Search Results

Search found 13889 results on 556 pages for 'results'.

Page 377/556 | < Previous Page | 373 374 375 376 377 378 379 380 381 382 383 384  | Next Page >

  • Removing duplicate solutions

    - by Enoon
    My code merges two lists of lists, item by item, in the following way: mergeL([[a,b],[c,d]], [[1,2],[3,4]], Result). Result = [[a,b,1,2],[c,d,3,4]] And this is the code i use: mergeL([],[],[]). mergeL(List, [], List). mergeL([], List, List). mergeL([X|Rest],[Y|Rest2], [XY|Res2]) :- mergeL(Rest, Rest2, Res2), append(X,Y,XY). This seems to work but if i call it with two lists of the same size i get three repeated results. Example (both list contain only one element): ?- mergeL([[a,b]],[[1,2,3]],Q). Q = [[a, b, 1, 2, 3]] ; Q = [[a, b, 1, 2, 3]] ; Q = [[a, b, 1, 2, 3]]. Is there a clean way to make this output only one solution?

    Read the article

  • Activate first workbook after closing second one?

    - by user1830217
    Open workbook A. Code in A opens workbook B. B is now the active WB. Code in B ends with ThisWorkBook.Close B closes, so A appears. Problem is, I can't get ANY Activate events in WB A to fire automatically after WB B closes. But if I close WB B manually, using mouse to 'x' out the WB, or via the menus, then WB A triggers Activate events. Somehow using VBA to close WB B prevents WB A Activate events from triggering. Same results in Excel 97 and 2003 Am I missing something, or is there a workaround?? Thanks! John

    Read the article

  • How can I put a string and an integer into the same array?

    - by Stelios M
    I have to following code. I want this to return an array e.g. arg[] that contains at arg[0] the number of the rows of my cursor and at arg[1] String(0) of my cursor. Since one is integer and the other is string I have a problem. Any ideas how to fix this? public String[] getSubcategoriesRow(String id){ this.openDataBase(); String[] asColumnsToReturn = new String[] {SECOND_COLUMN_ID,SECOND_COLUMN_SUBCATEGORIES,}; Cursor cursor = this.dbSqlite.query(SECOND_TABLE_NAME, asColumnsToReturn, SECOND_COLUMN_SUBCATEGORIES + "= \"" + id + "\"", null, null, null, null); String string = cursor.getString(0); int count = cursor.getCount(); String arg[] = new String[]{count, string}; cursor.close(); return arg; } The cursor and the results and correct i just need to compine them to an array in order to return that.

    Read the article

  • dynamically build Intersect statement ASP.NET

    - by TDDG
    I would like to use the IEnumerable function Intersect() to combine a few list and get the similar integers from each list. The problem I'm faced with is that I don't know how many list I will need to compare. Here is an example: A{1,2,3,4} B{1,2,3} C{1,2} results = A.Intersect(B).Intersect(C) This works great, but the next time around I may have a D{1,2} next time I come across the function. I'd like to use the Intersect method, but I'm open to new ideas as well.

    Read the article

  • In Ruby, how do I make a hash from an array?

    - by Wizzlewott
    I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

    Read the article

  • what is the purpose of numeric/boolean/string objects as opposed to primitive values?

    - by zespri
    In javascript you can call a function as a function or as a constructor. For example you can do : myObject = new Number(13); myPrimitiveValue = Number(13); or simply myPrimitiveValue = 13; I understand the difference between the results. Can you explain me under which reasonable circumstances creating a number, a boolean or a string as an object is desirable? For example, ability to set new properties (this is something you can do on objects but can't really do on primitive values) is almost always a bad idea for objects containing number/boolean/string. Why would I want a numeric/boolean/string object?

    Read the article

  • .NET-MVC Modelbinder not binding because of primary key, all other fields are right. What's happenin

    - by ropstah
    I want to perform an Add object scenario in .NET using the modelbinder. Function AddObject() As ActionResult Return View() End Function <AcceptVerbs(HttpVerbs.Post)> _ Function AddObject(<Bind(Exclude:="ObjectId")> ByVal o As BLL.Object) As ActionResult o.Save() End Function However, I get an error: 'o.ObjectId' is not declared or the module containing it is not loaded in the debugging session. While inspecting the object, all other fields are set properly. I've tried all combinations regarding: with/without Html.Hidden("ObjectId") to with/without <Bind(Exclude:="ObjectId")> and even setting o.ObjectId to Nothing, all with the same results. What am I doing wrong?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Delphi and mysql - Unable to connent to server..maybe custom connection reqd

    - by Steve
    I am coding an application for my company wherein i want to parse the results of a mysql query and display them in my application but i am facing a problem conecting to the database. the ip address of the server is : 172.30.192.20 and before i can ping it i have to add route on my pc something like this route add 172.30.192.0 mask 255.255.255.0 172.30.192.56 where 172.30.192.56 is the gateway Now whenever i try to connect 172.30.192.20 which is where the sql server is running my appplication instead connects to 172.30.192.56 i am coding the application in delphi and have used TmySQL After this didnt workout i tried an application called SQLwave. I just entered the server ip address and was able to connect to the database without any problems. it seems sqlwave uses mydac which is why even i tried using it but using the default connection options and setting i was still not able to connect. it seems sqlwave uses a custom connection using mydac i just want to know whats going wrong with my connection

    Read the article

  • Running Test framework as part of application

    - by VP
    Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

    Read the article

  • String.Format with NumberGroupSeparator outputting 0xa0 not comma

    - by andrevdm
    I'm seeing strange results when doing a string.Format( "C" ); E.g. double val = 123456.78; Console.WriteLine( val.ToString( "C" ) ); This prints the thousand separator as 0xa0 rather than a comma (0x2c). I get the same result if I use string.Format( "{0:0,0.00}", 1234567.12D ); Here is the full output R 123ÿ456,78 52333A333233 201230456C78 My regional settings are English (South African) and I'm getting the same result on multiple machines. Any ideas? Thanks.

    Read the article

  • putting values from database into a drop down list

    - by sushant
    hi. my tool is in asp. i am using this code for a query in sql dim req_id req_id=Request.Form("Req_id") if req_id<>"" then Set conn=server.CreateObject("adodb.connection") conn.Open session("Psrconnect") Set rs=CreateObject("Adodb.Recordset") rs.Open "select * from passwords where REQ_ID='"&req_id&"'", conn i want to put the results of this query into a drop down list. how do i do it? any help is very much appreciated.

    Read the article

  • How to test my outgoing emails in MS Outlook?

    - by John
    Some people are complaining my html emails are showing up as plain text with html mark ups and others are complaining about unusual characters like 0=D 3=D. They appear to be using MS Outlook. I just installed MS Outlook and configured the imap settings to work with my gmail account. All my emails appear fine. So I suspect I need my MS Outlook to work with an MS Exchange server in order to produce the results my other Outlook recipients are seeing. But I'm not sure how to get access to an MS Exchange server (assuming that is the case). Can anyone recommend how I can reproduce the same email environment as my recipients such that I can get the same bugs they get? Thanks

    Read the article

  • Get websites title and description, save to utf8 table, php/mysql

    - by Geteburg
    Hi guys, I've been trying today all day to figure this out and I have no idea. What I want: Get the title and meta description of any kind of website. Save this info to utf table in mysql. What the problem is? Different sites have different charsets which results in that some have chinese, some contain umlauts (german), then we have russian and so on.. I've tried preg_match which works for some while not for others, i've tried DOMdocument which is the same as preg_match. Is there any class available that will do this? Hope someone can help, thanks.

    Read the article

  • Django query - join on the same table

    - by dana
    i have a mini blog app, and a 'timeline' . there i want to be displayed all the posts from all the friends of a user, plus the posts of that user himself. For that, i have to make some kind of a 'join' between the results of two queries (queries on the same table) , so that the final result will be the combination of the user - posesor of the account, and all his friends. My query looks like this: blog = New.objects.filter(created_by = following,created_by = request.user) By that ',' i wanted to make a 'join' -i found something like this on a doc- but this method is not correct- i'm getting an error. How else could be done this 'join' ? Thanks!

    Read the article

  • can i have a date in the url of a route in asp.net ?

    - by oo
    This code below doesn't seem to work but i can't figure out why. If i have a user entered textbox that is a datepicker and the results are displayed as: 21-May-2010 , can i take this value and stick it into a URL to send over to a controller action so instead of an id (which is an int), i want a id which is a date value View / Javascript Code: $.get('/Tracker/DailyBlog/' + this.val(), function(data) { $('#dailyblog').html(data); }); ControllAction Code: public ActionResult DailyBlog(DateTime blogDate) { //go do something } any idea why this is not working ?

    Read the article

  • Nested for-loop, searching files

    - by user2961510
    I have two files: filetest.txt ============ SSISPACKAGE1.dtsx SSISPACKAGE2.dtsx SSISPACKAGE3.dtsx SSISPACKAGE4.dtsx SSISPACKAGE5.dtsx SSISPACKAGE6.dtsx SSISPACKAGE7.dtsx SSISPACKAGE8.dtsx filetest2.txt ============= \\central_test_server\SSIS_Packages\Daily.bat \\central_test_server\SSIS_Packages\Weekly.bat \\central_test_server\SSIS_Packages\Monthly.bat \\central_test_server\SSIS_Packages\Quarterly.bat \\central_test_server\SSIS_Packages\SemiAnnually.bat \\central_test_server\SSIS_Packages\Annually.bat What I need is to cycle through filetest.txt, then search the files identified in filetest2.txt for the filename and output to a file the results. I am trying to identify in well over 100 bat files where each of about 100 SSIS Packages are running. I'm doing this in Windows batch, have tried about 20 various approaches without success - any help would be greatly appreciated.

    Read the article

  • (Action<T>).Name does not return expected values

    - by Tomas Lycken
    I have the following method (used to generate friendly error messages in unit tests): protected string MethodName<TTestedType>(Action<TTestedType> call) { return string.Format("{0}.{1}", typeof(TTestedType).FullName, call.Method.Name); } But when I call it as follows, I don't get the expected results: var nm = MethodName<MyController>(ctrl => ctrl.Create()); After running this code, nm contains "<Create_CreateShowsView>b__8", and not (as expected) "Create". How should I change the code to obtain the expected result?

    Read the article

  • Combining IN and NOT IN in SQL as single result

    - by UltraVi01
    I apologize for the vague title. I am attempting to write a query that returns an alias column with matching values (resulting from an IN) as well as an alias column with values that do not match (using NOT IN). I want the result set to have: userId | matches | nonmatches. I currently have the following query which returns the matches as expected. I am having trouble getting the nonmatches in the result set -- that is, from a NOT IN statement SET @userId = 9; SELECT ug.user_id, COUNT(DISTINCT goal_id) as matches FROM user_goal ug WHERE ug.user_id!=@userId AND goal_id IN (SELECT iug.goal_id FROM user_goal iug WHERE user_id=@userId) GROUP BY user_id ORDER BY matches DESC LIMIT 4 So, the NOT IN would look something like this: goal_id NOT IN(SELECT uggg.goal_id FROM user_goal uggg WHERE user_id=@userId) AS nonmatches I am just not sure how to incorporate the NOT IN statement in my query so I get all the results

    Read the article

  • A pointer member variable having different values

    - by Rohan Prabhu
    Ok, to begin with, this is my code: HyperSprite::HyperSprite() { _view = 0; } void HyperSprite::publish(QGraphicsView* view) { _view = view; } void HyperSprite::getKFrame() { if(_view != 0) { qDebug()<<(void*)_view; } } Now, if I call HyperSprite::getKFrame() from within main(), I get the output: 0xbf8ffb84 I have a TCP server, which requires this QGraphicsView* variable. So whenever a new connection is made, HyperSprite::getKFrame() is called. However, whenever I make a connection to my server, this is the output: 0x1e425ff I honestly don't understand this. Shouldn't the value of a member remain same throughout? Why is the pointer value changing? As is obvious, whenever I try to use the _view pointer to access any of its members, a Segmentation Fault occurs. I tried using QSharedPointer, but it also results in the same problem. The data of the QSharedPointer automatically changes. Why is this happening?

    Read the article

  • grabbing text in div with jquery

    - by vick
    <a class="source" href="jquery-lead.php?source=<?=$src;?>">3</a> <script type="text/javascript"> $("a.source").live('click', function() { $("#results").load( $(this).attr('href') ); return false; }); </script> I am able to pass $src variable to my php script, but I also want to pass whatever is in the tag. In this case "3", this is going to be a pagination..

    Read the article

  • Array-size macro that rejects pointers

    - by nneonneo
    The standard array-size macro that is often taught is #define ARRAYSIZE(arr) (sizeof(arr) / sizeof(arr[0])) or some equivalent formation. However, this kind of thing silently succeeds when a pointer is passed in, and gives results that can seem plausible at runtime until things mysteriously fall apart. It's all-too-easy to make this mistake: a function that has a local array variable is refactored, moving a bit of array manipulation into a new function called with the array as a parameter. So, the question is: is there a "sanitary" macro to detect misuse of the ARRAYSIZE macro in C, preferably at compile-time? In C++ we'd just use a template specialized for array arguments only; in C, it seems we'll need some way to distinguish arrays and pointers. (If I wanted to reject arrays, for instance, I'd just do e.g. (arr=arr, ...) because array assignment is illegal).

    Read the article

  • Why does a non-constant offsetof expression work?

    - by Chris J. Kiick
    Why does this work: #include <sys/types.h> #include <stdio.h> #include <stddef.h> typedef struct x { int a; int b[128]; } x_t; int function(int i) { size_t a; a = offsetof(x_t, b[i]); return a; } int main(int argc, char **argv) { printf("%d\n", function(atoi(argv[1]))); } If I remember the definition of offsetof correctly, it's a compile time construct. Using 'i' as the array index results in a non-constant expression. I don't understand how the compiler can evaluate the expression at compile time. Why isn't this flagged as an error?

    Read the article

  • JQuery Tabs - HTML not displayed in any other tab except default tab

    - by user346347
    I'm pretty new to jquery, but I have a tab structure working and make a $.getJSON call to retrieve the JSON results from the backend. Now, I have 3 tabs: Tab1, Tab2 and Tab3. All the three tabs have the same divs but different content. The content shows up just fine in the first tab which is shown by default, but on clicking the 2nd tab, I make the same $.getJSON call and retrieve the JSON just fine, the same HTML is being constructed on the fly and set in the DIV within the tab but it is not being displayed... Any pointers??

    Read the article

  • PHP cURL loading delay

    - by lasquarte
    Hello. My problem is, I need to cURL-load a page that uses Ajax-based search, to get results of that search. And I need to organize a delay between curl_exec() and value returning. In other words, I need to execute curl_exec() for no less than 5 seconds. sleep() seems to stop curl execution and does not work. Will greatly appreciate any hint or clue UPD I don't know how, but on this page http://vkontakte.ru/gsearch.php?section=video&q=sample&name=1, but it requires an account to access curl DOES capture the search made by ajax. But if page tooks too long to load, Ajax returns "action was too fast" error. So I just need to prolong curl execution. Sorry if being unclear.

    Read the article

< Previous Page | 373 374 375 376 377 378 379 380 381 382 383 384  | Next Page >