Search Results

Search found 9983 results on 400 pages for 'fuzzy c means'.

Page 361/400 | < Previous Page | 357 358 359 360 361 362 363 364 365 366 367 368  | Next Page >

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • NSArraycontroller selectionIndexes bindings

    - by Michael Scherbaum
    Hi all, I have the following set-up: A Window that has a splitView in which I display I NSCollectionView in the left view and a detailView in the right view. Both views are set-up in separate xibs. Furthermore I have a Datacontroller (of class NSArrayController) that manages a mutable Array of NSMutableDictionaries (moviesForChoice). The dataController is set-up as application delegate. The movie objects in the array have properties like (name, plot, genre etc.) so far so good... In the xib for the NScollectionview I bound a NSArraycontroller content property to my datacontroller via Application.delegate.moviesForChoice The collectionView accesses the arraycontroller.arrrangedObjects and arraycontroller.selectionIndexes. This works fine the contents are displayed and the selection works fine in the collectionview (my collectionviewItem renders a selection color) In the xib for the detailView I want to display information for the selected object in the collectionview. Therefore I also added an arraycontroller to the xib, bound the content aray to Application.delegate.moviesForChoice and bound the NSTextfields in the view to e.g. arraycontroller.selection.name Here comes my issue: everytime I open the window with the two xibs, my collectionview displays all movies that are for choice correctly, and the detailview displays the information for the 1st object in my collectionview. Whenever I click on a different movie in the collectionView the res. item renders a selection color, but the detailView doesn't update. My understanding of it would be that the DataController is not informed about updates in the selectionIndexes and can therefore not trigger an update in the detailView. Correct me if I'm wrong... To remedy this I tried to bind the selectionIndexes property of the arraycontroller in the collectionView xib to Application.delegate.moviesForChoice.selecionIndexes but this failed with: addObserver:forKeyPath:options:context:] is not supported. Key path: selectionIndexes I could imagine that this means that the datacontroller is not KVO compliant for my Array moviesForChoice, but I implemented the following methods for it: -(void)insertObject:(NSDictionary *)dict inMoviesForChoiceAtIndex:(NSUInteger)index { [moviesForChoice insertObject:dict atIndex:index]; } -(void)removeObjectFromMoviesForChoiceAtIndex:(NSUInteger)index { [moviesForChoice removeObjectAtIndex:index]; } -(void)setMoviesForChoice:(NSMutableArray *)a { moviesForChoice = a; } -(NSArray*)moviesForChoice { return moviesForChoice; } -(NSUInteger)countOfMoviesForChoice { return [moviesForChoice count]; } - (void)addMovieForChoiceObject:(Movie *)anObject { [moviesForChoice addObject:anObject]; } So where am I wrong? How do I correctly bind to the selectionIndexes? You help is much appreciated! M

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • SSL Authentication with Certificates: Should the Certificates have a hostname?

    - by sixtyfootersdude
    Summary JBoss allows clients and servers to authenticate using certificates and ssl. One thing that seems strange is that you are not required to give your hostname on the certificate. I think that this means if Server B is in your truststore, Sever B can pretend to be any server that they want. (And likewise: if Client B is in your truststore...) Am I missing something here? Authentication Steps (Summary of Wikipeida Page) Client Server ================================================================================================= 1) Client sends Client Hello ENCRIPTION: None - highest TLS protocol supported - random number - list of cipher suites - compression methods 2) Sever Hello ENCRIPTION: None - highest TLS protocol supported - random number - choosen cipher suite - choosen compression method 3) Certificate Message ENCRIPTION: None - 4) ServerHelloDone ENCRIPTION: None 5) Certificate Message ENCRIPTION: None 6) ClientKeyExchange Message ENCRIPTION: server's public key => only server can read => if sever can read this he must own the certificate - may contain a PreMasterSecerate, public key or nothing (depends on cipher) 7) CertificateVerify Message ENCRIPTION: clients private key - purpose is to prove to the server that client owns the cert 8) BOTH CLIENT AND SERVER: - use random numbers and PreMasterSecret to compute a common secerate 9) Finished message - contains a has and MAC over previous handshakes (to ensure that those unincripted messages did not get broken) 10) Finished message - samething Sever Knows The client has the public key for the sent certificate (step 7) The client's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the server's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Client Knows The server has the public key for the sent certificate (step 6 with step 8) The server's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the client's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Potential Problem Suppose the client's truststore has certs in it: Server A Server B (malicous) Server A has hostname www.A.com Server B has hostname www.B.com Suppose: The client tries to connect to Server A but Server B launches a man in the middle attack. Since server B: has a public key for the certificate that will be sent to the client has a "valid certificate" (a cert in the truststore) And since: certificates do not have a hostname feild in them It seems like Server B can pretend to be Server A easily. Is there something that I am missing?

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' readonly?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • How to change button's image in visual c++ at run time?

    - by karikari
    After trying and error for many times, I decided to ask here. My objective is I wanted to change the feature of my IE toolbar button. The button is firstly setup by IE at IE startup using the function CRebarHandler::onSetRedraw and CRebarHandler::setButtonMenu2(). And then, I create a call from another cpp file, to call CRebarHandler::setButtonMenu2(). I intent to change just the button's image. I assigned the ID of the image correctly. But somehow it does not work. When I put other code inside this function,like a code for writing to file, it is proven work. Means, it is properly being called from the other file. But the thing is, the code for the button inside CRebarHandler::setButtonMenu2() seems does not work. Need help. Here is the code I am working on (I modify John Lister's button code): LRESULT CRebarHandler::onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled){ bHandled=false; if (m_ieVer==6){ if (!m_hWndToolbar) scanForToolbarSlow(); if (m_hWndToolbar){ findButton(m_hWndToolbar); if (m_buttonID>0) setButtonMenu(); } } return S_OK; } void CRebarHandler::setButtonMenu(){ HIMAGELIST hImageList = ImageList_Create(32, 32,ILC_COLOR16 | ILC_MASK,1, 0); HINSTANCE module = _AtlBaseModule.GetResourceInstance(); TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; char psBuffer[128]; FILE *pPipe; float f = 0; pPipe = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt", "rt" ); char* p = fgets(psBuffer, 128, pPipe); std::istringstream iss(p); iss >> f; if (f > 0.9) { inf.iImage = 1; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } else { inf.iImage = 2; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } iss.clear(); f = 0; } void CRebarHandler::setButtonMenu2(){ TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; inf.iImage = 1; //green SendMessage(NULL, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); }

    Read the article

  • Slider - Moving of slider clears the screen.....

    - by Mahesh
    Hi, I am currently working on Silver light 3.0. Currently facing one simple issue but not able to find the solution about it. I have one column slider, which is placed in between column 1 and column 3. Column 2 contains slider itself. But when i move the slider from column1 on column 3. That means column1 will only be visible right now. But when i move the slider to the right corer it clears the screen. Please find herewith my code...... <Grid Name="grdTopLeft" Grid.Row="1" Grid.Column="0" HorizontalAlignment="Stretch" VerticalAlignment="Stretch" Margin="0, 0, 0, 0" > <radNavigation:RadTabControl x:Name="layerTabControl" TabStripPlacement="Top" Style="{StaticResource IControllerRadTab}"> <radNavigation:RadTabItem Header="{Binding SelectedLayer.Name}" Style="{StaticResource IRadTabItem}"> <Page:WordView x:Name="WordView" Tag="DefaultLayer"/> </radNavigation:RadTabItem> </radNavigation:RadTabControl> </Grid> <!-- Top Splitter --> <basic:GridSplitter Grid.Row="1" Grid.Column="1" Width="3" Style="{StaticResource GridSplitterStyle}" VerticalAlignment="Stretch" HorizontalAlignment="Center" IsTabStop="False"/> <!--Top Right: Related--> <Grid Grid.Row="1" Grid.Column="2" VerticalAlignment="Stretch" HorizontalAlignment="Stretch" Margin="0, 0, 0, 0"> <Grid.RowDefinitions> <RowDefinition Height="Auto" /> <RowDefinition Height="*" /> </Grid.RowDefinitions> <radNavigation:RadTabControl x:Name="LayersTabControl" TabStripPlacement="Top" ItemContainerStyle="{StaticResource IRadTabItem}" ItemsSource="{Binding TabItems}" Style="{StaticResource IControllerRadTab1}" SelectedIndex="{Binding ActiveTab,Mode=TwoWay}" SelectionChanged="LayersTabControl_SelectionChanged" /> <Grid Grid.Row="1" Background="#EFF2F7" VerticalAlignment="Stretch" HorizontalAlignment="Stretch" > <Page:WordView x:Name="RelatedView" Margin="5,5,5,5" Tag="ActiveLayer"/> </Grid> </Grid> Can anyone please help me out from this issue..... Thanks in advance. Mahesh

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • 1180: Call to a possibly undefined method addEventListener

    - by Chris
    I'm going through some AS3 training, but I'm getting a weird error... I'm trying to add an event listener to the end of a motion tween in AS. I've created a tween, highlighted the frames, right clicked and copied the tween as AS and pasted it into the movie clip (I think there's a better way to do this, but I'm not sure what it is...) When I try to add the listener to the end of that code, I get the error. Here's my code. import fl.motion.AnimatorFactory; import fl.motion.MotionBase; import fl.motion.Motion; import flash.filters.*; import flash.geom.Point; import fl.motion.MotionEvent; import fl.events.*; var __motion_Enemy_3:MotionBase; if(__motion_Enemy_3 == null) { __motion_Enemy_3 = new Motion(); __motion_Enemy_3.duration = 30; // Call overrideTargetTransform to prevent the scale, skew, // or rotation values from being made relative to the target // object's original transform. // __motion_Enemy_3.overrideTargetTransform(); // The following calls to addPropertyArray assign data values // for each tweened property. There is one value in the Array // for every frame in the tween, or fewer if the last value // remains the same for the rest of the frames. __motion_Enemy_3.addPropertyArray("x", [0]); __motion_Enemy_3.addPropertyArray("y", [0]); __motion_Enemy_3.addPropertyArray("scaleX", [1.000000,1.048712,1.097424,1.146136,1.194847,1.243559,1.292271,1.340983,1.389695,1.438407,1.487118,1.535830,1.584542,1.633254,1.681966,1.730678,1.779389,1.828101,1.876813,1.925525,1.974237,2.022949,2.071661,2.120372,2.169084,2.217796,2.266508,2.315220,2.363932,2.412643]); __motion_Enemy_3.addPropertyArray("scaleY", [1.000000,1.048712,1.097424,1.146136,1.194847,1.243559,1.292271,1.340983,1.389695,1.438407,1.487118,1.535830,1.584542,1.633254,1.681966,1.730678,1.779389,1.828101,1.876813,1.925525,1.974237,2.022949,2.071661,2.120372,2.169084,2.217796,2.266508,2.315220,2.363932,2.412643]); __motion_Enemy_3.addPropertyArray("skewX", [0]); __motion_Enemy_3.addPropertyArray("skewY", [0]); __motion_Enemy_3.addPropertyArray("rotationConcat", [0]); __motion_Enemy_3.addPropertyArray("blendMode", ["normal"]); __motion_Enemy_3.addPropertyArray("cacheAsBitmap", [false]); __motion_Enemy_3.addEventListener(MotionEvent.MOTION_END, hurtPlayer); // Create an AnimatorFactory instance, which will manage // targets for its corresponding Motion. var __animFactory_Enemy_3:AnimatorFactory = new AnimatorFactory(__motion_Enemy_3); __animFactory_Enemy_3.transformationPoint = new Point(0.499558, 0.500000); // Call the addTarget function on the AnimatorFactory // instance to target a DisplayObject with this Motion. // The second parameter is the number of times the animation // will play - the default value of 0 means it will loop. // __animFactory_Enemy_3.addTarget(<instance name goes here>, 0); } function hurtPlayer(event:MotionEvent):void { this.parent.removeChild(this); } I've tried a few places for it, both with the animFactory_Enemy_3 variable and the motion_Enemy_3 variable - getting the same error both times.

    Read the article

  • Getting 404 when attempting to POST file to Google Cloud Storage from service account

    - by klactose
    I'm wondering if anyone can tell me the proper syntax & formatting for a service account to send a POST Object to bucket request? I'm attempting it programmatically using the HttpComponents library. I manage to get a token from my GoogleCredential, but every time I construct the POST request, I get: HTTP/1.1 403 Forbidden <?xml version='1.0' encoding='UTF-8'?><Error><Code>AccessDenied</Code><Message>Access denied.</Message><Detailsbucket-name</Details></Error The Google documentation that describes the request methods, mentions posting using html forms, but I'm hoping that wasn't suggesting the ONLY way to get the job done. I know that HttpComponents has a way to explicitly create form data by using UrlEncodedFormEntity, but it doesn't support multipart data. Which is why I went with using the MultipartEntity class. My code is below: MultipartEntity entity = new MultipartEntity( HttpMultipartMode.BROWSER_COMPATIBLE ); String token = credential.getAccessToken(); entity.addPart("Authorization", new StringBody("OAuth " + token)); String date = formatDate(new Date()); entity.addPart("Date", new StringBody(date)); entity.addPart("Content-Encoding", new StringBody("UTF-8")); entity.addPart("Content-Type", new StringBody("multipart/form-data")); entity.addPart("bucket", new StringBody(bucket)); entity.addPart("key", new StringBody("fileName")); entity.addPart("success_action_redirect", new StringBody("/storage")); File uploadFile = new File("pathToFile"); FileBody fileBody = new FileBody(uploadFile, "text/xml"); entity.addPart("file", fileBody); httppost.setEntity(entity); System.out.println("Posting URI = "+httppost.toString()); HttpResponse response = client.execute(httppost); HttpEntity resp_entity = response.getEntity(); As I mentioned, I am able to get an actual token, so I'm pretty sure the problem is in how I've formed the request as opposed to not being properly authenticated. Keep in mind: This is being performed by a service account. Which means that it does have Read/Write access Thanks for reading, and I appreciate any help!

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • how to find the data key on checkedchanged event of checkbox in a list view in asp.net?

    - by subodh
    I am using a list view inside that in item template i am using a label and a checkbox. I want that whenever user clicks on the check box the value should be updated in a table.i am using a datakeys in listview.on the basis of datakey value should be updated in the table query is string updateQuery = "UPDATE [TABLE] SET [COLUMN] = " + Convert.ToInt32(chk.Checked) + " WHERE PK_ID =" + dataKey + " "; also i want some help in displaying the result as it is inside the table.means if the value for column in table for a particular pkid is 1 then the checkbox shoul be checked. here is the code snippet <asp:ListView ID="lvFocusArea" runat="server" DataKeyNames="PK_ID" onitemdatabound="lvFocusArea_ItemDataBound" > <LayoutTemplate> <table border="0" cellpadding="1" width="400px"> <tr style="background-color: #E5E5FE"> <th align="left"> Focus Area </th> <th> Is Current Focused </th> </tr> <tr id="itemPlaceholder" runat="server"> </tr> </table> </LayoutTemplate> <ItemTemplate> <tr> <td width="80%"> <asp:Label ID="lblFocusArea" runat="server" Text=""><%#Eval("FOCUS_AREA_NAME") %></asp:Label> </td> <td align="center" width="20%"> <asp:CheckBox ID="chkFocusArea" runat="server" OnCheckedChanged="chkFocusArea_CheckedChanged" AutoPostBack="true"/> </td> </tr> </ItemTemplate> <AlternatingItemTemplate> <tr style="background-color: #EFEFEF"> <td> <asp:Label ID="lblFocusArea" runat="server" Text=""><%#Eval("FOCUS_AREA_NAME") %></asp:Label> </td> <td align="center"> <asp:CheckBox ID="chkFocusArea" runat="server" oncheckedchanged="chkFocusArea_CheckedChanged" AutoPostBack="true" /> </td> </tr> </AlternatingItemTemplate> <SelectedItemTemplate> <td> item selected</td> </SelectedItemTemplate> </asp:ListView> help me.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • XML serialization options in .NET

    - by Borek
    I'm building a service that returns an XML (no SOAP, no ATOM, just plain old XML). Say that I have my domain objects already filled with data and just need to transform them to the XML format. What options do I have on .NET? Requirements: The transformation is not 1:1. Say that I have an Address property of type Address with nested properties like Line1, City, Postcode etc. This may need to result in an XML like <xaddr city="...">Line1, Postcode</xaddr>, i.e. quite different. Some XML elements/attributes are conditional, for example, if a Customer is under 18, the XML needs to contain some additional information. I only need to serialize the objects to XML, the other direction (XML to objects) is not important Some technologies, i.e. Data Contracts use .NET attributes. Other means of configuration (external XML config, buddy classes etc.) would be a plus. Here are the options as I see them as the moment. Corrections / additions will be very welcome. String concatenation - forget it, it was a joke :) Linq 2 XML - complete control but quite a lot of hand written code, would need good suite of unit tests View engines in ASP.NET MVC (or even Web Forms theoretically), the logic being in controllers. It's a question how to structure it, I can have simple rules engine in my controller(s) and one view template per each possible output, or have the decision logic directly in the template. Both have upsides and downsides. XML Serialization - I'm not sure about the flexibility here Data Contracts from WCF - not sure about the flexibility either, plus would they work in a simple ASP.NET MVC app (non-WCF service)? Are they a super-set of the standard XML serialization now? If it exists, some XML-to-object mapper. The more I think about it the more I think I'm looking for something like this but I couldn't find anything appropriate. Any comments / other options?

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Image animation problem in silverlight

    - by Jak
    Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

    Read the article

  • SQL query - choosing 'last updated' record in a group, better db design?

    - by Jimmy
    Hi, Let's say I have a MySQL database with 3 tables: table 1: Persons, with 1 column ID (int) table 2: Newsletters, with 1 column ID (int) table 3: Subscriptions, with columns Person_ID (int), Newsletter_ID (int), Subscribed (bool), Updated (Datetime) Subscriptions.Person_ID points to a Person, and Subscription.Newsletter_ID points to a Newsletter. Thus, each person may have 0 or more subscriptions to 0 or more magazines at once. The table Subscriptions will also store the entire history of each person's subscriptions to each newsletter. If a particular Person_ID-Newsletter_ID pair doesn't have a row in the Subscriptions table, then it's equivalent to that pair having a subscription status of 'false'. Here is a sample dataset Persons ID 1 2 3 Newsletters ID 4 5 6 Subscriptions Person_ID Newsletter_ID Subscribed Updated 2 4 true 2010-05-01 3 4 true 2010-05-01 3 5 true 2010-05-10 3 4 false 2010-05-15 Thus, as of 2010-05-16, Person 1 has no subscription, Person 2 has a subscription to Newsletter 4, and Person 3 has a subscription to Newsletter 5. Person 3 had a subscription to Newsletter 4 for a while, but not anymore. I'm trying to do 2 kinds of query. A query that shows everyone's active subscriptions as of query time (we can assume that updated will never be in the future -- thus, this means returning the record with the latest 'updated' value for each Person_ID-Newsletter_ID pair, as long as Subscribed is true (if the latest record for a Person_ID-Newsletter_ID pair has a Subscribed status of false, then I don't want that record returned)). A query that returns all active subscriptions for a specific newsletter - same qualification as in 1. regarding records with 'false' in the Subscribed column. I don't use SQL/databases often enough to tell if this design is good, or if the SQL queries needed would be slow on a database with, say, 1M records in the Subscriptions table. I was using the Visual query builder tool in Visual Studio 2010 but I can't even get the query to return the latest updated record for each Person_ID-Newsletter_ID pair. Is it possible to come up with SQL queries that don't involve using subqueries (presumably because they would become too slow with a larger data set)? If not, would it be a better design to have a separate Subscriptions_History table, and every time a subscription status for a Person_ID-Newsletter-ID pair is added to Subscriptions, any existing record for that pair is moved to Subscriptions_History (that way the Subscriptions table only ever contains the latest status update for any Person_ID-Newsletter_ID pair)? I'm using .net on Windows, so would it be easier (or the same, or harder) to do this kind of queries using Linq? Entity Framework? Thanks!

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

< Previous Page | 357 358 359 360 361 362 363 364 365 366 367 368  | Next Page >