Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

Page 373/548 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Django: Geocoding an address on form submission?

    - by User
    Trying to wrap my head around django forms and the django way of doing things. I want to create a basic web form that allows a user to input an address and have that address geocoded and saved to a database. I created a Location model: class Location(models.Model): address = models.CharField(max_length=200) city = models.CharField(max_length=100) state = models.CharField(max_length=100, null=True) postal_code = models.CharField(max_length=100, null=True) country = models.CharField(max_length=100) latitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) longitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) And defined a form: class LocationForm(forms.ModelForm): class Meta: model = models.Location exclude = ('latitude','longitude') In my view I'm using form.save() to save the form. This works and saves an address to the database. I created a module to geocode an address. I'm not sure what the django way of doing things is, but I guess in my view, before I save the form, I need to geocode the address and set the lat and long. How do I set the latitude and longitude before saving?

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

  • Tkinter Gui to read in csv file and generate buttons based on the entries in the first row

    - by Thomas Jensen
    I need to write a gui in Tkinter that can choose a csv file, read it in and generate a sequence of buttons based on the names in the first row of the csv file (later the data in the csv file should be used to run a number of simulations). So far I have managed to write a Tkinter gui that will read the csv file, but I am stomped as to how I should proceed: from Tkinter import * import tkFileDialog import csv class Application(Frame): def __init__(self, master = None): Frame.__init__(self,master) self.grid() self.createWidgets() def createWidgets(self): top = self.winfo_toplevel() self.menuBar = Menu(top) top["menu"] = self.menuBar self.subMenu = Menu(self.menuBar) self.menuBar.add_cascade(label = "File", menu = self.subMenu) self.subMenu.add_command( label = "Read Data",command = self.readCSV) def readCSV(self): self.filename = tkFileDialog.askopenfilename() f = open(self.filename,"rb") read = csv.reader(f, delimiter = ",") app = Application() app.master.title("test") app.mainloop() Any help is greatly appreciated!

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Convert object to DateRange

    - by user655832
    I'm querying an underlying PostgreSQL database using Pandas 0.8. Pandas is returning the DataFrame properly but the underlying timestamp column in my database is being returned as a generic "object" type in Pandas. As I would eventually like to seasonal normalization of my data I am curious as to how to convert this generic "object" column to something that is appropriate for analysis. Here is my current code to retrieve the data: # get records from db example import pandas.io.sql as psql import psycopg2 # define query to get all subs created this year QRY = """ select i i, i * random() f, case when random() > 0.5 then true else false end t, (current_date - (i*random())::int)::timestamp with time zone tsz from generate_series(1,1000) as s(i) order by 4 ; """ CONN_STRING = "host='localhost' port=5432 dbname='postgres' user='postgres'" # connect to db conn = psycopg2.connect(CONN_STRING) # get some data set index on relid column df = psql.frame_query(QRY, con=conn) print "Row count retrieved: %i" % (len(df),) Thanks for any help you can render. M

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • SQLAlchemy declarative syntax with autoload in Pylons

    - by Juliusz Gonera
    I would like to use autoload to use an existings database. I know how to do it without declarative syntax (model/_init_.py): def init_model(engine): """Call me before using any of the tables or classes in the model""" t_events = Table('events', Base.metadata, schema='events', autoload=True, autoload_with=engine) orm.mapper(Event, t_events) Session.configure(bind=engine) class Event(object): pass This works fine, but I would like to use declarative syntax: class Event(Base): __tablename__ = 'events' __table_args__ = {'schema': 'events', 'autoload': True} Unfortunately, this way I get: sqlalchemy.exc.UnboundExecutionError: No engine is bound to this Table's MetaData. Pass an engine to the Table via autoload_with=<someengine>, or associate the MetaData with an engine via metadata.bind=<someengine> The problem here is that I don't know where to get the engine from (to use it in autoload_with) at the stage of importing the model (it's available in init_model()). I tried adding meta.Base.metadata.bind(engine) to environment.py but it doesn't work. Anyone has found some elegant solution?

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >