Search Results

Search found 7513 results on 301 pages for 'actual'.

Page 272/301 | < Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >

  • Extending AdapterView

    - by Ander Webbs
    Hi, i'm trying to make (for learning purposes) my own implementation of a simple AdapterView where items comes from an basic Adapter (ImageAdapter from sdk samples). Actual code is like this: public class MyAdapterView extends AdapterView<ImageAdapter> implements AdapterView.OnItemClickListener{ private ImageAdapter mAdapter; public MyAdapterView(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); initThings(); } private void initThings(){ setOnItemClickListener(this); } @Override public ImageAdapter getAdapter() { // TODO Auto-generated method stub return mAdapter; } @Override public void setAdapter(ImageAdapter adapter) { // TODO Auto-generated method stub mAdapter=adapter; requestLayout(); } View obtainView(int position) { View child = mAdapter.getView(position, null, this); return child; } @Override protected void onLayout(boolean changed, int l, int t, int r, int b) { super.onLayout(changed, l, t, r, b); for(int i=0;i<mAdapter.getCount();i++){ View child = obtainView(i); child.layout(10, 70*i, 70, 70); addViewInLayout(child, i, null, true); } this.invalidate(); } @Override public void onItemClick(AdapterView<?> parent, View v, int position, long id) { Log.d("MYEXAMPLES","Clicked an item!"); } } This isn't a coding masterpiece, it just displays a pseudo-listview with pictures. I know i could've used ListView, GridView, Spinner, etc. but i'm relative new to android and i'm trying to figure out some things on it. Well, the question here is: Why is my onItemClick not firing? Using the same ImageAdapter with a GridView, everything works ok, but when i use with above class, i get nothing. Inside AdapterView.java there is code for those click, longclick, etc events... so why can't i just fire them? Maybe i'm misunderstanding basic things on how AdapterView works? Should I extend other base classes instead? And why? Hoping to find more experienced guidance on here, thanks in advance.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • What is the wrong of this converted code?

    - by Gum Slashy
    I'm developing shape identification project using javacv and I have found some opencv code to identify U shapes in particular image and I have try to convert it in to javacv but it doesn't provide same out put. Can you please help me to convert this opencv code into javacv? This is Opencv code import cv2 import numpy as np img = cv2.imread('sofud.jpg') gray = cv2.cvtColor(img,cv2.COLOR_BGR2GRAY) ret,thresh = cv2.threshold(gray,127,255,1) contours,hierarchy = cv2.findContours(thresh,cv2.RETR_LIST,cv2.CHAIN_APPROX_SIMPLE) for cnt in contours: x,y,w,h = cv2.boundingRect(cnt) if 10 < w/float(h) or w/float(h) < 0.1: cv2.rectangle(img,(x,y),(x+w,y+h),(0,0,255),2) cv2.imshow('res',img) cv2.waitKey(0) cv2.destroyAllWindows() This is the expected output This is the code that I have converted import com.googlecode.javacpp.Loader; import com.googlecode.javacv.CanvasFrame; import static com.googlecode.javacpp.Loader.*; import static com.googlecode.javacv.cpp.opencv_core.*; import static com.googlecode.javacv.cpp.opencv_imgproc.*; import static com.googlecode.javacv.cpp.opencv_highgui.*; import java.io.File; import javax.swing.JFileChooser; public class TestBeam { public static void main(String[] args) { CvMemStorage storage=CvMemStorage.create(); CvSeq squares = new CvContour(); squares = cvCreateSeq(0, sizeof(CvContour.class), sizeof(CvSeq.class), storage); JFileChooser f=new JFileChooser(); int result=f.showOpenDialog(f);//show dialog box to choose files File myfile=null; String path=""; if(result==0){ myfile=f.getSelectedFile();//selected file taken to myfile path=myfile.getAbsolutePath();//get the path of the file } IplImage src = cvLoadImage(path);//hear path is actual path to image IplImage grayImage = IplImage.create(src.width(), src.height(), IPL_DEPTH_8U, 1); cvCvtColor(src, grayImage, CV_RGB2GRAY); cvThreshold(grayImage, grayImage, 127, 255, CV_THRESH_BINARY); CvSeq cvSeq=new CvSeq(); CvMemStorage memory=CvMemStorage.create(); cvFindContours(grayImage, memory, cvSeq, Loader.sizeof(CvContour.class), CV_RETR_CCOMP, CV_CHAIN_APPROX_SIMPLE); System.out.println(cvSeq.total()); for (int i = 0; i < cvSeq.total(); i++) { CvRect rect=cvBoundingRect(cvSeq, i); int x=rect.x(),y=rect.y(),h=rect.height(),w=rect.width(); if (10 < (w/h) || (w/h) < 0.1){ cvRectangle(src, cvPoint(x, y), cvPoint(x+w, y+h), CvScalar.RED, 1, CV_AA, 0); //cvSeqPush(squares, rect); } } CanvasFrame cnvs=new CanvasFrame("Beam"); cnvs.setDefaultCloseOperation(javax.swing.JFrame.EXIT_ON_CLOSE); cnvs.showImage(src); //cvShowImage("Final ", src); } } This is the out put that I got please can some one help me to solve this problem ?

    Read the article

  • 2nd Year College - Learning - Microsoft Server Products

    - by Ryan
    As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • How do I call a function name that is stored in a hash in Perl?

    - by Ether
    I'm sure this is covered in the documentation somewhere but I have been unable to find it... I'm looking for the syntactic sugar that will make it possible to call a method on a class whose name is stored in a hash (as opposed to a simple scalar): use strict; use warnings; package Foo; sub foo { print "in foo()\n" } package main; my %hash = (func => 'foo'); Foo->$hash{func}; If I copy $hash{func} into a scalar variable first, then I can call Foo->$func just fine... but what is missing to enable Foo->$hash{func} to work? (EDIT: I don't mean to do anything special by calling a method on class Foo -- this could just as easily be a blessed object (and in my actual code it is); it was just easier to write up a self-contained example using a class method.) EDIT 2: Just for completeness re the comments below, this is what I'm actually doing (this is in a library of Moose attribute sugar, created with Moose::Exporter): # adds an accessor to a sibling module sub foreignTable { my ($meta, $table, %args) = @_; my $class = 'MyApp::Dir1::Dir2::' . $table; my $dbAccessor = lcfirst $table; eval "require $class" or do { die "Can't load $class: $@" }; $meta->add_attribute( $table, is => 'ro', isa => $class, init_arg => undef, # don't allow in constructor lazy => 1, predicate => 'has_' . $table, default => sub { my $this = shift; $this->debug("in builder for $class"); ### here's the line that uses a hash value as the method name my @args = ($args{primaryKey} => $this->${\$args{primaryKey}}); push @args, ( _dbObject => $this->_dbObject->$dbAccessor ) if $args{fkRelationshipExists}; $this->debug("passing these values to $class -> new: @args"); $class->new(@args); }, ); } I've replaced the marked line above with this: my $pk_accessor = $this->meta->find_attribute_by_name($args{primaryKey})->get_read_method_ref; my @args = ($args{primaryKey} => $this->$pk_accessor); PS. I've just noticed that this same technique (using the Moose meta class to look up the coderef rather than assuming its naming convention) cannot also be used for predicates, as Class::MOP::Attribute does not have a similar get_predicate_method_ref accessor. :(

    Read the article

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • Simple RSA encryption (Java)

    - by jake blue
    This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

    Read the article

  • NHibernate unable to create SessionFactory

    - by Tyler
    I'm having a bit of trouble setting up NHibernate, and I'm not too sure what the problem is exactly. I'm attempting to save a domain object to the database (Oracle 10g XE). However, I'm getting a TypeInitializationException while trying to create the ISessionFactory. Here is what my hibernate.cfg.xml looks like: <?xml version="1.0" encoding="utf-8"?> <hibernate-configuration xmlns="urn:nhibernate-configuration-2.2" > <session-factory name="MyProject.DataAccess"> <property name="connection.driver_class">NHibernate.Driver.OracleClientDriver</property> <property name="connection.connection_string"> User ID=myid;Password=mypassword;Data Source=localhost </property> <property name="show_sql">true</property> <property name="dialect">NHibernate.Dialect.OracleDialect</property> <property name="proxyfactory.factory_class">NHibernate.ByteCode.LinFu.ProxyFactoryFactory, NHibernate.ByteCode.LinFu</property> <mapping resource="MyProject/Domain/User.hbm.xml"/> </session-factory> </hibernate-configuration> I created a DAO which I will use to persist domain objects to the database. The DAO uses a HibernateUtil class that creates the SessionFactory. Both classes are in the DataAccess namespace along with the Hibernate configuration. This is where the exception is occuring. Here's that class: public class HibernateUtil { private static ISessionFactory SessionFactory = BuildSessionFactory(); private static ISessionFactory BuildSessionFactory() { try { // This seems to be where the problem occurs return new Configuration().Configure().BuildSessionFactory(); } catch (TypeInitializationException ex) { Console.WriteLine("Initial SessionFactory creation failed." + ex); throw new Exception("Unable to create SessionFactory."); } } public static ISessionFactory GetSessionFactory() { return SessionFactory; } } The DataAccess namespace references the NHibernate DLLs. This is virtually the same setup I've used with Hibernate in Java, so I'm not entirely sure what I'm doing wrong here. Any ideas? Edit The innermost exception is the following: "Could not find file 'C:\Users\Tyler\Documents\Visual Studio 2010\Projects\MyProject\MyProject\ConsoleApplication\bin\Debug\hibernate.cfg.xml'." ConsoleApplication contains the entry point where I've created a User object and am trying to persist it with my DAO. Why is it looking for the configuration file there? The actual persisting takes place in the DAO, which is in DataAccess. Also, when I add the configuration file to ConsoleApplication, it still does not find it.

    Read the article

  • jQuery .live() not working.

    - by Silvio Iannone
    Hi there, my actual problem is that .live() jQuery method is not working. This si the code where i use it: jQuery.fn.sb_animateMenuItem = function() { var mousehoverColor = '#0089F7'; var duration = 250; return this.each(function() { var originalColor = $(this).css('background-color'); $(this).live('mouseover', function() { this.style.cursor = 'pointer'; $(this).animate().stop(); $(this).animate( { backgroundColor: mousehoverColor }, duration); }); $(this).live('mouseout', function() { this.style.cursor = 'default'; $(this).animate( { backgroundColor: originalColor }, duration); }); }); }; This snipped is used i another page in this way: <script type="text/javascript" src="ui/js/jquery-1.4.2.js"></script> <script type="text/javascript" src="ui/js/jquery-ui-1.8.1.custom.min.js"></script> <script type="text/javascript" src="ui/js/color.js"></script> <script type="text/javascript" src="engine/js/tiny_mce/tiny_mce.js"></script> <script type="text/javascript" src="ui/js/ui.js"></script> <script type="text/javascript"> // UI effects $(document).ready(function() { $('button').sb_animateButton(); $('input').sb_animateInput(); $('.top_menu_item').sb_animateMenuItem(); $('.top_menu_item_right').sb_animateMenuItem(); $('.left_menu_item').sb_animateMenuItem(); }); </script> Since my site uses AJAX requests i used the .live method in the first snippet, but when i load the page the effects are not applied the the button/input... tags. If i remove the .live method and use the 'normal' way, ui effects defined in the first snipped are applied but only the the elements loaded before any AJAX request. The elements loaded after the ajax request are not affected by first snippet (though they have the same selector). Thanks for helping.

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • Jscrollpane causese text to disappear on internet explorer

    - by Crippletoe
    Hello all, in my current site, i am using the new Jscrollpane in order to generate a scrollbar for a menu (not my descision but the designer's descision so i dont wanna get into how 90's that all looks like..). my menu is based on a <UL> the <li> elements inside it have the attribute "text-align: right;". my problem that on IE alone the menu text doesnt show when i apply the ScrollPane to the menu. when i delete the ScrollPane function from my code- the menu re-appears. i checked the page with "microsoft Expression" DOM inspector in order to examine how IE sees my code and i can see the <li> elements there, only the text inside them is missing. when i disable the "text-align: right;" for the <li> in my CSS, the text shows again. i suspect this has something to do with the jScrollPane's containing which is relatively aligned but i cannot be sure.. can anyone suggest some fix for this problem? a link to a page where you can see the problem is here: http://kaplanoland.com/index.php?option=com_content&view=article&id=2&Itemid=12 the problematic menu is on the right side of the page. on every browser but IE you can see the text. only on IE not. my CSS code for that menu (not including the jScrollPane CSS) is here: div#menu2{ position: absolute; top: 123px; right: 36px; width: 330px; height: 150px; } div#menu2_scroll{ /*the actual scroller*/ height: 150px; } div#menu2 div#menu2_contain{ } div#menu2 li{ text-align: right; } div#menu2 li span{ line-height: 18px; } div#menu2 a:link, div#menu2 a:visited{ color: #808285 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 a:hover, div#menu2 li#current a{ color: #000000 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 span.separator{ display: block; padding-top: 12px; padding-bottom: 40px; font-family: Arial, Helvetica, sans-serif; font-size: 12px; font-weight: bold; color: #000000; } div#menu2 span.separator span { padding-top: 12px; border-top-width: 1px; border-top-style: solid; border-top-color: #808285; } thank you all so much.

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • SVG via dynamic XML+XSL

    - by Daniel
    This is a bit of a vague notion which I have been running over in my head, and which I am very curious if there is an elegant method of solving. Perhaps it should be taken as a thought experiment. Imagine you have an XML schema with a corresponding XSL transform, which renders the XML as SVG in the browser. The XSL generates SVG with appropriate Javascript handlers that, ultimately, implement editing-like functionality such that properties of the objects or their locations on the SVG canvas can be edited by the user. For instance, an element can be dragged from one location to another. Now, this isn't particularly difficult - the drag/drop example is simply a matter of changing the (x,y) coordinates of the SVG object, or a resize operation would be a simple matter of changing its width or height. But is there an elegant way to have Javascript work on the DOM of the source XML document instead of the rendered SVG? Why, you ask? Well, imagine you have very complex XSL transforms, where the modification of one property results in complex changes to the SVG. You want to maintain simplicity in your Javascript code, but also a simple way to persist the modified XML back to the server. Some possibilities of how this may function: After modification of the source DOM, simply re-run the XSL transform and replace the original. Downside: brute force, potentially expensive operation. Create id/class naming conventions in the source and target XML/SVG so elements can be related back to each other, and do an XSL transform on only a subset of the new DOM. In other words, modify temporary DOM, apply XSL to it, remove changed elements from SVG, and insert the new one. Downside: May not be possible to apply XSL to temporary in-browser DOMs(?). Also, perhaps a bit convoluted or ugly to maintain. I think that it may be possible to come up with a framework that handles the second scenario, but the challenge would be making it lightweight and not heavily tied to the actual XML schema. Any ideas or other possibilities? Or is there maybe an existing method of doing this which I'm not aware of? UPDATE: To clarify, as I mentioned in a comment below, this aids in separating the draw code from the edit code. For a more concrete example of how this is useful, imagine an element which determines how it is drawn dependent on the value of a property of an adjacent element. It's better to condense that logic directly in the draw code instead of also duplicating it in the edit code.

    Read the article

  • jQuery ajax multiline "script" response

    - by Rendrik
    I'm designing a template creation tool, which uses a jQuery Ajax request that posts parameters to a PHP file. The PHP does the actual generation of the template's HTML. // Send for processing. Expect JS back to execute. function generate() { $.ajax({ type: "POST", url: "generate.php", data: $('#genform :input').serialize(), dataType: "script", beforeSend: function() { $("#loading").html("<img src='images/loadbar.gif' />"); $("#loading") .dialog({ height: 80, width: 256, autoOpen: true, modal: true }); }, success: function(data) { $("#loading").dialog('close'); } }); } My trouble is that I have the ajax dataType: set to "script". Using this, the PHP file generates some jQuery dialogs for any errors which works nicely. However, after I generate the HTML, i'm having trouble passing it back. So I have probably 100 lines of generated HTML and javascript which i'd like to work with. In the PHP file, i've tried: echo('$("#result").html("'.$html.'");'); This does actually work if there are NO line breaks in $html. As soon as there are any line breaks, the Chrome debugger reports "gen.html:1 Uncaught SyntaxError: Unexpected token ILLEGAL". It's obvious that it's trying to eval the returned response headers, but is stopping at any line break. So, to be clear, when I pass $html back, if the contents are this: $html = "<div>hi there</div>"; It works fine (all of my error message dialogs are one line). But if it's: $html = "<div> hi there </div>"; It blows up. I'm really not sure how to get around this, or if there's a better way to go about it. It's important to me to keep the formatting so people can copy the HTML template. I may just break down and display the template file on the PHP page if I can't solve this, but I was really hoping to keep everything within the confines of the HTML page.

    Read the article

  • Blit Queue Optimization Algorithm

    - by martona
    I'm looking to implement a module that manages a blit queue. There's a single surface, and portions of this surface (bounded by rectangles) are copied to elsewhere within the surface: add_blt(rect src, point dst); There can be any number of operations posted, in order, to the queue. Eventually the user of the queue will stop posting blits, and ask for an optimal set of operations to actually perform on the surface. The task of the module is to ensure that no pixel is copied unnecessarily. This gets tricky because of overlaps of course. A blit could re-blit a previously copied pixel. Ideally blit operations would be subdivided in the optimization phase in such a way that every block goes to its final place with a single operation. It's tricky but not impossible to put this together. I'm just trying to not reinvent the wheel. I looked around on the 'net, and the only thing I found was the SDL_BlitPool Library which assumes that the source surface differs from the destination. It also does a lot of grunt work, seemingly unnecessarily: regions and similar building blocks are a given. I'm looking for something higher-level. Of course, I'm not going to look a gift horse in the mouth, and I also don't mind doing actual work... If someone can come forward with a basic idea that makes this problem seem less complex than it does right now, that'd be awesome too. EDIT: Thinking about aaronasterling's answer... could this work? Implement customized region handler code that can maintain metadata for every rectangle it contains. When the region handler splits up a rectangle, it will automatically associate the metadata of this rectangle with the resulting sub-rectangles. When the optimization run starts, create an empty region handled by the above customized code, call this the master region Iterate through the blt queue, and for every entry: Let srcrect be the source rectangle for the blt beng examined Get the intersection of srcrect and master region into temp region Remove temp region from master region, so master region no longer covers temp region Promote srcrect to a region (srcrgn) and subtract temp region from it Offset temp region and srcrgn with the vector of the current blt: their union will cover the destination area of the current blt Add to master region all rects in temp region, retaining the original source metadata (step one of adding the current blt to the master region) Add to master region all rects in srcrgn, adding the source information for the current blt (step two of adding the current blt to the master region) Optimize master region by checking if adjacent sub-rectangles that are merge candidates have the same metadata. Two sub-rectangles are merge candidates if (r1.x1 == r2.x1 && r1.x2 == r2.x2) | (r1.y1 == r2.y1 && r1.y2 == r2.y2). If yes, combine them. Enumerate master region's sub-rectangles. Every rectangle returned is an optimized blt operation destination. The associated metadata is the blt operation`s source.

    Read the article

  • How do I detect server status in a port scanner java implementation

    - by akz
    I am writing a port scanner in Java and I want to be able to distinct the following 4 use cases: port is open port is open and server banner was read port is closed server is not live I have the following code: InetAddress address = InetAddress.getByName("google.com"); int[] ports = new int[]{21, 22, 23, 80, 443}; for (int i = 0; i < ports.length; i++) { int port = ports[i]; Socket socket = null; try { socket = new Socket(address, port); socket.setSoTimeout(500); System.out.println("port " + port + " open"); BufferedReader reader = new BufferedReader( new InputStreamReader(socket.getInputStream())); String line = reader.readLine(); if (line != null) { System.out.println(line); } socket.close(); } catch (SocketTimeoutException ex) { // port was open but nothing was read from input stream ex.printStackTrace(); } catch (ConnectException ex) { // port is closed ex.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null && !socket.isClosed()) { try { socket.close(); } catch (Exception e) { e.printStackTrace(); } } } } The problem is that I get a ConnectionException both when the port is closed and the server cannot be reached but with a different exception message: java.net.ConnectException: Connection timed out: connect when the connection was never established and java.net.ConnectException: Connection refused: connect when the port was closed so I cannot make the distinction between the two use cases without digging into the actual exception message. Same thing happens when I try a different approach for the socket creation. If I use: socket = new Socket(); socket.setSoTimeout(500); socket.connect(new InetSocketAddress(address, port), 1000); I have the same problem but with the SocketTimeoutException instead. I get a java.net.SocketTimeoutException: Read timed out if port was open but there was no banner to be read and java.net.SocketTimeoutException: connect timed out if server is not live or port is closed. Any ideas? Thanks in advance!

    Read the article

  • Id property not populated

    - by fingers
    I have an identity mapping like so: Id(x => x.GuidId).Column("GuidId") .GeneratedBy.GuidComb().UnsavedValue(Guid.Empty); When I retrieve an object from the database, the GuidId property of my object is Guid.Empty, not the actual Guid (the property in the class is of type System.Guid). However, all of the other properties in the object are populated just fine. The database field's data type (SQL Server 2005) is uniqueidentifier, and marked as RowGuid. The application that is connecting to the database is a VB.NET Web Site project (not a "Web Application" or "MVC Web Application" - just a regular "Web Site" project). I open the NHibernate session through a custom HttpModule. Here is the HttpModule: public class NHibernateModule : System.Web.IHttpModule { public static ISessionFactory SessionFactory; public static ISession Session; private static FluentConfiguration Configuration; static NHibernateModule() { if (Configuration == null) { string connectionString = cfg.ConfigurationManager.ConnectionStrings["myDatabase"].ConnectionString; Configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2005.ConnectionString(cs => cs.Is(connectionString))) .ExposeConfiguration(c => c.Properties.Add("current_session_context_class", "web")) .Mappings(x => x.FluentMappings.AddFromAssemblyOf<LeadMap>().ExportTo("C:\\Mappings")); } SessionFactory = Configuration.BuildSessionFactory(); } public void Init(HttpApplication context) { context.BeginRequest += delegate { Session = SessionFactory.OpenSession(); CurrentSessionContext.Bind(Session); }; context.EndRequest += delegate { CurrentSessionContext.Unbind(SessionFactory); }; } public void Dispose() { Session.Dispose(); } } The strangest part of all, is that from my unit test project, the GuidId property is returned as I would expect. I even rigged it to go for the exact row in the exact database as the web site was hitting. The only differences I can think of between the two projects are The unit test project is in C# Something with the way the session is managed between the HttpModule and my unit tests The configuration for the unit tests is as follows: Fluently.Configure() .Database(MsSqlConfiguration.MsSql2005.ConnectionString(cs => cs.Is(connectionString))) .Mappings(x => x.FluentMappings.AddFromAssemblyOf<LeadDetailMap>()); I am fresh out of ideas. Any help would be greatly appreciated. Thanks

    Read the article

  • Make text in a <div> wrap around a child element.

    - by John
    In Word you can place an image on a page and have the text flow nicely around it. I was wondering how far one can get towards this using CSS, noting that is has to work in IE6. I already have something sort of close using float, but the floated child-element still 'blocks' text above it. So it partially wraps. Is it possible to put a child div at some arbitrary position in the parent, and have text flow around it freely? The actual use-case here is to put illustrations inside the main content , where each illustration is implemented inside a child . I repeat, it has to work on IE6. And I don't want to get too involved in browser-specific hacks... floating the child at least works on IE6 with no tweaking. Currently I have like this: <div> <div class="illustration"> <img src="image1.png" /> <p>Illustration caption</p> </div> <p>Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. Atvero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. </p> </div> div.illustration { float:right; border-top: 1px solid #505050; border-left: 1px solid #505050; border-right: 1px solid #505050; border-bottom: 1px solid #505050; margin-right:30px; margin-top:100px; text-align:center; padding:2px; background: #96C3FF; } div.illustration p { margin:0; font-size:small; font-style:italic; padding:0; }

    Read the article

  • How do I use Ruby metaprogramming to refactor this common code?

    - by James Wenton
    I inherited a project with a lot of badly-written Rake tasks that I need to clean up a bit. Because the Rakefiles are enormous and often prone to bizarre nonsensical dependencies, I'm simplifying and isolating things a bit by refactoring everything to classes. Specifically, that pattern is the following: namespace :foobar do desc "Frozz the foobar." task :frozzify do unless Rake.application.lookup('_frozzify') require 'tasks/foobar' Foobar.new.frozzify end Rake.application['_frozzify'].invoke end # Above pattern repeats many times. end # Several namespaces, each with tasks that follow this pattern. In tasks/foobar.rb, I have something that looks like this: class Foobar def frozzify() # The real work happens here. end # ... Other tasks also in the :foobar namespace. end For me, this is great, because it allows me to separate the task dependencies from each other and to move them to another location entirely, and I've been able to drastically simplify things and isolate the dependencies. The Rakefile doesn't hit a require until you actually try to run a task. Previously this was causing serious issues because you couldn't even list the tasks without it blowing up. My problem is that I'm repeating this idiom very frequently. Notice the following patterns: For every namespace :xyz_abc, there is a corresponding class in tasks/... in the file tasks/[namespace].rb, with a class name that looks like XyzAbc. For every task in a particular namespace, there is an identically named method in the associated namespace class. For example, if namespace :foo_bar has a task :apples, you would expect to see def apples() ... inside the FooBar class, which itself is in tasks/foo_bar.rb. Every task :t defines a "meta-task" _t (that is, the task name prefixed with an underscore) which is used to do the actual work. I still want to be able to specify a desc-description for the tasks I define, and that will be different for each task. And, of course, I have a small number of tasks that don't follow the above pattern at all, so I'll be specifying those manually in my Rakefile. I'm sure that this can be refactored in some way so that I don't have to keep repeating the same idiom over and over, but I lack the experience to see how it could be done. Can someone give me an assist?

    Read the article

  • JAXB doesn't unmarshal list of interfaces

    - by Joker_vD
    It seems JAXB can't read what it writes. Consider the following code: interface IFoo { void jump(); } @XmlRootElement class Bar implements IFoo { @XmlElement public String y; public Bar() { y = ""; } public Bar(String y) { this.y = y; } @Override public void jump() { System.out.println(y); } } @XmlRootElement class Baz implements IFoo { @XmlElement public int x; public Baz() { x = 0; } public Baz(int x) { this.x = x; } @Override public void jump() { System.out.println(x); } } @XmlRootElement public class Holder { private List<IFoo> things; public Holder() { things = new ArrayList<>(); } @XmlElementWrapper @XmlAnyElement public List<IFoo> getThings() { return things; } public void addThing(IFoo thing) { things.add(thing); } } // ... try { JAXBContext context = JAXBContext.newInstance(Holder.class, Bar.class, Baz.class); Holder holder = new Holder(); holder.addThing(new Bar("1")); holder.addThing(new Baz(2)); holder.addThing(new Baz(3)); for (IFoo thing : holder.getThings()) { thing.jump(); } StringWriter s = new StringWriter(); context.createMarshaller().marshal(holder, s); String data = s.toString(); System.out.println(data); StringReader t = new StringReader(data); Holder holder2 = (Holder)context.createUnmarshaller().unmarshal(t); for (IFoo thing : holder2.getThings()) { thing.jump(); } } catch (Exception e) { System.err.println(e.getMessage()); } It's a simplified example, of course. The point is that I have to store two very differently implemented classes, Bar and Baz, in one collection. Well, I observed that they have pretty similar public interface, so I created an interface IFoo and made them two to implement it. Now, I want to have tools to save and load this collection to/from XML. Unfortunately, this code doesn't quite work: the collection is saved, but then it cannot be loaded! The intended output is 1 2 3 some xml 1 2 3 But unfortunately, the actual output is 1 2 3 some xml com.sun.org.apache.xerces.internal.dom.ElementNSImpl cannot be cast to testapplication1.IFoo Apparently, I need to use the annotations in a different way? Or to give up on JAXB and look for something else? I, well, can write "XMLNode toXML()" method for all classes I wan't to (de)marshal, but...

    Read the article

  • choosing an image locally from http url and serving that image without a server round trip

    - by serverman
    Hi folks I am a complete novice to Flash (never created anything in flash). I am quite familiar with web applications (J2EE based) and have a reasonable expertise in Javascript. Here is my requirement. I want the user to select (via an html form) an image. Normally in the post, this image would be sent to server and may be stored there to be served later. I do not want that. I want to store this image locally and then serve it via HTTP to the user. So, the flow is: 1. Go to the "select image url":mywebsite.com/selectImage Browse the image and select the image This would transfer control locally to some code running on the client (Javascript or flash), which would then store the image locally at some place on the client machine. Go to the "show image url": mywebsite.com/showImage This would eventually result in some client code running on the browser that retrieves the image and renders it (without any server round trips.) I considered the following options: Use HTML5 local storage. Since I am a complete novice to flash, I looked into this. I found that it is fairly straightforward to store and retrieve images in javascript (only strings are allowed but I am hoping storing base64 encoded strings would work at least for small images). However, how do I serve the image via http url that points to my server without a server round trip? I saw the interesting article at http://hacks.mozilla.org/category/fileapi/ but that would work only in firefox and I need to work on all latest browsers (at least the ones supporting HTML5 local storage) Use flash SharedObjects. OK, this would have been good - the only thing is I am not sure where to start. Snippets of actionscripts to do this are scattered everywhere but I do not know how to use those scripts in an actual html page:) I do not need to create any movies or anything - just need to store an image and serve it locally. If I go this route, I would also use it to store other "strings" locally. If you suggest this, please give me the exact steps (could be pointers to other web sites) on how to do this. I would like to avoid paying for any flash development environment software ideally:) Thank you!

    Read the article

  • BlackBerry OS 7.1 secured TLS connection is closed after very short time

    - by MrVincenzo
    To make a long story short: Same client-server configuration, same network topology, same device (Bold 9900) - works perfectly well on OS 7.0 but doesn't work as expected on OS 7.1 and the secured tls connection is being closed by the server after a very short time. My application opens a secured tls connection to a server. The connection is kept alive by a application layer keep-alive mechanism and remains open until the client closes it. Attached is a simplified version of the actual code that opens connection and reads from the socket. The code works perfectly on OS 5.0-7.0 but doesn't work as expected on OS 7.1. When running on OS 7.1, the blocking read() returns with -1 (end of the stream has been reached) after very short time (10-45 seconds). For OS 5.0-7.0 the call to read() remains blocking until next data arrives and the connection is never closed by the server. Connection connection = Connector.open(connectionString); connInputStream = connection.openInputStream(); while (true) { try { retVal = connInputStream.read(); if (-1 == retVal) { break; // end of stream has been reached } } catch (Exception e ) { // do error handling } // data read from stream is handled here } UPDATE 1: Apparently, the problem appears only when I use secured tls connection (either using mobile network or WiFi) on OS 7.1. Everything works as expected when opening a non secured connection on OS 7.1. For tls on mobile networks I use the following connection string: connectionString = "tls://someipaddress:443;deviceside=false;ConnectionType=mds-public;EndToEndDesired"; For tls on Wifi I use the following connection string: connectionString = "tls://someipaddress:443;deviceside=true;interface=wifi;EndToEndRequired" UPDATE 2: The connection is never idle. I am constantly receiving and sending data on it. The issue appears both when using mobile connection and WiFi. The issue appears both on real OS 7.1 devices and simulators. I am starting to suspect that it is somehow related either to the connection string I am using or to the tls handshake. UPDATE 3: According to Wireshark's captures that I made with the OS 7.1 simulator, the secured tls connection is being closed by the server (client receives FIN). For the moment I don't have the server's private key therefore I unable to debug the tls handshake.

    Read the article

  • .NET Free memory usage (how to prevent overallocation / release memory to the OS)

    - by Ronan Thibaudau
    I'm currently working on a website that makes large use of cached data to avoid roundtrips. At startup we get a "large" graph (hundreds of thouthands of different kinds of objects). Those objects are retrieved over WCF and deserialized (we use protocol buffers for serialization) I'm using redgate's memory profiler to debug memory issues (the memory didn't seem to fit with how much memory we should need "after" we're done initializing and end up with this report Now what we can gather from this report is that: 1) Most of the memory .NET allocated is free (it may have been rightfully allocated during deserialisation, but now that it's free, i'd like for it to return to the OS) 2) Memory is fragmented (which is bad, as everytime i refresh the cash i need to redo the memory hungry deserialisation process and this, in turn creates large object that may throw an OutOfMemoryException due to fragmentation) 3) I have no clue why the space is fragmented, because when i look at the large object heap, there are only 30 instances, 15 object[] are directly attached to the GC and totally unrelated to me, 1 is a char array also attached directly to the GC Heap, the remaining 15 are mine but are not the cause of this as i get the same report if i comment them out in code. So my question is, what can i do to go further with this? I'm not really sure what to look for in debugging / tools as it seems my memory is fragmented, but not by me, and huge amounts of free spaces are allocated by .net , which i can't release. Also please make sure you understand the question well before answering, i'm not looking for a way to free memory within .net (GC.Collect), but to free memory that is already free in .net , to the system as well as to defragment said memory. Note that a slow solution is fine, if it's possible to manually defragment the large heap i'd be all for it as i can call it at the end of RefreshCache and it's ok if it takes 1 or 2 second to run. Thanks for your help! A few notes i forgot: 1) The project is a .net 2.0 website, i get the same results running it in a .net 4 pool, idem if i run it in a .net 4 pool and convert it to .net 4 and recompile. 2) These are results of a release build, so debug build can not be the issue. 3) And this is probably quite important, i do not get these issues at all in the webdev server, only in IIS, in the webdev i get memory consumption rather close to my actual consumption (well more, but not 5-10X more!)

    Read the article

< Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >