Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 372/548 | < Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Fabric methods exceptions

    - by baobee
    I try to make Fabric func, which checks if Apache installed: from fabric.api import * def check_apache(): try: result = local('httpd -v', capture=True) except: print "check_apache exception" But if httpd not installed I get: [root@server-local ~]$ fab check_apache Fatal error: local() encountered an error (return code 127) while executing 'ahttpd -v' Aborting. check_apache exception Done. How can I get correct exception for Fabric local() method ? So I need to get exception and continue executing without any Fabric error messages: [root@server-local ~]$ fab check_apache check_apache exception Done.

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Preserving the dimensions of a slice from a Numpy 3d array

    - by Brendan
    I have a 3d array, a, of shape say a.shape = (10, 10, 10) When slicing, the dimensions are squeezed automatically i.e. a[:,:,5].shape = (10, 10) I'd like to preserve the number of dimensions but also ensure that the dimension that was squeezed is the one that shows 1 i.e. a[:,:,5].shape = (10, 10, 1) I have thought of re-casting the array and passing ndmin but that just adds the extra dimensions to the start of the shape tuple regardless of where the slice came from in the array a.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Auto filling polymorphic table on save or on delete in django

    - by Mo J. Mughrabi
    Hi, Am working on an project in which I made an app "core" it will contain some of the reused models across my projects, most of those are polymorphic models (Generic content types) and will be linked to different models. Example below am trying to create audit model and will be linked to several models which may require auditing. This is the polls/models.py from django.db import models from django.contrib.auth.models import User from core.models import * from django.contrib.contenttypes import generic class Poll(models.Model): ## TODO: Document question = models.CharField(max_length=300) question_slug=models.SlugField(editable=False) start_poll_at = models.DateTimeField(null=True) end_poll_at = models.DateTimeField(null=True) is_active = models.BooleanField(default=True) audit_obj=generic.GenericRelation(Audit) def __unicode__(self): return self.question class Choice(models.Model): ## TODO: Document choice = models.CharField(max_length=200) poll=models.ForeignKey(Poll) audit_obj=generic.GenericRelation(Audit) class Vote(models.Model): ## TODO: Document choice=models.ForeignKey(Choice) Ip_Address=models.IPAddressField(editable=False) vote_at=models.DateTimeField("Vote at", editable=False) here is the core/modes.py from django.db import models from django.contrib.auth.models import User from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic class Audit(models.Model): ## TODO: Document # Polymorphic model using generic relation through DJANGO content type created_at = models.DateTimeField("Created at", auto_now_add=True) created_by = models.ForeignKey(User, db_column="created_by", related_name="%(app_label)s_%(class)s_y+") updated_at = models.DateTimeField("Updated at", auto_now=True) updated_by = models.ForeignKey(User, db_column="updated_by", null=True, blank=True, related_name="%(app_label)s_%(class)s_y+") content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField(unique=True) content_object = generic.GenericForeignKey('content_type', 'object_id') and here is polls/admin.py from django.core.context_processors import request from polls.models import Poll, Choice from core.models import * from django.contrib import admin class ChoiceInline(admin.StackedInline): model = Choice extra = 3 class PollAdmin(admin.ModelAdmin): inlines = [ChoiceInline] admin.site.register(Poll, PollAdmin) Am quite new to django, what am trying to do here, insert a record in audit when a record is inserted in polls and then update that same record when a record is updated in polls.

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • Django: Geocoding an address on form submission?

    - by User
    Trying to wrap my head around django forms and the django way of doing things. I want to create a basic web form that allows a user to input an address and have that address geocoded and saved to a database. I created a Location model: class Location(models.Model): address = models.CharField(max_length=200) city = models.CharField(max_length=100) state = models.CharField(max_length=100, null=True) postal_code = models.CharField(max_length=100, null=True) country = models.CharField(max_length=100) latitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) longitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) And defined a form: class LocationForm(forms.ModelForm): class Meta: model = models.Location exclude = ('latitude','longitude') In my view I'm using form.save() to save the form. This works and saves an address to the database. I created a module to geocode an address. I'm not sure what the django way of doing things is, but I guess in my view, before I save the form, I need to geocode the address and set the lat and long. How do I set the latitude and longitude before saving?

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • how to fill a part of a circle using PIL?

    - by valya
    hello. I'm trying to use PIL for a task but the result is very dirty. What I'm doing is trying to fill a part of a piece of a circle, as you can see on the image. Here is my code: def gen_image(values): side = 568 margin = 47 image = Image.open(settings.MEDIA_ROOT + "/i/promo_circle.jpg") draw = ImageDraw.Draw(image) draw.ellipse((margin, margin, side-margin, side-margin), outline="white") center = side/2 r = side/2 - margin cnt = len(values) for n in xrange(cnt): angle = n*(360.0/cnt) - 90 next_angle = (n+1)*(360.0/cnt) - 90 nr = (r * values[n] / 5) max_r = r min_r = nr for cr in xrange(min_r*10, max_r*10): cr = cr/10.0 draw.arc((side/2-cr, side/2-cr, side/2+cr, side/2+cr), angle, next_angle, fill="white") return image

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >