Search Results

Search found 13889 results on 556 pages for 'results'.

Page 377/556 | < Previous Page | 373 374 375 376 377 378 379 380 381 382 383 384  | Next Page >

• I'm looking for a blend mode that gives 'realistic' paint colors. (Subtractive)

  - by almosnow

  I've been looking for a blend mode to (well ...) blend two RGB pixels in order to build colors in the samw way that a painter builds them (i.e: subtractive). Here are quick examples of the type of results that I'm expecting: CYAN + MAGENTA = BLUE CYAN + YELLOW = GREEN MAGENTA + YELLOW = RED RED + YELLOW = ORANGE RED + BLUE = PURPLE YELLOW + BLUE = GREEN I'm looking for a formula, like: dest_red = first_red + second_red; dest_green = first_green + second_green; dest_blue = first_blue + second_blue; I've tried with the commonly used 'multiply' formula but it doesn't work; I've tried with custom made formulas but I'm still not able to 'crack' how it should work. And I know already a lot of color theory so please refrain from answers like: Check this link: http://the_difference_betweeen_additive_and_subtractive_lightning.html

  Read the article

• .NET-MVC Modelbinder not binding because of primary key, all other fields are right. What's happenin

  - by ropstah

  I want to perform an Add object scenario in .NET using the modelbinder. Function AddObject() As ActionResult Return View() End Function <AcceptVerbs(HttpVerbs.Post)> _ Function AddObject(<Bind(Exclude:="ObjectId")> ByVal o As BLL.Object) As ActionResult o.Save() End Function However, I get an error: 'o.ObjectId' is not declared or the module containing it is not loaded in the debugging session. While inspecting the object, all other fields are set properly. I've tried all combinations regarding: with/without Html.Hidden("ObjectId") to with/without <Bind(Exclude:="ObjectId")> and even setting o.ObjectId to Nothing, all with the same results. What am I doing wrong?

  Read the article

• Activate first workbook after closing second one?

  - by user1830217

  Open workbook A. Code in A opens workbook B. B is now the active WB. Code in B ends with ThisWorkBook.Close B closes, so A appears. Problem is, I can't get ANY Activate events in WB A to fire automatically after WB B closes. But if I close WB B manually, using mouse to 'x' out the WB, or via the menus, then WB A triggers Activate events. Somehow using VBA to close WB B prevents WB A Activate events from triggering. Same results in Excel 97 and 2003 Am I missing something, or is there a workaround?? Thanks! John

  Read the article

• Cakephp Autoconvert find() fields?

  - by Razor Storm

  In cake php I can grab a model's fields by using the find() method. What if I wish to apply a transformation function to the fields? Is there a way to directly accomplish this task? Suppose I have a model called RaceTime with the fields racerId and timeMillis RaceTime +------------+ | Field | +------------+ | id | | racerId | | timeMillis | +------------+ timeMillis is an int specifying how long the race took in milliseconds. Obviously saying a race took 15651 milliseconds isn't very useful to a human reader, and I would wish to convert this to a human readable format. Is there a way to accomplish this directly in find()? Or is the only option to loop through the results after find() finishes?

  Read the article

• Removing duplicate solutions

  - by Enoon

  My code merges two lists of lists, item by item, in the following way: mergeL([[a,b],[c,d]], [[1,2],[3,4]], Result). Result = [[a,b,1,2],[c,d,3,4]] And this is the code i use: mergeL([],[],[]). mergeL(List, [], List). mergeL([], List, List). mergeL([X|Rest],[Y|Rest2], [XY|Res2]) :- mergeL(Rest, Rest2, Res2), append(X,Y,XY). This seems to work but if i call it with two lists of the same size i get three repeated results. Example (both list contain only one element): ?- mergeL([[a,b]],[[1,2,3]],Q). Q = [[a, b, 1, 2, 3]] ; Q = [[a, b, 1, 2, 3]] ; Q = [[a, b, 1, 2, 3]]. Is there a clean way to make this output only one solution?

  Read the article

• grabbing text in div with jquery

  - by vick

  <a class="source" href="jquery-lead.php?source=<?=$src;?>">3</a> <script type="text/javascript"> $("a.source").live('click', function() { $("#results").load( $(this).attr('href') ); return false; }); </script> I am able to pass $src variable to my php script, but I also want to pass whatever is in the tag. In this case "3", this is going to be a pagination..

  Read the article

• Delphi and mysql - Unable to connent to server..maybe custom connection reqd

  - by Steve

  I am coding an application for my company wherein i want to parse the results of a mysql query and display them in my application but i am facing a problem conecting to the database. the ip address of the server is : 172.30.192.20 and before i can ping it i have to add route on my pc something like this route add 172.30.192.0 mask 255.255.255.0 172.30.192.56 where 172.30.192.56 is the gateway Now whenever i try to connect 172.30.192.20 which is where the sql server is running my appplication instead connects to 172.30.192.56 i am coding the application in delphi and have used TmySQL After this didnt workout i tried an application called SQLwave. I just entered the server ip address and was able to connect to the database without any problems. it seems sqlwave uses mydac which is why even i tried using it but using the default connection options and setting i was still not able to connect. it seems sqlwave uses a custom connection using mydac i just want to know whats going wrong with my connection

  Read the article

• Django query - join on the same table

  - by dana

  i have a mini blog app, and a 'timeline' . there i want to be displayed all the posts from all the friends of a user, plus the posts of that user himself. For that, i have to make some kind of a 'join' between the results of two queries (queries on the same table) , so that the final result will be the combination of the user - posesor of the account, and all his friends. My query looks like this: blog = New.objects.filter(created_by = following,created_by = request.user) By that ',' i wanted to make a 'join' -i found something like this on a doc- but this method is not correct- i'm getting an error. How else could be done this 'join' ? Thanks!

  Read the article

• calling a service layer method to my presentation layer

  - by Josepth Vodary

  Ok I feel really dumb asking this but I seem to be missing something really simple here. I have the following code in a class in my service layer - public Items getItems(String category, float amount, String color, String type) The code reads from a database and returns the results - I plan on placing it in a jframe. Nice and simple. But no matter how I call it from the jframe I get errors in eclipse that the code is wrong - either that their are illegal modifiers or such. So obviously I am calling it completely wrong, so my stupid question is how do you call that method into a jframe? For example - if I try to call it this way: public Items getItems(); I get told that getItems is an illegal parameter. If I call this.. Items getItems(); I am told its undefined

  Read the article

• Combining IN and NOT IN in SQL as single result

  - by UltraVi01

  I apologize for the vague title. I am attempting to write a query that returns an alias column with matching values (resulting from an IN) as well as an alias column with values that do not match (using NOT IN). I want the result set to have: userId | matches | nonmatches. I currently have the following query which returns the matches as expected. I am having trouble getting the nonmatches in the result set -- that is, from a NOT IN statement SET @userId = 9; SELECT ug.user_id, COUNT(DISTINCT goal_id) as matches FROM user_goal ug WHERE ug.user_id!=@userId AND goal_id IN (SELECT iug.goal_id FROM user_goal iug WHERE user_id=@userId) GROUP BY user_id ORDER BY matches DESC LIMIT 4 So, the NOT IN would look something like this: goal_id NOT IN(SELECT uggg.goal_id FROM user_goal uggg WHERE user_id=@userId) AS nonmatches I am just not sure how to incorporate the NOT IN statement in my query so I get all the results

  Read the article

• Nested for-loop, searching files

  - by user2961510

  I have two files: filetest.txt ============ SSISPACKAGE1.dtsx SSISPACKAGE2.dtsx SSISPACKAGE3.dtsx SSISPACKAGE4.dtsx SSISPACKAGE5.dtsx SSISPACKAGE6.dtsx SSISPACKAGE7.dtsx SSISPACKAGE8.dtsx filetest2.txt ============= \\central_test_server\SSIS_Packages\Daily.bat \\central_test_server\SSIS_Packages\Weekly.bat \\central_test_server\SSIS_Packages\Monthly.bat \\central_test_server\SSIS_Packages\Quarterly.bat \\central_test_server\SSIS_Packages\SemiAnnually.bat \\central_test_server\SSIS_Packages\Annually.bat What I need is to cycle through filetest.txt, then search the files identified in filetest2.txt for the filename and output to a file the results. I am trying to identify in well over 100 bat files where each of about 100 SSIS Packages are running. I'm doing this in Windows batch, have tried about 20 various approaches without success - any help would be greatly appreciated.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Get websites title and description, save to utf8 table, php/mysql

  - by Geteburg

  Hi guys, I've been trying today all day to figure this out and I have no idea. What I want: Get the title and meta description of any kind of website. Save this info to utf table in mysql. What the problem is? Different sites have different charsets which results in that some have chinese, some contain umlauts (german), then we have russian and so on.. I've tried preg_match which works for some while not for others, i've tried DOMdocument which is the same as preg_match. Is there any class available that will do this? Hope someone can help, thanks.

  Read the article

• Optimizing Solr for Sorting

  - by devinfoley

  I'm using Solr for a realtime search index. My dataset is about 60M large documents. Instead of sorting by relevance, I need to sort by time. Currently I'm using the sort flag in the query to sort by time. This works fine for specific searches, but when searches return large numbers of results, Solr has to take all of the resulting documents and sort them by time before returning. This is slow, and there has to be a better way. What is the better way?

  Read the article

• (Action<T>).Name does not return expected values

  - by Tomas Lycken

  I have the following method (used to generate friendly error messages in unit tests): protected string MethodName<TTestedType>(Action<TTestedType> call) { return string.Format("{0}.{1}", typeof(TTestedType).FullName, call.Method.Name); } But when I call it as follows, I don't get the expected results: var nm = MethodName<MyController>(ctrl => ctrl.Create()); After running this code, nm contains "<Create_CreateShowsView>b__8", and not (as expected) "Create". How should I change the code to obtain the expected result?

  Read the article

• In Ruby, how do I make a hash from an array?

  - by Wizzlewott

  I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

  Read the article

• Why does set key not do anything in AES/SymmetricAlgorithm?

  - by acidzombie24

  This MESSED ME UP hard. I thought i was setting the key but i was not. No exceptions, nothing happen except bad results. Why is there a setter if everything is ignored and no exceptions are thrown when i attempt to write? What is the point of the setter on the Keys property? When i do the below Key value are not changed. After an hour when i realize what was happening i wrote the loop to verify. I also tried aes.Key[0] = val; var b = val == aes.Key[0]; (and messed with it in immediate mode). Why does it have this behavior? Array.Copy(myKey, aes.Key, aes.Key.Length); int i = 0; foreach (var v in aes.Key) { var b = myKey[i++] == v; if (!b) b = b; }

  Read the article

• can i have a date in the url of a route in asp.net ?

  - by oo

  This code below doesn't seem to work but i can't figure out why. If i have a user entered textbox that is a datepicker and the results are displayed as: 21-May-2010 , can i take this value and stick it into a URL to send over to a controller action so instead of an id (which is an int), i want a id which is a date value View / Javascript Code: $.get('/Tracker/DailyBlog/' + this.val(), function(data) { $('#dailyblog').html(data); }); ControllAction Code: public ActionResult DailyBlog(DateTime blogDate) { //go do something } any idea why this is not working ?

  Read the article

• How do I make a DIV stay at the top of the screen no matter ow far down the page my visitor scrolls?

  - by user1289863

  What I'm saying is, I have some extremely long pages on my website, which can make it annoying I've my visitors need to scroll to the top of the page to be able to navigate to another page. I'm not quite sure what I would call this but any Google search that contains the words 'DIV' and 'float' come up with completely unrelated results... What I'm looking to do is create a DIV that stays at the top of the Screen (not to be confused with the page) so that if the user is at the bottom of the page, they can still see the navigation bar just floating at the top of the screen. What I can think of is to position the DIV relative to the position of the screen but I don't know how to code this. I'm happy to use JavaScript (preferably in the form of jQuery), but if you know how to do this using CSS, I would favour your response. This might help: I know a little bit of jQuery and JavaScript and I know a good deal of CSS and HTML. Thanks in advance.

  Read the article

• String.Format with NumberGroupSeparator outputting 0xa0 not comma

  - by andrevdm

  I'm seeing strange results when doing a string.Format( "C" ); E.g. double val = 123456.78; Console.WriteLine( val.ToString( "C" ) ); This prints the thousand separator as 0xa0 rather than a comma (0x2c). I get the same result if I use string.Format( "{0:0,0.00}", 1234567.12D ); Here is the full output R 123ÿ456,78 52333A333233 201230456C78 My regional settings are English (South African) and I'm getting the same result on multiple machines. Any ideas? Thanks.

  Read the article

• what is the purpose of numeric/boolean/string objects as opposed to primitive values?

  - by zespri

  In javascript you can call a function as a function or as a constructor. For example you can do : myObject = new Number(13); myPrimitiveValue = Number(13); or simply myPrimitiveValue = 13; I understand the difference between the results. Can you explain me under which reasonable circumstances creating a number, a boolean or a string as an object is desirable? For example, ability to set new properties (this is something you can do on objects but can't really do on primitive values) is almost always a bad idea for objects containing number/boolean/string. Why would I want a numeric/boolean/string object?

  Read the article

• Running Test framework as part of application

  - by VP

  Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

  Read the article

• putting values from database into a drop down list

  - by sushant

  hi. my tool is in asp. i am using this code for a query in sql dim req_id req_id=Request.Form("Req_id") if req_id<>"" then Set conn=server.CreateObject("adodb.connection") conn.Open session("Psrconnect") Set rs=CreateObject("Adodb.Recordset") rs.Open "select * from passwords where REQ_ID='"&req_id&"'", conn i want to put the results of this query into a drop down list. how do i do it? any help is very much appreciated.

  Read the article

• Social statistics for a given page

  - by Trendee

  I have looked through the API's of facebook and twitter but i cannot seem to find the answer to my question. On websites like http://punchfork.com/recipe/Porkitos-Crispy-Prosciutto-Chips-Nom-Nom-Paleo On the right hand side they have the social stats page with information such as Tweets, Facebook Shares and Stumbleupons. My question is how do they record or gather these results? Is it a case of they have a button that records it in their database then sends you to the page to tweet/share/stumble? But surely that couldn't be accurate as people might not continue to fill out the action.

  Read the article

• Why does a non-constant offsetof expression work?

  - by Chris J. Kiick

  Why does this work: #include <sys/types.h> #include <stdio.h> #include <stddef.h> typedef struct x { int a; int b[128]; } x_t; int function(int i) { size_t a; a = offsetof(x_t, b[i]); return a; } int main(int argc, char **argv) { printf("%d\n", function(atoi(argv[1]))); } If I remember the definition of offsetof correctly, it's a compile time construct. Using 'i' as the array index results in a non-constant expression. I don't understand how the compiler can evaluate the expression at compile time. Why isn't this flagged as an error?

  Read the article

< Previous Page | 373 374 375 376 377 378 379 380 381 382 383 384  | Next Page >