Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 30/63 | < Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >

  • Optimally reducing maximum flow

    - by ArIck
    Given a parameter k, I'm trying to delete k edges from a directed graph such that the maximum flow is reduced by as much as possible. The graph has a source s and a sink t, and the capacity of each edge is one. The graph may or may not contain cycles. My proposed solution would be to first perform a topological sorting on the graph, using an algorithm that "forgives" cycles -- perhaps by ignoring edges that lead us back to the source. Then (assuming k = 1): i = 0 for each vertex u order by topological(u) for each edge (u, v) order by topological(v) descending if topological(v) > topological(u) then delete (u, v) if ++i = k then return else // edge doesn't contribute to max flow, ignore Would this work, or am I totally off-track here?

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • Losing data after reading them correct from file

    - by user1388172
    i have the fallowing class of object with a class a data structure which i use in main combined. The ADT(abstract data type) is a linked list. After i read from file the input data and create and object which at print looks just fine after a print. after i push_back() the 3-rd int variable get initializated to 0. So example and code: Example: ex.in: 1 7 31 2 2 2 3 3 3 now i create objects from each line, which at print look as they suppose, but after push_back(): 1 7 0 2 2 0 3 3 0 Class.h: class RAngle { private: int x,y,l,b; public: int solution,prec; RAngle(){ x = y = solution = prec = b = l =0; } RAngle(int i,int j,int k){ x = i; y = j; l = k; solution = 0; prec=0; b=0; } friend ostream& operator << (ostream& out, const RAngle& ra){ out << ra.x << " " << ra.y << " " << ra.l <<endl; return out; } friend istream& operator >>( istream& is, RAngle& ra){ is >> ra.x; is >> ra.y; is >> ra.l; return is ; } }; ADT.h: template <class T> class List { private: struct Elem { T data; Elem* next; }; Elem* first; T pop_front(){ if (first!=NULL) { T aux = first->data; first = first->next; return aux; } T a; return a; } void push_back(T data){ Elem *n = new Elem; n->data = data; n->next = NULL; if (first == NULL) { first = n; return ; } Elem *current; for(current=first;current->next != NULL;current=current->next); current->next = n; } Main.cpp(after i call this function in main which prints object as they suppose to be the x var(from RAngle class) changes to 0 in all cases.) void readData(List <RAngle> &l){ RAngle r; ifstream f_in; f_in.open("ex.in",ios::in); for(int i=0;i<10;++i){ f_in >> r; cout << r; l.push_back(r); }

    Read the article

  • Challenging question find if there is an element repeating himself n/k times

    - by gleb-pendler
    here how it's goes: You have an array size n and a constant k (whatever) you can assume the the array of int type tho it kind be of whatever type but just for the clearane let assume it's an integer. Describe an algorithm that finds if there is an element/s that repeat itself at least n/k times... if there is return one - do it in linear time running O(n) Imortent: now the catch do this algorithm or even pseuo-code using a constant usage of memory and running over the array only TWICE!!!

    Read the article

  • Initialize a Variable Again.

    - by SoulBeaver
    That may sound a little confusing. Basically, I have a function CCard newCard() { /* Used to store the string variables intermittantly */ std::stringstream ssPIN, ssBN; int picker1, picker2; int pin, bankNum; /* Choose 5 random variables, store them in stream */ for( int loop = 0; loop < 5; ++loop ) { picker1 = rand() % 8 + 1; picker2 = rand() % 8 + 1; ssPIN << picker1; ssBN << picker2; } /* Convert them */ ssPIN >> pin; ssBN >> bankNum; CCard card( pin, bankNum ); return card; } that creates a new CCard variable and returns it to the caller CCard card = newCard(); My teacher advised me that doing this is a violation of OOP principles and has to be put in the class. He told me to use this method as a constructor. Which I did: CCard::CCard() { m_Sperre = false; m_Guthaben = rand() % 1000; /* Work */ /* Convert them */ ssPIN >> m_Geheimzahl; ssBN >> m_Nummer; } All variables with m_ are member variables. However, the constructor works when I initialize the card normally CCard card(); at the start of the program. However, I also have a function, that is supposed to create a new card and return it to the user, this function is now broken. The original command: card = newCard(); isn't available anymore, and card = new CCard(); doesn't work. What other options do I have? I have a feeling using the constructor won't work, and that I probably should just create a class method newCard, but I want to see if it is somehow at all possible to do it the way the teacher wanted. This is creating a lot of headaches for me. I told the teacher that this is a stupid idea and not everything has to be classed in OOP. He has since told me that Java or C# don't allow code outside of classes, which sounds a little incredible. Not sure that you can do this in C++, especially when templated functions exist, or generic algorithms. Is it true that this would be bad code for OOP in C++ if I didn't force it into a class?

    Read the article

  • Sorting a list of items using javascript

    - by Nicholas
    Hi all, I am working on a class assignment in which i need to accomplish the following: 1 User types a list of items into a text box (form field) 2 When the user presses the sort button, the list in the text box is sorted 3 It takes the text from the text box and puts the sorted text back in the text box Please help!

    Read the article

  • Help with method logic in Java, hw

    - by Crystal
    I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

    Read the article

  • Encountering NullPointerException when trying to add polynoms

    - by Ayler Cruz
    I need to add two polynomials, which is composed of two ints. For example, the coefficient and the exponent 3x^2 would be constructed using 3 and 2 as parameters. I am getting a NullPointerException but I can't figure out why. Any help would be appreciated! public class Polynomial { private Node poly; public Polynomial() { } private Polynomial(Node p) { poly = p; } private class Term { int coefficient; int exponent; private Term(int coefficient, int exponent) { this.coefficient = coefficient; this.exponent = exponent; } } private class Node { private Term data; private Node next; private Node(Term data, Node next) { this.data = data; this.next = next; } } public void addTerm(int coeff, int exp) { Node pointer = poly; if (pointer.next == null) { poly.next = new Node(new Term(coeff, exp), null); } else { while (pointer.next != null) { if (pointer.next.data.exponent < exp) { Node temp = new Node(new Term(coeff, exp), pointer.next.next); pointer.next = temp; return; } pointer = pointer.next; } pointer.next = new Node(new Term(coeff, exp), null); } } public Polynomial polyAdd(Polynomial p) { return new Polynomial(polyAdd(this.poly, p.poly)); } private Node polyAdd(Node p1, Node p2) { if (p1 == p2) { Term adding = new Term(p1.data.coefficient + p2.data.coefficient, p1.data.exponent); p1 = p1.next; p2 = p2.next; return new Node(adding, null); } if (p1.data.exponent > p2.data.exponent) { p2 = p2.next; } if (p1.data.exponent < p2.data.exponent) { p1 = p1.next; } if (p1.next != null && p2.next != null) { return polyAdd(p1, p2); } return new Node(null, null); } }

    Read the article

  • BFS algorithm problem

    - by Gorkamorka
    The problem is as follows: A wanderer begins on the grid coordinates (x,y) and wants to reach the coordinates (0,0). From every gridpoint, the wanderer can go 8 steps north OR 3 steps south OR 5 steps east OR 6 steps west (8N/3S/5E/6W). How can I find the shortest route from (X,Y) to (0,0) using breadth-first search? Clarifications: Unlimited grid Negative coordinates are allowed A queue (linked list or array) must be used No obstacles present

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Breadth first search all paths

    - by Amndeep7
    First of all, thank you for looking at this question. For a school assignment we're supposed to create a BFS algorithm and use it to do various things. One of these things is that we're supposed to find all of the paths between the root and the goal nodes of a graph. I have no idea how to do this as I can't find a way to keep track of all of the alternate routes without also including copies/cycles. Here is my BFS code: def makePath(predecessors, last): return makePath(predecessors, predecessors[last]) + [last] if last else [] def BFS1b(node, goal): Q = [node] predecessor = {node:None} while Q: current = Q.pop(0) if current[0] == goal: return makePath(predecessor, goal) for subnode in graph[current[0]][2:]: if subnode[0] not in predecessor: predecessor[subnode[0]] = current[0] Q.append(subnode[0]) A conceptual push in the right direction would be greatly appreciated. tl;dr How do I use BFS to find all of the paths between two nodes?

    Read the article

  • Choosing design method for ladder-like word game.

    - by owca
    I'm trying to build a simple application, with the finished program looking like this : I will also have to implement two different GUI layouts for this. Now I'm trying to figure out the best method to perform this task. My professor told me to introduce Element class with 4 states : - empty - invisible (used in GridLayout) - first letter - other letter I've thought about following solutions (by List I mean any sort of Collection) : 1. Element is a single letter, and each line is Element[]. Game class will be array of arrays Element[]. I guess that's the dumbest way, and the validation might be troublesome. 2. Like previously but Line is a List of Element. Game is an array of Lines. 3. Like previously but Game is a List of Lines. Which one should I choose ? Or maybe do you have better ideas ? What collection would be best if to use one ?

    Read the article

  • speech recognition project

    - by sk
    hello im making my final year project i.e. speech recognition.but i dont have nay idea how to start.i will use c#.plz can anyone guide me how to start.what shoul be the first step? thnx

    Read the article

  • Problem with sending out variable to serial port using api JAVA

    - by sjaakensjon
    We are developing a java program for school. But we are experiencing problems with sending out a variable created by 3 sliders. The idea is that we have 3 sliders. One slider for every color. Red green and blue. The variable has to have a value between 0 and 255. Everytime the value of the slider changes is has to send a variable for the channel, that value is 1, 2 ,3. And after that it has to send the value of the slider through the serial port. Could you please help us out by creating an example program? Below is our code so far. Thanks in advance. Sjaak package main; import javax.swing.*; import javax.swing.event.*; import java.awt.*; import app.Com; import app.Parameters; public class menu{ JSlider sliderblauw; JLabel hoeveelblauw; JLabel blauw; JLabel rood; JSlider sliderrood; JLabel hoeveelrood; JLabel groen; JLabel hoeveelgroen; JSlider slidergroen; public menu(){ Frame venster = new JFrame("Color control"); JPanel blauwinstel = new JPanel(); ((JFrame) venster).setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); venster.setSize(500, 500); venster.setVisible(true); sliderblauw = new JSlider(JSlider.VERTICAL, 0, 255, 0); sliderblauw.addChangeListener(new veranderingblauw()); hoeveelblauw = new JLabel ("0"); blauwinstel.add(sliderblauw); blauwinstel.add(hoeveelblauw); venster.add(blauwinstel, BorderLayout.WEST); sliderblauw.setMajorTickSpacing(10); sliderblauw.setPaintTicks(true); JPanel roodinstel = new JPanel(); sliderrood = new JSlider(JSlider.VERTICAL, 0, 255, 0); sliderrood.addChangeListener(new veranderingrood()); hoeveelrood = new JLabel ("0"); roodinstel.add(sliderrood); roodinstel.add(hoeveelrood); venster.add(roodinstel, BorderLayout.EAST); sliderrood.setMajorTickSpacing(10); sliderrood.setPaintTicks(true); JPanel groeninstel = new JPanel(); slidergroen = new JSlider(JSlider.VERTICAL, 0, 255, 0); slidergroen.addChangeListener(new veranderinggroen()); hoeveelgroen = new JLabel ("0"); groeninstel.add(slidergroen); groeninstel.add(hoeveelgroen); venster.add(groeninstel, BorderLayout.CENTER); slidergroen.setMajorTickSpacing(10); slidergroen.setPaintTicks(true); } public class veranderingblauw implements ChangeListener{ public void stateChanged(ChangeEvent ce){ int value = sliderblauw.getValue(); String waarde_blauw = Integer.toString(value); hoeveelblauw.setText(waarde_blauw); }} public class veranderingrood implements ChangeListener{ public void stateChanged(ChangeEvent ce){ int value = sliderrood.getValue(); String waarde_rood = Integer.toString(value); hoeveelrood.setText(waarde_rood); }} public class veranderinggroen implements ChangeListener{ public void stateChanged(ChangeEvent ce){ int value = slidergroen.getValue(); String waarde_groen = Integer.toString(value); hoeveelgroen.setText(waarde_groen); }} public static void main( String[] args) { new menu(); } }

    Read the article

  • longest common subsequence

    - by davit-datuashvili
    i have following code public class LCS1 { public static String lcs(String a,String b) { String x; String y; int alen=a.length(); int blen=b.length(); if (alen==0 || blen==0) { return ""; } else if (a.charAt(alen-1)==b.charAt(blen-1)) { return lcs(a.substring(0,alen-1),b.substring(0,blen-1)); } else { x=lcs(a,b.substring(0,blen-1)); y=lcs(a.substring(0,alen-1),b); } return (x.length()>y.length()) ? x : y; } public static void main(String[]args){ String a="computer"; String b="houseboat"; System.out.println(lcs(a,b)); } } it should return "out" but returns nothing what is problem?

    Read the article

  • JRadio Menu buttons - JAVA

    - by user337465
    I have a relatively easy question. I have to create a java GUI to do math based calculations. I have to have a menu item that will double the variable that I am doing calculations with. For example variable = 1 if radio button = selected{ variable = variable * 2 } So, how would I achieve the if statement there? thankyou

    Read the article

  • Write a C++ program to encrypt and decrypt certain codes.

    - by Amber
    Step 1: Write a function int GetText(char[],int); which fills a character array from a requested file. That is, the function should prompt the user to input the filename, and then read up to the number of characters given as the second argument, terminating when the number has been reached or when the end of file is encountered. The file should then be closed. The number of characters placed in the array is then returned as the value of the function. Every character in the file should be transferred to the array. Whitespace should not be removed. When testing, assume that no more than 5000 characters will be read. The function should be placed in a file called coding.cpp while the main will be in ass5.cpp. To enable the prototypes to be accessible, the file coding.h contains the prototypes for all the functions that are to be written in coding.cpp for this assignment. (You may write other functions. If they are called from any of the functions in coding.h, they must appear in coding.cpp where their prototypes should also appear. Do not alter coding.h. Any other functions written for this assignment should be placed, along with their prototypes, with the main function.) Step 2: Write a function int SimplifyText(char[],int); which simplifies the text in the first argument, an array containing the number of characters as given in the second argument, by converting all alphabetic characters to lower case, removing all non-alpha characters, and replacing multiple whitespace by one blank. Any leading whitespace at the beginning of the array should be removed completely. The resulting number of characters should be returned as the value of the function. Note that another array cannot appear in the function (as the file does not contain one). For example, if the array contained the 29 characters "The 39 Steps" by John Buchan (with the " appearing in the array), the simplified text would be the steps by john buchan of length 24. The array should not contain a null character at the end. Step 3: Using the file test.txt, test your program so far. You will need to write a function void PrintText(const char[],int,int); that prints out the contents of the array, whose length is the second argument, breaking the lines to exactly the number of characters in the third argument. Be warned that, if the array contains newlines (as it would when read from a file), lines will be broken earlier than the specified length. Step 4: Write a function void Caesar(const char[],int,char[],int); which takes the first argument array, with length given by the second argument and codes it into the third argument array, using the shift given in the fourth argument. The shift must be performed cyclicly and must also be able to handle negative shifts. Shifts exceeding 26 can be reduced by modulo arithmetic. (Is C++'s modulo operations on negative numbers a problem here?) Demonstrate that the test file, as simplified, can be coded and decoded using a given shift by listing the original input text, the simplified text (indicating the new length), the coded text and finally the decoded text. Step 5: The permutation cypher does not limit the character substitution to just a shift. In fact, each of the 26 characters is coded to one of the others in an arbitrary way. So, for example, a might become f, b become q, c become d, but a letter never remains the same. How the letters are rearranged can be specified using a seed to the random number generator. The code can then be decoded, if the decoder has the same random number generator and knows the seed. Write the function void Permute(const char[],int,char[],unsigned long); with the same first three arguments as Caesar above, with the fourth argument being the seed. The function will have to make up a permutation table as follows: To find what a is coded as, generate a random number from 1 to 25. Add that to a to get the coded letter. Mark that letter as used. For b, generate 1 to 24, then step that many letters after b, ignoring the used letter if encountered. For c, generate 1 to 23, ignoring a or b's codes if encountered. Wrap around at z. Here's an example, for only the 6 letters a, b, c, d, e, f. For the letter a, generate, from 1-5, a 2. Then a - c. c is marked as used. For the letter b, generate, from 1-4, a 3. So count 3 from b, skipping c (since it is marked as used) yielding the coding of b - f. Mark f as used. For c, generate, from 1-3, a 3. So count 3 from c, skipping f, giving a. Note the wrap at the last letter back to the first. And so on, yielding a - c b - f c - a d - b (it got a 2) e - d f - e Thus, for a given seed, a translation table is required. To decode a piece of text, we need the table generated to be re-arranged so that the right hand column is in order. In fact you can just store the table in the reverse way (e.g., if a gets encoded to c, put a opposite c is the table). Write a function called void DePermute(const char[],int,char[], unsigned long); to reverse the permutation cypher. Again, test your functions using the test file. At this point, any main program used to test these functions will not be required as part of the assignment. The remainder of the assignment uses some of these functions, and needs its own main function. When submitted, all the above functions will be tested by the marker's own main function. Step 6: If the seed number is unknown, decoding is difficult. Write a main program which: (i) reads in a piece of text using GetText; (ii) simplifies the text using SimplifyText; (iii) prints the text using PrintText; (iv) requests two letters to swap. If we think 'a' in the text should be 'q' we would type aq as input. The text would be modified by swapping the a's and q's, and the text reprinted. Repeat this last step until the user considers the text is decoded, when the input of the same letter twice (requesting a letter to be swapped with itself) terminates the program. Step 7: If we have a large enough sample of coded text, we can use knowledge of English to aid in finding the permutation. The first clue is in the frequency of occurrence of each letter. Write a function void LetterFreq(const char[],int,freq[]); which takes the piece of text given as the first two arguments (same as above) and returns in the 26 long array of structs (the third argument), the table of the frequency of the 26 letters. This frequency table should be in decreasing order of popularity. A simple Selection Sort will suffice. (This will be described in lectures.) When printed, this summary would look something like v x r s z j p t n c l h u o i b w d g e a q y k f m 168106 68 66 59 54 48 45 44 35 26 24 22 20 20 20 17 13 12 12 4 4 1 0 0 0 The formatting will require the use of input/output manipulators. See the header file for the definition of the struct called freq. Modify the program so that, before each swap is requested, the current frequency of the letters is printed. This does not require further calls to LetterFreq, however. You may use the traditional order of regular letter frequencies (E T A I O N S H R D L U) as a guide when deciding what characters to exchange. Step 8: The decoding process can be made more difficult if blank is also coded. That is, consider the alphabet to be 27 letters. Rewrite LetterFreq and your main program to handle blank as another character to code. In the above frequency order, space usually comes first.

    Read the article

  • How to solve this problem with lists?

    - by osabri
    what i don't understand in my task here what kind of list i can use, and if it should have 2 attributes key and value ? or only value? with pointers to another node ofc the task: "design a function which create a list using input from the keyboard _ the prefered solution. Assume that some magic stops the input; so the length of a list is not known in advance.(alternative solution: a function which creates explicitly a fixed list. However, all other function can not assume any knowledge about the length of lists). Necessary utilities( additional functions to be created): a function which deallocates the memory used for lists and a function which prints the content of the list. let the element of lists contain a letter. Design a function which create a copy of such list. can't also understand the list line !!!!!???

    Read the article

  • How to access the relative directory of a ASP.NET website?

    - by Michael Schilling
    I need to access a folder that will contain various text files for my web site. I'm using Visual Web Developer 2010 Express. I made a web site using visual basic. Here is the failing code: Dim fileName As String fileName = CurDir.ToString + fileName.Text + ".txt" FileOpen(1, fileName, OpenMode.Output) FileClose(1) CurDir.ToString is giving me strange directory path that isn't anywhere near where my website files are located. I need to be able to access the files in a folder inside of the WebSite1 folder without using C:\Users\..., but I'm at a loss on how to do that. Can anyone help me out?

    Read the article

  • How do I output the preorder traversal of a tree given the inorder and postorder tranversal?

    - by user342580
    Given the code for outputing the postorder traversal of a tree when I have the preorder and the inorder traversal in an interger array. How do I similarily get the preorder with the inorder and postorder array given? void postorder( int preorder[], int prestart, int inorder[], int inostart, int length) { if(length==0) return; //terminating condition int i; for(i=inostart; i<inostart+length; i++) if(preorder[prestart]==inorder[i])//break when found root in inorder array break; postorder(preorder, prestart+1, inorder, inostart, i-inostart); postorder(preorder, prestart+i-inostart+1, inorder, i+1, length-i+inostart-1); cout<<preorder[prestart]<<" "; } Here is the prototype for preorder() void preorder( int inorderorder[], int inostart, int postorder[], int poststart, int length)

    Read the article

< Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >