Search Results

Search found 19635 results on 786 pages for 'materialized path pattern'.

Page 105/786 | < Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >

• How can I use jQuery to match a string inside the current URL of the window I am in?

  - by Jannis

  Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• DDD: Getting aggregate roots for other aggregates

  - by Ed

  I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

  Read the article

• How do you handle EF Data Contexts combined with asp.net custom membership/role providers

  - by KallDrexx

  I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

  Read the article

• C# remove redundant paths from a list

  - by andrew

  Say I have this list List<string> sampleList = new List<string> { "C:\\Folder1", "D:\\Folder2", "C:\\Folder1\\Folder3", "C:\\Folder111\\Folder4" }; I'd like to remove the paths that are contained in other folders, for example we have C:\Folder1 and C:\Folder1\Folder3 the second entry should go away because C:\Folder1 contains C:\Folder1\Folder3 is there something that does that in the .net framework or do i have to write the algo myself?

  Read the article

• How does a Perl program know where to find the file containing Perl module it uses?

  - by DVK

  If my Perl program uses Perl modules, how will it determine where to find the file containing the module code? For example, if the program contains: use MyModule1; # Example 1 use This::Here::MyModule2; # Example 2 where will it look?

  Read the article

• Regular Expressions: Positive Lookahead and Word Border question

  - by Inf.S

  Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

  Read the article

• controlling which project header file Xcode will include

  - by jdmuys

  My Xcode project builds to variations of the same product using two targets. The difference between the two is only on which version of an included library is used. For the .c source files it's easy to assign the correct version to the correct target using the target check box. However, including the header file always includes the same one. This is correct for one target, but wrong for the other one. Is there a way to control which header file is included by each target? Here is my project file hierarchy (which is replicated in Xcode): MyProject TheirOldLib theirLib.h theirLib.cpp TheirNewLib theirLib.h theirLib.cpp myCode.cpp and myCode.cpp does thing such as: #include "theirLib.h" … somecode() { #if OLDVERSION theirOldLibCall(…); #else theirNewLibCall(…); #endif } And of course, I define OLDVERSION for one target and not for the other. So is there a way to tell Xcode which theirLib.h to include per target? Constraints: - the two header files have the same name. As a last resort, I could rename one of them, but I'd rather avoid that as this will lead to major hair pulling on the other platforms. - I'm free to tweak my project as I otherwise see fit Thanks for any help.

  Read the article

• Apache local configuration to resolve files correctly

  - by Alex E.

  Hello, I am new at this so bare with me. I have just configured Apache and PHP to work on my local Mac OS X computer. Now PHP works fine, except when I try to load the files for my live sites. The live sites have separate directories and are sorted by client name etc. I've created symlinks in the default root for the local web server documents. My issue is that Apache doesn't seem to want to load any of the relative paths that are found in the HTML pages. For example, I have src="/css/main.css" but Apache doesn't load the file, similarly for images, it just resolves as a file not found 404 error. I then thought it might be the symlinks so I copied the full directory into the Apache document root, and still had the same result. I would really love to setup my local development environment to run Apache, PHP, MySQL to develop locally then publish when ready. I also tried the MAMP installation, and had the same issues. Any help at all in this would be greatly appreciated. If my explanation wasn't clear please let me know. Thanks! Alex.

  Read the article

• Does .NET Regex support global matching?

  - by Dave

  I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

  Read the article

• ASP.NET: convert UNC to file:/// URL

  - by Heinzi

  I need to convert UNC paths to file:/// URLs, e.g. \\fileserver\share\dir\some file.ext --> file://///fileserver/share/dir/some%20file.ext Is there some built-in function for this?

  Read the article

• How can I extract the nth occurrence of a match in a Perl regex?

  - by Zaid

  Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

  Read the article

• How to get R to recognize your working directory as its working directory?

  - by Dan Goldstein

  I use R under Windows on several machines. I know you can set the working directory from within an R script, like this setwd("C:/Documents and Settings/username/My Documents/x/y/z") ... but then this breaks the portability of the script. It's also annoying to have to reverse all the slashes (since Windows gives you backslashes) Is there a way to start R in a particular working directory so that you don't need to do this at the script level?

  Read the article

• How can I substitute the nth occurrence of a match in a Perl regex?

  - by Zaid

  Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

  Read the article

• Rename a file with perl

  - by perlnoob

  I have a file in a different folder I want to rename in perl, I was looking at a solution earlier that showed something like this: for (<backup.rar>) { my $file = $_; my $new = $_ 'backup'. @test .'.rar'; rename $file, $new or die "Error, can not rename $file as $new: $!"; } however backup.rar is in a different folder, I did try putting "C:\backup\backup.rar" in the < above, however I got the same error. C:\Program Files\WinRARperl backup.pl String found where operator expected at backup.pl line 35, near "$_ 'backup'" (Missing operator before 'backup'?) syntax error at backup.pl line 35, near "$_ 'backup'" Execution of backup.pl aborted due to compilation errors. I was using # Get time my @test = POSIX::strftime("%m-%d-%Y--%H-%M-%S\n", localtime); print @test; To get the current time, however I couldn't seem to get it to rename correctly. What can I do to fix this? Please note I am doing this on a windows box.

  Read the article

• Multi-tenant Access Control: Repository or Service layer?

  - by FreshCode

  In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

  Read the article

• Apache URL rewrite query

  - by ant-1980

  Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

  Read the article

• Comparing 2 columns in the same table with the "Like" function

  - by Vic

  I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

  Read the article

• PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

  - by Lightworker

  I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

  Read the article

• Can anyone explain UriMatcher (Android SDK)?

  - by mobibob

  I have been tasked with designing my web services client code to use the utility class UriMatcher in the Android SDK. Unfortunately, the example in the Dev Guide does not relate to anything in my mind. I know I am missing some fundamental points to the functionality and possibly about Uri itself. If you can tie it to some web APIs that are accessible with HTTP POST request, that would be ideal.

  Read the article

• C# Inheritence: Choosing what repository based on type of inherited class

  - by Oskar Kjellin

  I have been making a program that downloads information about movies from the internet. I have a base class Title, which represents all titles. Movie, Serie and Episode are inherited from that class. To save them to the database I have 2 services, MovieService and SerieService. They in turn call repositories, but that is not important here. I have a method Save(Title title) which I am not very happy with. I check for what type the title is and then call the correct service. I would like to perhaps write like this: ITitleService service = title.GetService(); title.GetSavedBy(service); So I have an abstract method on Title that returns an ITitleSaver, which will return the correct service for the instance. My question is how should I implement ITitleSaver? If I make it accept Title I will have to cast it to the correct type before calling the correct overload. Which will lead to having to deal with casting once again. What is the best approach to dealing with this? I would like to have the saving logic in the corresponding class.

  Read the article

• WPF tree data binding

  - by Am

  Hi, I have a well defined tree repository. Where I can rename items, move them up, down, etc. Add new and delete. The data is stored in a table as follows: Index Parent Label Left Right 1 0 root 1 14 2 1 food 2 7 3 2 cake 3 4 4 2 pie 5 6 5 1 flowers 8 13 6 5 roses 9 10 7 5 violets 11 12 Representing the following tree: (1) root (14) (2) food (7) (8) flowers (13) (3) cake (4) (5) pie (6) (9) roeses (10) (11) violets (12) or root food cake pie flowers roses violets Now, my problem is how to represent this in a bindable way, so that a TreeView can handle all the possible data changes? Renaming is easy, all I need is to make the label an updatble field. But what if a user moves flowers above food? I can make the relevant data changes, but they cause a complete data change to all other items in the tree. And all the examples I found of bindable hierarchies are good for non static trees.. So my current (and bad) solution is to reload the displayed tree after relocation change. Any direction will be good. Thanks

  Read the article

• C# Silverlight - XmlDictionary from Uri

  - by Robert White

  I've been developing a Silverlight application for a company's website and have encountered a problem. Up until now I have been programming this locally, now I need to publish the program onto the website; the issue is that FileStream can only access local files with elevated permissions. Here's a snippet of code: using (FileStream fileStream = new FileStream(@"E:\Users\LUPUS\Documents\Visual Studio 2010\Projects\Lycaon5\Lycaon5\acids.xdb", FileMode.Open)) { using (XmlDictionaryReader reader = XmlDictionaryReader.CreateTextReader(fileStream, XmlDictionaryReaderQuotas.Max)) { //Read the XML file out. } } Without changing anything to do with XmlDictionaryReader reader - How could I go about reading the files from a relative Uri? Many Thanks, Rob. P.s. Apologies for the lack of formatting, me cave man, me don't know how.

  Read the article

• Bourne Shell: Convert ~/Desktop to /users/me/Desktop

  - by sixtyfootersdude

  Incredably annoyed at the Java Keytool. So much so that I have created a new tag: "SunSuck". The keytool does not resolve impartial directories. Ie this works: keytool -keystore "/users/me/Desktop" ... This doesn't: keytool -keystore "~/Desktop" ... Is there something that I could call like this: keytool -keystore "$(<cmd> ~/Desktop)" ...

  Read the article

• Dependency injection and factory

  - by legenden

  Trying to figure out how to best handle the following scenario: Assume a RequestContext class which has a dependency to an external service, such as: public class RequestContext : IRequestContext { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContext(ServiceFactory<IWeatherService> weatherService, UserLocation location, string query) { _weatherService = weatherService; ... What sort of dependency should I require in the class that will ultimately instantiate RequestContext? It could be ServiceFactory<IWeatherService>, but that doesn't seem right, or I could create an IRequestContextFactory for it along the lines of: public class RequestContextFactory : IRequestContextFactory { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContextFactory(ServiceFactory<IWeatherService> weatherService) { _weatherService = weatherService; } public RequestContext Create(UserLocation location, string query) { return new RequestContext(_weatherService, location, query); } } And then pass the IRequestContextFactory through constructor injection. This seems like a good way to do it, but the problem with this approach is that I think it hinders discoverability (devs must know about the factory and implement it, which is not really apparent). Is there a better/more discoverable way that I'm missing?

  Read the article

< Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >