Search Results

Search found 6394 results on 256 pages for 'regular expressions'.

Page 194/256 | < Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201  | Next Page >

  • boost test case for function taking user input

    - by oadams
    I have a function that takes in user input via std::cin: std::getline(std::cin, in); and creates a corresponding data structure by matching it with a regular expression. The function then returns this data structure. I'm using boost.test and I want to create a unit test to check that the output data type is correct given some inputs. However I don't know how to go about it since the input isn't passed as an argument to the function. EDIT: Is there a simple way to create a boost test case that feeds the function a string via standard input?

    Read the article

  • Just how much do I want to make virtual?

    - by Alex
    I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

    Read the article

  • byte and short data types in Java can accept the value outside the range by explicit cast. The higher data types however can not. Why?

    - by Lion
    Let's consider the following expressions in Java. byte a = 32; byte b = (byte) 250; int i = a + b; This is valid in Java even though the expression byte b = (byte) 250; is forced to assign the value 250 to b which is outside the range of the type byte. Therefore, b is assigned -6 and consequently i is assigned the value 26 through the statement int i = a + b;. The same thing is possible with short as follows. short s1=(short) 567889999; Although the specified value is outside the range of short, this statement is legal. The same thing is however wrong with higher data types such int, double, folat etc and hence, the following case is invalid and causes a compile-time error. int z=2147483648; This is illegal, since the range of int in Java is from -2,147,483,648 to 2147483647 which the above statement exceeds and issues a compile-time error. Why is such not wrong with byte and short data types in Java?

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • PHP editors for Ubuntu

    - by mepo
    What are the Light weight PHP editors available for ubuntu? And is there a ubuntu version of the Notepad++ editor. For those who haven't used Notepad++, do not confuse it with Notepad.exe. Notepad.exe is the lightweight Windows editor by Microsoft. Notepad++ is an Open Source programmer's text editor for Windows based on SciTE. It has syntax highlighting, code collapsing, language recognition, macro recording, regular expression search and replace across line breaks and in files on disk, copy filenames and paths to clipboard, and many other advance text editing tools. Only the more full-featured editors for Linux would be likely to be suitable replacements for Notepad++. Thanks

    Read the article

  • Making simple tabs in android

    - by user2910566
    I am new to Android. I am making a tab Activity that has 3 tabs in it. . I came across reading some interesting articles that tab can be made in three ways:: Regular TabHost Using simple Fragments Using Action Bar Sherlock I have a set of questions Which is a better choice & why ? Which gives more flexibility, efficiency & performance ? Which would be the preferd choice in case of requirement changes happen in future ? My research indicate :: ActionBarsherlock is better ! Is there something better than this ? If so what is it ?

    Read the article

  • actionscript find and convert text to url

    - by gravesit
    I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Get seleted text parent tag using regex C#

    - by Aruna Tennakoon
    <SPAN id=spanD121C150D2 style="BACKGROUND-COLOR: antiquewhite" CategoryID="1" MessageID="2316" refSpan=""> <SPAN id=span1CE69EDE12 style="BACKGROUND-COLOR: blue" CategoryID="2" MessageID="2316" refSpan="">platnosci inny srodkiem platnosci. DC - zakup paliwa na stacji benzynowej 101-500 (150 zl). 27 </SPAN> </SPAN> I have a string like above. If the selected text is "srodkiem ", is it possible to get the relevant span tag? Is this possible using a regular expression?

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • why does InnoDB keep on growing without for every update?

    - by Akash Kava
    I have a table which consists of heavy blobs, and I wanted to conduct some tests on it. I know deleted space is not reclaimed by innodb, so I decided to reuse existing records by updating its own values instead of createing new records. But I noticed, whether I delete and insert a new entry, or I do UPDATE on existing ROW, InnoDB keeps on growing. Assuming I have 100 Rows, each Storing 500KB of information, My InnoDB size is 10MB, now when I call UPDATE on all rows (no insert/ no delete), the innodb grows by ~8MB for every run I do. All I am doing is I am storing exactly 500KB of data in each row, with little modification, and size of blob is fixed. What can I do to prevent this? I know about optimize table, but I cant do it because on regular usage, the table is going to be 60-100GB big, and running optimize will just stall entire server.

    Read the article

  • PHP reg expr. replace ALL URLs except img src URLs

    - by zilveer
    Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

    Read the article

  • Replace non-html links with <A> tags

    - by tombazza
    I have a block of code that will take a block of text like the following: Sample text sample text http://www.google.com sample text Using the preg_replace_callback method and the following regular expression: preg_replace_callback('/http:\/\/([,\%\w.\-_\/\?\=\+\&\~\#\$]+)/', create_function( '$matches', '$url = $matches[1]; $anchorText = ( strlen($url) > 35 ? substr($url, 0, 35).\'...\' : $url); return \'<a href="http://\'. $url .\'">\'. $anchorText .\'</a>\';'), $str); Will convert the sample text to look like: Sample text sample text < a href="http://www.google.com"http://www.google.com< /a sample text My problem now is that we have introduced a rich text editor that can create links before being sent to the script. I need to update this piece of code so that it will ignore any URLs that are already inside an tag.

    Read the article

  • syntax for MySQL INSERT with an array of columns

    - by Mike_Laird
    I'm new to PHP and MySQL query construction. I have a processor for a large form. A few fields are required, most fields are user optional. In my case, the HTML ids and the MySQL column names are identical. I've found tutorials about using arrays to convert $_POST into the fields and values for INSERT INTO, but I can't get them working - after many hours. I've stepped back to make a very simple INSERT using arrays and variables, but I'm still stumped. The following line works and INSERTs 5 items into a database with over 100 columns. The first 4 items are strings, the 5th item, monthlyRental is an integer. $query = "INSERT INTO `$table` (country, stateProvince, city3, city3Geocode, monthlyRental) VALUES ( '$country', '$stateProvince', '$city3', '$city3Geocode', '$monthlyRental')"; When I make an array for the fields and use it, as follows: $colsx = array('country,', 'stateProvince,', 'city3,', 'city3Geocode,', 'monthlyRental'); $query = "INSERT INTO `$table` ('$colsx') VALUES ( '$country', '$stateProvince', '$city3', '$city3Geocode', '$monthlyRental')"; I get a MySQL error - check the manual that corresponds to your MySQL server version for the right syntax to use near ''Array') VALUES ( 'US', 'New York', 'Fairport, Monroe County, New York', '(43.09)' at line 1. I get this error whether the array items have commas inside the single quotes or not. I've done a lot of reading and tried many combinations and I can't get it. I want to see the proper syntax on a small scale before I go back to foreach expressions to process $_POST and both the fields and values are arrays. And yes, I know I should use mysql_real_escape_string, but that is an easy later step in the foreach. Lastly, some clues about the syntax for an array of values would be helpful, particularly if it is different from the fields array. I know I need to add a null as the first array item to trigger the MySQL autoincrement id. What else? I'm pretty new, so please be specific.

    Read the article

  • richtextbox font

    - by habbo95
    hi.... I want to change the font color and size for 1 line in richTextBox enter code here String [] Words = {"hi","hello","11111","he","she"}; richTextBox1.SelectionFont = new Font("Verdana", 10, FontStyle.Regular); richTextBox1.SelectionColor = Color.Blue; richTextBox1.SelectedText += Environment.NewLine + wo[0]; richTextBox1.SelectedText += Environment.NewLine + wo[1]; richTextBox1.SelectedText += Environment.NewLine + wo[2]; richTextBox1.SelectedText += Environment.NewLine + wo[3]; richTextBox1.SelectedText += Environment.NewLine + wo[4]; I want to change just the string "11111" and keep the rest lines as default any help

    Read the article

  • Zend Framework: How to handle exceptions in Ajax requests?

    - by understack
    Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

    Read the article

  • Given a user control with a form containing validation can I validate entirely server side?

    - by JoshBaltzell
    We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

    Read the article

  • How do I compute a variable in Javascript if and only if it is used?

    - by LLer
    This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

    Read the article

  • compare date split across colums

    - by alex-tech
    Greetings. I am querying tables from Microsoft SQL 2008 which have date split across 3 columns: day, month and year. Unfortunately, I do not have control over this because data is coming in to the database daily from a 3rd party source in that format. I need to add between to a where clause so user can pull records within a range. Would be easy enough if date was in a single column but finding it nearly impossible when its split across three columns. To display the date, I am doing a CAST( CAST(year as varchar(4)) + '-' + CAST(month as varchar(2)) + '-' + CAST(day as varchar(2)) as date) AS "date"` in a select. I tried to put it as a parameter for datediff function or just the regular between but get no results. Thanks for any help.

    Read the article

  • Get "2:35pm" instead of "02:35PM" from Python date/time?

    - by anonymous coward
    I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

    Read the article

  • Assign RegEx submatches to variables or map (C++/C)

    - by Michael
    I need to extract the SAME type of information (e.g. First name, Last Name, Telephone, ...), from numerous different text sources (each with a different format & different order of the variables of interest). I want a function that does the extraction based on a regular expression and returns the result as DESCRIPTIVE variables. In other words, instead of returning each match result as submatch[0], submatch[1], submatch[2], ..., have it do EITHER of the following: 1.) return std::map so that the submatches can be accessed via: submatch["first_name"], submatch["last_name"], submatch["telephone"] 2.) return a variables with the submatches so that the submatches can be accessed via: submatch_first_name, submatch_last_name, submatch_telephone I can write a wrapper class around boost::regex to do #1, but I was hoping there would be a built-in or a more elegant way to do this in C++/Boost/STL/C.

    Read the article

  • Java Util Linked List - how to find next?

    - by drozzy
    When using Java LinkedList how do you find out the element's next or previous relationships? I mean, in a regular linked list I would do something like this: Node node1 = new Node(); Node node2 = new Node(); LinkedList list = new LinkedList(); list.add(node1); list.add(node2); //then my node1 will know who it's next is: assertEquals(node2, node1.next()); But in Java's LinkedList, the data does not seem to be modified. So how do I actually find out who the "next" (or "previous" in the case of doubly-linked lists) element is?

    Read the article

  • Within headers, images with alt text vs. text

    - by Court
    Do search engines treat the alt text of an image placed within an h1 tag the same way they would treat regular text placed in an h1 tag? I gave a search through here looking for an answer to this question, but was only able to find information on image replacement and the infamous h1 debate. For example would: <h1><img src="#" alt="Contact Us" /></h1> Act the same as: <h1>Contact Us</h1> In the electronic eye of a search engine? This seems considerably less "CSS Hacky" than other image replacement techniques like negative text indents, display:none, height:0, or ridiculous z-index integers.

    Read the article

  • c# performance- create font

    - by user85917
    I have performance issues in this code segment which I think is caused by the "new Font". Will it be faster if fonts are static/global ? if (row.StartsWith(TILD_BEGIN)) { rtbTrace.SelectionColor = Color.Maroon; rtbTrace.SelectionFont = new Font(myFont, (float)8.25, FontStyle.Regular); if (row.StartsWith(BEGIN) ) rtbTrace.AppendText(Environment.NewLine + row + Environment.NewLine); else rtbTrace.AppendText(Environment.NewLine + row.Substring(1) + Environment.NewLine); continue; } if (row.StartsWith(EXCL_BEGIN)) { -- similar block } if (row.StartsWith(DLR_BEGIN)) { -- similar block } . . .

    Read the article

< Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201  | Next Page >