Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 370/548 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • Pylons error handling

    - by TJ Huffington
    Hello, I am just getting started with Pylons and am confused as to how to account for exceptions. What is the proper way to error check user input (ensure a correct email address, check that it doesn't yet exist in the database, etc ...)? Should these checks go inside the model classes or somewhere else? Sample code would be great.

    Read the article

  • Removing a node from a linked list

    - by lost_with_coding
    I would like to create a delete_node function that deletes the node at the location in the list as a count from the first node. So far this is the code I have: class node: def __init__(self): self.data = None # contains the data self.next = None # contains the reference to the next node class linked_list: def __init__(self): self.cur_node = None def add_node(self, data): new_node = node() # create a new node new_node.data = data new_node.next = self.cur_node # link the new node to the 'previous' node. self.cur_node = new_node # set the current node to the new one. def list_print(self): node = ll.cur_node while node: print node.data node = node.next def delete_node(self,location): node = ll.cur_node count = 0 while count != location: node = node.next count+=1 delete node ll = linked_list() ll.add_node(1) ll.add_node(2) ll.add_node(3) ll.list_print()

    Read the article

  • SQLAlchemy - SQLite for testing and Postgresql for devlopment - How to port?

    - by StackUnderflow
    I want to use sqlite memory database for all my testing and Postgresql for my development/production server. But the SQL syntax is not same in both dbs. for ex: SQLite has autoincrement, and Postgresql has serial Is it easy to port the SQL script from sqlite to postgresql... what are your solutions? If you want me to use standard SQL, how should I go about generating primary key in both the databases?

    Read the article

  • ImportError and Django driving me crazy

    - by John Peebles
    OK, I have the following directory structure (it's a django project): - project -- app and within the app folder, there is a scraper.py file which needs to reference a class defined within models.py I'm trying to do the following: import urllib2 import os import sys import time import datetime import re import BeautifulSoup sys.path.append('/home/userspace/Development/') os.environ['DJANGO_SETTINGS_MODULE'] = 'project.settings' from project.app.models import ClassName and this code just isn't working. I get an error of: Traceback (most recent call last): File "scraper.py", line 14, in from project.app.models import ClassName ImportError: No module named project.app.models This code above used to work, but broke somewhere along the line and I'm extremely confused as to why I'm having problems. On SnowLeopard using python2.5.

    Read the article

  • Dynamically add items to Tkinter Canvas

    - by nick369
    I'm attempting to learn Tkinter with the goal of being able to create a 'real-time' scope to plot data. As a test, I'm trying to draw a polygon on the canvas every time the 'draw' button is pressed. The triangle position is randomized. I have two problems: There is a triangle on the canvas as soon as the program starts, why and how do I fix this? It doesn't draw any triangles when I press the button, at least none that I can see. CODE from Tkinter import * from random import randint class App: def __init__(self,master): #frame = Frame(master) #frame.pack(side = LEFT) self.plotspc = Canvas(master,height = 100, width = 200, bg = "white") self.plotspc.grid(row=0,column = 2, rowspan = 5) self.button = Button(master, text = "Quit", fg = "red", \ command = master.quit) self.button.grid(row=0,column=0) self.drawbutton = Button(master, text = "Draw", command = \ self.pt([50,50])) self.drawbutton.grid(row = 0, column = 1) def pt(self, coords): coords[0] = coords[0] + randint(-20,20) coords[1] = coords[1] + randint(-20,20) x = (0,5,10) y = (0,10,0) xp = [coords[0] + xv for xv in x] yp = [coords[1] + yv for yv in y] ptf = zip(xp,yp) self.plotspc.create_polygon(*ptf) if _name_ == "_main_": root = Tk() app = App(root) root.mainloop() The code is formatting strangely within the code tags, I have no idea how to fix this.

    Read the article

  • Django: Determining if a user has voted or not

    - by TheLizardKing
    I have a long list of links that I spit out using the below code, total votes, submitted by, the usual stuff but I am not 100% on how to determine if the currently logged in user has voted on a link or not. I know how to do this from within my view but do I need to alter my below view code or can I make use of the way templates work to determine it? I have read http://stackoverflow.com/questions/1528583/django-vote-up-down-method but I don't quite understand what's going on ( and don't need any ofjavascriptery). Models (snippet): class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Views (snippet): links = Link.objects.select_related().annotate(votes=Count('vote')).order_by('-created')

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • Dynamically setting the queryset of a ModelMultipleChoiceField to a custom recordset

    - by Daniel Quinn
    I've seen all the howtos about how you can set a ModelMultipleChoiceField to use a custom queryset and I've tried them and they work. However, they all use the same paradigm: the queryset is just a filtered list of the same objects. In my case, I'm trying to get the admin to draw a multiselect form that instead of using usernames as the text portion of the , I'd like to use the name field from my account class. Here's a breakdown of what I've got: # models.py class Account(models.Model): name = models.CharField(max_length=128,help_text="A display name that people understand") user = models.ForeignKey(User, unique=True) # Tied to the User class in settings.py class Organisation(models.Model): administrators = models.ManyToManyField(User) # admin.py from django.forms import ModelMultipleChoiceField from django.contrib.auth.models import User class OrganisationAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): from ethico.accounts.models import Account self.base_fields["administrators"] = ModelMultipleChoiceField( queryset=User.objects.all(), required=False ) super(OrganisationAdminForm, self).__init__(*args, **kwargs) class Meta: model = Organisation This works, however, I want queryset above to draw a selectbox with the Account.name property and the User.id property. This didn't work: queryset=Account.objects.all().order_by("name").values_list("user","name") It failed with this error: 'tuple' object has no attribute 'pk' I figured that this would be easy, but it's turned into hours of dead-ends. Anyone care to shed some light?

    Read the article

  • Trouble with encoding and urllib

    - by Ockonal
    Hello, I'm loading web-page using urllib. Ther eis russian symbols, but page encoding is 'utf-8' 1 pageData = unicode(requestHandler.read()).decode('utf-8') UnicodeDecodeError: 'ascii' codec can't decode byte 0xd0 in position 262: ordinal not in range(128) 2 pageData = requestHandler.read() soupHandler = BeautifulSoup(pageData) print soupHandler.findAll(...) UnicodeEncodeError: 'ascii' codec can't encode characters in position 340-345: ordinal not in range(128)

    Read the article

  • Simple pygtk and threads example please.

    - by wtzolt
    Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • How to get bit rotation function to accept any bit size?

    - by calccrypto
    i have these 2 functions i got from some other code def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (32 - n)) def ROL(x, n): return ROR(x, 32 - n) and i wanted to use them in a program, where 16 bit rotations are required. however, there are also other functions that require 32 bit rotations, so i wanted to leave the 32 in the equation, so i got: def ROR(x, n, bits = 32): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (bits - n)) def ROL(x, n, bits = 32): return ROR(x, bits - n) however, the answers came out wrong when i tested this set out. yet, the values came out correctly when the code is def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (16 - n)) def ROL(x, n,bits): return ROR(x, 16 - n) what is going on and how do i fix this?

    Read the article

  • Finding matching submatrics inside a matrix

    - by DaveO
    I have a 100x200 2D array expressed as a numpy array consisting of black (0) and white (255) cells. It is a bitmap file. I then have 2D shapes (it's easiest to think of them as letters) that are also 2D black and white cells. I know I can naively iterate through the matrix but this is going to be a 'hot' portion of my code so speed is an concern. Is there a fast way to perform this in numpy/scipy? I looked briefly at Scipy's correlate function. I am not interested in 'fuzzy matches', only exact matches. I also looked at some academic papers but they are above my head.

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • How to allow resizing of QMessageBox in PyQt4

    - by Simeon Fitch
    I'm using the nice feature in QMessageBox to optionally show detailed text to the user. However, the window after expansion is still fairly small, and one immediately tries to resize the window so more of the details are visible. Even after setting what I think are the proper settings it won't allow resizing. Here's the relevant snippet of PyQt4 code: mb = QMessageBox() mb.setText("Results written to '%s'" % filename) mb.setDetailedText(str(myData)) mb.setSizePolicy(QSizePolicy.Expanding, QSizePolicy.Expanding) mb.setSizeGripEnabled(True) Am I missing a step and/or is this at all possible?

    Read the article

  • redefine __and__ operator

    - by wiso
    Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to create instances of a class from a static method?

    - by Pierre
    Hello. Here is my problem. I have created a pretty heavy readonly class making many database calls with a static "factory" method. The goal of this method is to avoid killing the database by looking in a pool of already-created objects if an identical instance of the same object (same type, same init parameters) already exists. If something was found, the method will just return it. No problem. But if not, how may I create an instance of the object, in a way that works with inheritance? >>> class A(Object): >>> @classmethod >>> def get_cached_obj(self, some_identifier): >>> # Should do something like `return A(idenfier)`, but in a way that works >>> class B(A): >>> pass >>> A.get_cached_obj('foo') # Should do the same as A('foo') >>> A().get_cached_obj('foo') # Should do the same as A('foo') >>> B.get_cached_obj('bar') # Should do the same as B('bar') >>> B().get_cached_obj('bar') # Should do the same as B('bar') Thanks.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >