Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

Page 373/548 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • Get particular row as series from pandas dataframe

    - by Pratyush
    How do we get a particular filtered row as series? Example dataframe: >>> df = pd.DataFrame({'date': [20130101, 20130101, 20130102], 'location': ['a', 'a', 'c']}) >>> df date location 0 20130101 a 1 20130101 a 2 20130102 c I need to select the row where location is c as a series. I tried: row = df[df["location"] == "c"].head(1) # gives a dataframe row = df.ix[df["location"] == "c"] # also gives a dataframe with single row In either cases I can't the row as series.

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • matplotlib.pyplot, preserve aspect ratio of the plot

    - by Headcrab
    Assuming we have a polygon coordinates as polygon = [(x1, y1), (x2, y2), ...], the following code displays the polygon: import matplotlib.pyplot as plt plt.fill(*zip(*polygon)) plt.show() By default it is trying to adjust the aspect ratio so that the polygon (or whatever other diagram) fits inside the window, and automatically changing it so that it fits even after resizing. Which is great in many cases, except when you are trying to estimate visually if the image is distorted. How to fix the aspect ratio to be strictly 1:1? (Not sure if "aspect ratio" is the right term here, so in case it is not - I need both X and Y axes to have 1:1 scale, so that (0, 1) on both X and Y takes an exact same amount of screen space. And I need to keep it 1:1 no matter how I resize the window.)

    Read the article

  • grabbing a substring while scraping with Python2.6

    - by Diego
    Hey can someone help with the following? I'm trying to scrape a site that has the following information.. I need to pull just the number after the </strong> tag.. [<li><strong>ISBN-13:</strong> 9780375853401</li>, <li><strong>Pub. Date: </strong> 05/11/2010</li>] [<li><strong>UPC:</strong> 490355000372</li>, <li><strong>Catalog No:</strong> 15024/25</li>, <li><strong>Label:</strong> CAMERATA</li>] here's a piece of the code I've been using to grab the above data using mechanize and BeautifulSoup. I'm stuck here as it won't let me use the find() function for a list br_results = mechanize.urlopen(br_results) html = br_results.read() soup = BeautifulSoup(html) local_links = soup.findAll("a", {"class" : "down-arrow csa"}) upc_code = soup.findAll("ul", {"class" : "bc-meta3"}) for upc in upc_code: upc_text = upc.contents.contents print upc_text

    Read the article

  • Convert object to DateRange

    - by user655832
    I'm querying an underlying PostgreSQL database using Pandas 0.8. Pandas is returning the DataFrame properly but the underlying timestamp column in my database is being returned as a generic "object" type in Pandas. As I would eventually like to seasonal normalization of my data I am curious as to how to convert this generic "object" column to something that is appropriate for analysis. Here is my current code to retrieve the data: # get records from db example import pandas.io.sql as psql import psycopg2 # define query to get all subs created this year QRY = """ select i i, i * random() f, case when random() > 0.5 then true else false end t, (current_date - (i*random())::int)::timestamp with time zone tsz from generate_series(1,1000) as s(i) order by 4 ; """ CONN_STRING = "host='localhost' port=5432 dbname='postgres' user='postgres'" # connect to db conn = psycopg2.connect(CONN_STRING) # get some data set index on relid column df = psql.frame_query(QRY, con=conn) print "Row count retrieved: %i" % (len(df),) Thanks for any help you can render. M

    Read the article

  • How can I login in a website with Pyhon?

    - by Shady
    How can I do it? I was trying to enter some specified link (with urllib), but to do it, I need to log. I have this source from the site <form id="login-form" action="auth/login" method="post"> <div> <!--label for="rememberme">Remember me</label><input type="checkbox" class="remember" checked="checked" name="remember me" /--> <label for="email" id="email-label" class="no-js">Email</label> <input id="email-email" type="text" name="handle" value="" autocomplete="off" /> <label for="combination" id="combo-label" class="no-js">Combination</label> <input id="password-clear" type="text" value="Combination" autocomplete="off" /> <input id="password-password" type="password" name="password" value="" autocomplete="off" /> <input id="sumbitLogin" class="signin" type="submit" value="Sign In" /> It's possible?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >