    I have multiple templates which differs with each other only by few containers. The most complex one contains superset of all containers used in all other one thus to avoid creating multiple templates I created the most complex one in following format some layout stuff (div and all) defining nested insert for each container and content. Now in client template based on what is needed I turn off container which is not needed as else if container is needed, just define content as doSomething Please let me know if you guys see any issues with this approach, any potential problem or alternate approach for similar scenario. thanks a lot. Maddy

    Read the article

  • Using varible in re.match in python

    - by screwuphead
    I am trying to create an array of things to match in a description line. So I cant ignore them later on in my script. Below is a sample script that I have been working on, on the side. Basically I am trying to take a bunch of strings and match it against a bunch of other strings. AKA: asdf or asfs or wrtw in string = true continue with script if not print this. import re ignorelist = ['^test', '(.*)set'] def guess(a): for ignore in ignorelist: if re.match(ignore, a): return('LOSE!') else: return('WIN!') a = raw_input('Take a guess: ') print guess(a) Thanks

    Read the article

  • Selecting dictionary items by key efficiently in Python

    - by user248237
    suppose I have a dictionary whose keys are strings. How can I efficiently make a new dictionary from that which contains only the keys present in some list? for example: # a dictionary mapping strings to stuff mydict = {'quux': ..., 'bar': ..., 'foo': ...} # list of keys to be selected from mydict keys_to_select = ['foo', 'bar', ...] The way I came up with is: filtered_mydict = [mydict[k] for k in mydict.keys() \ if k in keys_to_select] but I think this is highly inefficient because: (1) it requires enumerating the keys with keys(), (2) it requires looking up k in keys_to_select each time. at least one of these can be avoided, I would think. any ideas? I can use scipy/numpy too if needed.

    Read the article

  • How to test Language DLLs?

    - by EKI
    Our application offer the user to display different languages if they have the approppriate Language DLL (say German.DLL, French.DLL, even Chinese.DLL). We have functional test to verify that those DLLs enable the right options in a Combobox and that choosing them will actually translate strings in the UI. I would like to know options to test this translation dll's more in depth, maybe ensuring that all the characters in the selected langauge (and in the file) can be correctly displayed, or that the internal structure of the DLL is consistent, there are no strings exceeding the limits that are expected of them, etc... Any suggestions on what to test and how to test it? Does anyone know specific problems that may arise and we should check? Thanks in advance.

    Read the article

  • Map a property in the entity framework to a different type

    - by Tom
    I have a SQL Server 2008 database. I have a bunch of fields in TableA that are just strings that corresponds to booleans. So every value is either true or false. The edmx I generated using Entity Framework 4.0 has them as strings. This is technically correct but I would like to have them mapped as Booleans instead. Is this possible? If so how can I accomplish this? Thanks much!

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

< Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >