Search Results

Search found 19635 results on 786 pages for 'materialized path pattern'.

Page 105/786 | < Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • C# remove redundant paths from a list

    - by andrew
    Say I have this list List<string> sampleList = new List<string> { "C:\\Folder1", "D:\\Folder2", "C:\\Folder1\\Folder3", "C:\\Folder111\\Folder4" }; I'd like to remove the paths that are contained in other folders, for example we have C:\Folder1 and C:\Folder1\Folder3 the second entry should go away because C:\Folder1 contains C:\Folder1\Folder3 is there something that does that in the .net framework or do i have to write the algo myself?

    Read the article

  • Anyone has implemented SMA* search algorithm?

    - by Endy
    I find the algorithm description in AIMA (Artificial Intelligence: A Modern Approach) is not correct at all. What does 'necessary' mean? What is the memory limit? The queue size or processed nodes? What if the current node has no children at all? I am wondering if this algorithm itself is correct or not. Because I searched the Internet and nobody has implemented it yet. Thanks.

    Read the article

  • controlling which project header file Xcode will include

    - by jdmuys
    My Xcode project builds to variations of the same product using two targets. The difference between the two is only on which version of an included library is used. For the .c source files it's easy to assign the correct version to the correct target using the target check box. However, including the header file always includes the same one. This is correct for one target, but wrong for the other one. Is there a way to control which header file is included by each target? Here is my project file hierarchy (which is replicated in Xcode): MyProject TheirOldLib theirLib.h theirLib.cpp TheirNewLib theirLib.h theirLib.cpp myCode.cpp and myCode.cpp does thing such as: #include "theirLib.h" … somecode() { #if OLDVERSION theirOldLibCall(…); #else theirNewLibCall(…); #endif } And of course, I define OLDVERSION for one target and not for the other. So is there a way to tell Xcode which theirLib.h to include per target? Constraints: - the two header files have the same name. As a last resort, I could rename one of them, but I'd rather avoid that as this will lead to major hair pulling on the other platforms. - I'm free to tweak my project as I otherwise see fit Thanks for any help.

    Read the article

  • Apache local configuration to resolve files correctly

    - by Alex E.
    Hello, I am new at this so bare with me. I have just configured Apache and PHP to work on my local Mac OS X computer. Now PHP works fine, except when I try to load the files for my live sites. The live sites have separate directories and are sorted by client name etc. I've created symlinks in the default root for the local web server documents. My issue is that Apache doesn't seem to want to load any of the relative paths that are found in the HTML pages. For example, I have src="/css/main.css" but Apache doesn't load the file, similarly for images, it just resolves as a file not found 404 error. I then thought it might be the symlinks so I copied the full directory into the Apache document root, and still had the same result. I would really love to setup my local development environment to run Apache, PHP, MySQL to develop locally then publish when ready. I also tried the MAMP installation, and had the same issues. Any help at all in this would be greatly appreciated. If my explanation wasn't clear please let me know. Thanks! Alex.

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • How to get R to recognize your working directory as its working directory?

    - by Dan Goldstein
    I use R under Windows on several machines. I know you can set the working directory from within an R script, like this setwd("C:/Documents and Settings/username/My Documents/x/y/z") ... but then this breaks the portability of the script. It's also annoying to have to reverse all the slashes (since Windows gives you backslashes) Is there a way to start R in a particular working directory so that you don't need to do this at the script level?

    Read the article

  • C# Inheritence: Choosing what repository based on type of inherited class

    - by Oskar Kjellin
    I have been making a program that downloads information about movies from the internet. I have a base class Title, which represents all titles. Movie, Serie and Episode are inherited from that class. To save them to the database I have 2 services, MovieService and SerieService. They in turn call repositories, but that is not important here. I have a method Save(Title title) which I am not very happy with. I check for what type the title is and then call the correct service. I would like to perhaps write like this: ITitleService service = title.GetService(); title.GetSavedBy(service); So I have an abstract method on Title that returns an ITitleSaver, which will return the correct service for the instance. My question is how should I implement ITitleSaver? If I make it accept Title I will have to cast it to the correct type before calling the correct overload. Which will lead to having to deal with casting once again. What is the best approach to dealing with this? I would like to have the saving logic in the corresponding class.

    Read the article

  • Rename a file with perl

    - by perlnoob
    I have a file in a different folder I want to rename in perl, I was looking at a solution earlier that showed something like this: for (<backup.rar>) { my $file = $_; my $new = $_ 'backup'. @test .'.rar'; rename $file, $new or die "Error, can not rename $file as $new: $!"; } however backup.rar is in a different folder, I did try putting "C:\backup\backup.rar" in the < above, however I got the same error. C:\Program Files\WinRARperl backup.pl String found where operator expected at backup.pl line 35, near "$_ 'backup'" (Missing operator before 'backup'?) syntax error at backup.pl line 35, near "$_ 'backup'" Execution of backup.pl aborted due to compilation errors. I was using # Get time my @test = POSIX::strftime("%m-%d-%Y--%H-%M-%S\n", localtime); print @test; To get the current time, however I couldn't seem to get it to rename correctly. What can I do to fix this? Please note I am doing this on a windows box.

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • Apache URL rewrite query

    - by ant-1980
    Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

    Read the article

  • C#/ASP.NET MVC 4 Instantiate Object Derived From Interface In Factory Method

    - by Chris
    Currently have a Factory class that features a GetSelector function, which returns a concrete implementation of ISelector. I have several different classes that implement ISelector and based on a setting I would like to receive the appropriate ISelector back. public interface ISelector { string GetValue(string Params); } public class XmlSelector : ISelector { public string GetValue(string Params) { // open XML file and get value } } public static class SelectorFactory { public static ISelector GetSelector() { return new XmlSelector(); // Needs changing to look at settings } } My question is what is the best way to store the setting? I am aware of using AppSettings etc. but I'm not sure whether I want to have to store strings in the web.config and perform a switch on it - just seems to be really tightly coupled in that if a new implementation of ISelector is made, then the Factory would need to be changed. Is there any way of perhaps storing an assembly name and instantiating based on that? Thanks, Chris

    Read the article

  • Horrorble performance using ListViews with nested objects in WPF

    - by Christian
    Hi community, like mentioned in the title I get a horrible performance if I use ListViews with nested objects. My scenario is: Each row of a ListView presents an object of the class Transaction with following attributes: private int mTransactionID; private IBTTransactionSender mSender; private IBTTransactionReceiver mReceiver; private BTSubstrate mSubstrate; private double mAmount; private string mDeliveryNote; private string mNote; private DateTime mTransactionDate; private DateTime mCreationTimestamp; private BTEmployee mEmployee; private bool mImported; private bool mDescendedFromRecurringTransaction; Each attribute can be accessed by its corresponding property. An ObservableCollection<Transaction> is bound to the ItemsSource of a ListView. The ListView itself looks like the following: </ListView.GroupStyle> <ListView.View> <GridView> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.ToSave" Width="80"> <GridViewColumnHeader Name="GVCHLoadedToSave" Style="{StaticResource ListViewHeaderStyle}">Speichern</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <CheckBox Name="CBListViewItem" IsChecked="{Binding Path=Transaction.ToSave, Mode=TwoWay, UpdateSourceTrigger=PropertyChanged}"></CheckBox> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.TransactionDate" Width="80"> <GridViewColumnHeader Name="GVCHLoadedDate" Style="{StaticResource ListViewHeaderStyle}">Datum</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding ElementName=DPDate, Path=Text}" Style="{StaticResource GridBlockStyle}"/> <toolkit:DatePicker Name="DPDate" Width="{Binding ElementName=GVCHDate, Path=ActualWidth}" SelectedDateFormat="Short" Style="{StaticResource GridEditStyle}" SelectedDate="{Binding Path=Transaction.TransactionDate, Mode=TwoWay}" SelectedDateChanged="DPDate_SelectedDateChanged"/> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.Sender.Description" Width="120"> <GridViewColumnHeader Name="GVCHLoadedSender" Style="{StaticResource ListViewHeaderStyle}">Von</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.Sender.Description}" Style="{StaticResource GridBlockStyle}"/> <ComboBox Name="CBSender" Width="{Binding ElementName=GVCHSender, Path=ActualWidth}" SelectedItem="{Binding Path=Transaction.Sender}" DisplayMemberPath="Description" Text="{Binding Path=Sender.Description, Mode=OneWay}" ItemsSource="{Binding ElementName=Transaction, Path=SenderList}" Style="{StaticResource GridEditStyle}"> </ComboBox> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.Receiver.Description" Width="120"> <GridViewColumnHeader Name="GVCHLoadedReceiver" Style="{StaticResource ListViewHeaderStyle}">Nach</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.Receiver.Description}" Style="{StaticResource GridBlockStyle}"/> <ComboBox Name="CBReceiver" Width="{Binding ElementName=GVCHReceiver, Path=ActualWidth}" SelectedItem="{Binding Path=Transaction.Receiver}" DisplayMemberPath="Description" Text="{Binding Path=Receiver.Description, Mode=OneWay}" ItemsSource="{Binding ElementName=Transaction, Path=ReceiverList}" Style="{StaticResource GridEditStyle}"> </ComboBox> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.Substrate.Description" Width="140"> <GridViewColumnHeader Name="GVCHLoadedSubstrate" Style="{StaticResource ListViewHeaderStyle}">Substrat</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.Substrate.Description}" Style="{StaticResource GridBlockStyle}"/> <ComboBox Name="CBSubstrate" Width="{Binding ElementName=GVCHSubstrate, Path=ActualWidth}" SelectedItem="{Binding Path=Transaction.Substrate}" DisplayMemberPath="Description" Text="{Binding Path=Substrate.Description, Mode=OneWay}" ItemsSource="{Binding ElementName=Transaction, Path=SubstrateList}" Style="{StaticResource GridEditStyle}"> </ComboBox> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.Amount" Width="80"> <GridViewColumnHeader Name="GVCHLoadedAmount" Style="{StaticResource ListViewHeaderStyle}">Menge [kg]</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.Amount}" Style="{StaticResource GridBlockStyle}"/> <TextBox Name="TBAmount" Text="{Binding Path=Transaction.Amount, Mode=TwoWay, UpdateSourceTrigger=PropertyChanged}" Width="{Binding ElementName=GVCHAmount, Path=ActualWidth}" Style="{StaticResource GridTextBoxStyle}" /> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.DeliveryNote" Width="100"> <GridViewColumnHeader Name="GVCHLoadedDeliveryNote" Style="{StaticResource ListViewHeaderStyle}">Lieferschein Nr.</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.DeliveryNote}" Style="{StaticResource GridBlockStyle}"/> <TextBox Name="TBDeliveryNote" Text="{Binding Path=Transaction.DeliveryNote, Mode=TwoWay, UpdateSourceTrigger=PropertyChanged}" Width="{Binding ElementName=GVCHDeliveryNote, Path=ActualWidth}" Style="{StaticResource GridEditStyle}" /> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.Note" Width="190"> <GridViewColumnHeader Name="GVCHLoadedNote" Style="{StaticResource ListViewHeaderStyle}">Bemerkung</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.Note}" Style="{StaticResource GridBlockStyle}"/> <TextBox Name="TBNote" Text="{Binding Path=Transaction.Note, Mode=TwoWay, UpdateSourceTrigger=PropertyChanged}" Width="{Binding ElementName=GVCHNote, Path=ActualWidth}" Style="{StaticResource GridEditStyle}" /> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> <GridViewColumn core:SortableListView.SortPropertyName="Transaction.Employee.LastName" Width="100"> <GridViewColumnHeader Name="GVCHLoadedEmployee" Style="{StaticResource ListViewHeaderStyle}">Mitarbeiter</GridViewColumnHeader> <GridViewColumn.CellTemplate> <DataTemplate> <Grid> <TextBlock Text="{Binding Path=Transaction.Employee.LastName}" Style="{StaticResource GridBlockStyle}"/> <ComboBox Name="CBEmployee" Width="{Binding ElementName=GVCHEmployee, Path=ActualWidth}" SelectedItem="{Binding Path=Transaction.Employee}" DisplayMemberPath="LastName" Text="{Binding Path=Employee.LastName, Mode=OneWay}" ItemsSource="{Binding ElementName=Transaction, Path=EmployeeList}" Style="{StaticResource GridEditStyle}"> </ComboBox> </Grid> </DataTemplate> </GridViewColumn.CellTemplate> </GridViewColumn> </GridView> </ListView.View> </ListView> As you can see in the screenshot the user got the possibility to change the values of the transaction attributes with comboboxes. Ok now to my problem. If I click on the "Laden" button the application will load about 150 entries in the ObservableCollection<Transaction>. Before I fill the collection I set the ItemsSource of the ListView to null and after filling I bind the collection to the ItemsSource once again. The loading itself takes a few milliseconds, but the rendering of the filled collection takes a long time (150 entries = about 20 sec). I tested to delete all Comboboxes out of the xaml and i got a better performance, because I don't have to fill the ComboBoxes for each row. But I need to have these comboboxes for modifing the attributes of the Transaction. Does anybody know how to improve the performance? THX

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • Simulink: Specifying trajectory

    - by stanigator
    I would like to use jtraj to specify a trajectory in a Simulink model. Below are what I attempted to retrieve in the command prompt: Q0 = [1 1 0]; Q1 = [1+0.5*cos(2*20) 1+0.5*sin(2*20) 0]; t = 0:0.1:20; [Q, Qd, Qdd] = jtraj(Q0, Q1, t); However, I don't know how to include such trajectory data in the Simulink model easily. Any comments? Thanks in advance.

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • Dependecy Injection with Massive ORM: dynamic trouble

    - by Sergi Papaseit
    I've started working on an MVC 3 project that needs data from an enormous existing database. My first idea was to go ahead and use EF 4.1 and create a bunch of POCO's to represent the tables I need, but I'm starting to think the mapping will get overly complicated as I only need some of the columns in some of the tables. (thanks to Steven for the clarification in the comments. So I thought I'd give Massive ORM a try. I normally use a Unit of Work implementation so I can keep everything nicely decoupled and can use Dependency Injection. This is part of what I have for Massive: public interface ISession { DynamicModel CreateTable<T>() where T : DynamicModel, new(); dynamic Single<T>(string where, params object[] args) where T : DynamicModel, new(); dynamic Single<T>(object key, string columns = "*") where T : DynamicModel, new(); // Some more methods supported by Massive here } And here's my implementation of the above interface: public class MassiveSession : ISession { public DynamicModel CreateTable<T>() where T : DynamicModel, new() { return new T(); } public dynamic Single<T>(string where, params object[] args) where T: DynamicModel, new() { var table = CreateTable<T>(); return table.Single(where, args); } public dynamic Single<T>(object key, string columns = "*") where T: DynamicModel, new() { var table = CreateTable<T>(); return table.Single(key, columns); } } The problem comes with the First(), Last() and FindBy() methods. Massive is based around a dynamic object called DynamicModel and doesn't define any of the above method; it handles them through a TryInvokeMethod() implementation overriden from DynamicObject instead: public override bool TryInvokeMember(InvokeMemberBinder binder, object[] args, out object result) { } I'm at a loss on how to "interface" those methods in my ISession. How could my ISession provide support for First(), Last() and FindBy()? Put it another way, how can I use all of Massive's capabilities and still be able to decouple my classes from data access?

    Read the article

  • C# Silverlight - XmlDictionary from Uri

    - by Robert White
    I've been developing a Silverlight application for a company's website and have encountered a problem. Up until now I have been programming this locally, now I need to publish the program onto the website; the issue is that FileStream can only access local files with elevated permissions. Here's a snippet of code: using (FileStream fileStream = new FileStream(@"E:\Users\LUPUS\Documents\Visual Studio 2010\Projects\Lycaon5\Lycaon5\acids.xdb", FileMode.Open)) { using (XmlDictionaryReader reader = XmlDictionaryReader.CreateTextReader(fileStream, XmlDictionaryReaderQuotas.Max)) { //Read the XML file out. } } Without changing anything to do with XmlDictionaryReader reader - How could I go about reading the files from a relative Uri? Many Thanks, Rob. P.s. Apologies for the lack of formatting, me cave man, me don't know how.

    Read the article

< Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >