Search Results

Search found 11068 results on 443 pages for 'print preview'.

Page 420/443 | < Previous Page | 416 417 418 419 420 421 422 423 424 425 426 427  | Next Page >

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • using Object input\ output Streams with files and array list

    - by soad el-hayek
    hi every one .. i'm an it student , and it's time to finish my final project in java , i've faced too many problems , this one i couldn't solve it and i'm really ubset ! :S my code is like this : in Admin class : public ArrayList cos_info = new ArrayList(); public ArrayList cas_info = new ArrayList(); public int cos_count = 0 ; public int cas_count = 0 ; void coustmer_acount() throws FileNotFoundException, IOException{ String add=null; do{ person p = new person() ; cos_info.add(cos_count, p); cos_count ++ ; add =JOptionPane.showInputDialog("Do you want to add more coustmer..\n'y'foryes ..\n 'n'for No .."); } while(add.charAt(0) == 'Y'||add.charAt(0)=='y'); writenew_cos(); // add_acounts(); } void writenew_cos() throws IOException{ ObjectOutputStream aa = new ObjectOutputStream(new FileOutputStream("coustmer.txt")); aa.writeObject(cos_info); JOptionPane.showMessageDialog(null,"Added to file done sucessfuly.."); aa.close(); } in Coustmer class : void read_cos() throws IOException, ClassNotFoundException{ person p1= null ; int array_count = 0; ObjectInputStream d = new ObjectInputStream(new FileInputStrea ("coustmer.txt")); JOptionPane.showMessageDialog(null,d.available() ); for(int i = 0;d.available() == 0;i++){ a.add(array_count,(ArrayList) d.readObject()); array_count++; JOptionPane.showMessageDialog(null,"Haaaaai :D" ); JOptionPane.showMessageDialog(null,array_count ); } d.close(); JOptionPane.showMessageDialog(null,array_count +"1111" ); for(int i = 0 ; i<a.size()&& found!= true ; i++){ count++ ; p1 =(person)a.get(i); user=p1.user; pass = p1.pass; cas_checkpass(); } } it just print JOptionPane.showMessageDialog(null,d.available() ); and having excep. here a.add(array_count,(ArrayList) d.readObject()); p.s : person object from my own class and it's Serializabled

    Read the article

  • Java NoSuchElementException using scanner.nextInt()

    - by othnin
    I am trying to read in a pgm file (512x512 array) and when I read in a larger file I get the error: java.util.NoSuchElementException on reading element (3,97). I have created a much smaller file to read (23x23) and it reads fine. Is there a size limit? I have checked the file and confirmed that there is an int for the value: This appears to be the line it crashes at: fileArray[row][col] = scan.nextInt(); Here is the file: import java.util.Scanner; import java.io.*; public class FileReader { public static void main(String[] args) throws IOException { String fileName = "lena.pgma"; int width, height, maxValue; FileInputStream fileInputStream = null; fileInputStream = new FileInputStream(fileName); Scanner scan = new Scanner(fileInputStream); // Discard the magic number scan.nextLine(); // Discard the comment line scan.nextLine(); // Read pic width, height and max value width = scan.nextInt(); System.out.println("Width: " + width); height = scan.nextInt(); System.out.println("Heigth: " + height); maxValue = scan.nextInt(); fileInputStream.close(); // Now parse the file as binary data FileInputStream fin = new FileInputStream(fileName); DataInputStream dis = new DataInputStream(fin); // look for 4 lines (i.e.: the header) and discard them int numnewlines = 4; while (numnewlines > 0) { char c; do { c = (char)(dis.readUnsignedByte()); } while (c != '\n'); numnewlines--; } // read the image data int[][] fileArray = new int[height][width]; for (int row = 0; row < height; row++) { for (int col = 0; col < width; col++) { fileArray[row][col] = scan.nextInt(); System.out.print("(" + row + " ," + col +"): " + fileArray[row][col]+ " "); } System.out.println(); } dis.close(); } } any advise would be appreciated.

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • c++ i need help with this program. everytime i try to run it, i got a problem

    - by FOXMULDERIZE
    1-the program must read numeric data from a file. 2-only one line per number 3-half way between those numbers is a negative number. 4-the program must sum those who are above the negative number in a acumulator an those below the negative number in another acumulator. 5-the black screen shall print both results and determined who is grater or equal. include include using namespace std; void showvalues(int,int,int[]); void showvalues2(int,int); void sumtotal(int,int); int main() { int total1=0; int total2=0; const int SIZE_A= 9; int arreglo[SIZE_A]; int suma,total,a,b,c,d,e,f; ifstream archivo_de_entrada; archivo_de_entrada.open("numeros.txt"); //lee/// for(int count =0 ;count < SIZE_A;count++) archivo_de_entrada>>arreglo[count] ; archivo_de_entrada.close(); showvalues(0,3,arreglo); showvalues2(5,8); sumtotal(total1,total2); system("pause"); return 0; } void showvalues(int a,int b,int arreglos) { int total1=0; //muestra//////////////////////// cout<< "los num son "; for(int count = a ;count <= b;count++) total1 += arreglos[count]; cout < } void showvalues2(int c,int d) { ////////////////////////////// int total2=0; cout<< "los num 2 son "; for(count =5 ;count <=8;count++) total2 = total2 + arreglo[count]; cout < void sumtotal(int e,int f) { ///////////////////////////////// cout<<"la suma de t1 y t2 es "; total= total1 + total2; cout< }

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • Sorted sets and comparators

    - by Jack
    Hello, I'm working with a TreeSetthat is meant to store pathfind locations used during the execution of a A* algorithm. Basically until there are "open" elements (still to be exhaustively visited) the neighbours of every open element are taken into consideration and added to a SortedSetthat keeps them ordered by their cost and heuristic cost. This means that I have a class like: public class PathTileInfo implements Comparable<PathTileInfo> { int cost; int hCost; final int x, y; @Override public int compareTo(PathTileInfo t2) { int c = cost + hCost; int c2 = t2.cost + t2.hCost; int costComp = c < c2 ? -1 : (c > c2 ? 1: 0); return costComp != 0 ? costComp : (x < t2.x || y < t2.y ? -1 : (x > t2.x || y > t2.y ? 1 : 0)); } @Override public boolean equals(Object o2) { if (o2 instanceof PathTileInfo) { PathTileInfo i = (PathTileInfo)o2; return i.cost + i.hCost == cost + hCost && x == i.x && y == i.y; } return false; } } In this way first the total cost is considered, then, since a total ordering is needed (consistency with equals) a ordering according to the x,y coordinate is taken into account. This should work but simply it doesn't, if I iterate over the TreeSet during the algorithm execution like in for (PathTileInfo t : openSet) System.out.print("("+t.x+","+t.y+","+(t.cost+t.hCost)+") "); I get results in which the right ordering is not kept, eg: (7,7,6) (7,6,7) (6,8,6) (6,6,7) (5,8,7) (5,7,7) (6,7,6) (6,6,7) (6,5,7) (5,7,7) (5,5,8) (4,7,7) (4,6,8) (4,5,8) is there something subtle I am missing? Thanks!

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • python object to native c++ pointer

    - by Lodle
    Im toying around with the idea to use python as an embedded scripting language for a project im working on and have got most things working. However i cant seem to be able to convert a python extended object back into a native c++ pointer. So this is my class: class CGEGameModeBase { public: virtual void FunctionCall()=0; virtual const char* StringReturn()=0; }; class CGEPYGameMode : public CGEGameModeBase, public boost::python::wrapper<CGEPYGameMode> { public: virtual void FunctionCall() { if (override f = this->get_override("FunctionCall")) f(); } virtual const char* StringReturn() { if (override f = this->get_override("StringReturn")) return f(); return "FAILED TO CALL"; } }; Boost wrapping: BOOST_PYTHON_MODULE(GEGameMode) { class_<CGEGameModeBase, boost::noncopyable>("CGEGameModeBase", no_init); class_<CGEPYGameMode, bases<CGEGameModeBase> >("CGEPYGameMode", no_init) .def("FunctionCall", &CGEPYGameMode::FunctionCall) .def("StringReturn", &CGEPYGameMode::StringReturn); } and the python code: import GEGameMode def Ident(): return "Alpha" def NewGamePlay(): return "NewAlpha" def NewAlpha(): import GEGameMode import GEUtil class Alpha(GEGameMode.CGEPYGameMode): def __init__(self): print "Made new Alpha!" def FunctionCall(self): GEUtil.Msg("This is function test Alpha!") def StringReturn(self): return "This is return test Alpha!" return Alpha() Now i can call the first to functions fine by doing this: const char* ident = extract< const char* >( GetLocalDict()["Ident"]() ); const char* newgameplay = extract< const char* >( GetLocalDict()["NewGamePlay"]() ); printf("Loading Script: %s\n", ident); CGEPYGameMode* m_pGameMode = extract< CGEPYGameMode* >( GetLocalDict()[newgameplay]() ); However when i try and convert the Alpha class back to its base class (last line above) i get an boost error: TypeError: No registered converter was able to extract a C++ pointer to type class CGEPYGameMode from this Python object of type Alpha I have done alot of searching on the net but cant work out how to convert the Alpha object into its base class pointer. I could leave it as an object but rather have it as a pointer so some non python aware code can use it. Any ideas?

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • quick java question

    - by j-unit-122
    private static char[] quicksort (char[] array , int left , int right) { if (left < right) { int p = partition(array , left, right); quicksort(array, left, p - 1 ); quicksort(array, p + 1 , right); } for (char i : array) System.out.print(i + ” ”); System.out.println(); return array; } private static int partition(char[] a, int left, int right) { char p = a[left]; int l = left + 1, r = right; while (l < r) { while (l < right && a[l] < p) l++; while (r > left && a[r] >= p) r--; if (l < r) { char temp = a[l]; a[l] = a[r]; a[r] = temp; } } a[left] = a[r]; a[r] = p; return r; } } hi guys just a quick question regarding the above coding, i know that the above coding returns the following B I G C O M P U T E R B C E G I M P U T O R B C E G I M P U T O R B C E G I M P U T O R B C E G I M P U T O R B C E G I M O P T U R B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U when the sequence BIGCOMPUTER is used but my question is can someone explain to me what is happening in the code and how? i know abit about the quick-sort algorithm but it doesnt seem to be the same in the above example.

    Read the article

  • bad file descriptor with close() socket (c++)

    - by user321246
    hi everybody! I'm running out of file descriptors when my program can't connect another host. The close() system call doesn't work, the number of open sockets increases. I can se it with cat /proc/sys/fs/file-nr Print from console: connect: No route to host close: Bad file descriptor connect: No route to host close: Bad file descriptor .. Code: #include <stdio.h> #include <stdlib.h> #include <sys/socket.h> #include <netinet/in.h> #include <netdb.h> #include <string.h> #include <iostream> using namespace std; #define PORT 1238 #define MESSAGE "Yow!!! Are we having fun yet?!?" #define SERVERHOST "192.168.9.101" void write_to_server (int filedes) { int nbytes; nbytes = write (filedes, MESSAGE, strlen (MESSAGE) + 1); if (nbytes < 0) { perror ("write"); } } void init_sockaddr (struct sockaddr_in *name, const char *hostname, uint16_t port) { struct hostent *hostinfo; name->sin_family = AF_INET; name->sin_port = htons (port); hostinfo = gethostbyname (hostname); if (hostinfo == NULL) { fprintf (stderr, "Unknown host %s.\n", hostname); } name->sin_addr = *(struct in_addr *) hostinfo->h_addr; } int main() { for (;;) { sleep(1); int sock; struct sockaddr_in servername; /* Create the socket. */ sock = socket (PF_INET, SOCK_STREAM, 0); if (sock < 0) { perror ("socket (client)"); } /* Connect to the server. */ init_sockaddr (&servername, SERVERHOST, PORT); if (0 > connect (sock, (struct sockaddr *) &servername, sizeof (servername))) { perror ("connect"); sock = -1; } /* Send data to the server. */ if (sock > -1) write_to_server (sock); if (close (sock) != 0) perror("close"); } return 0; }

    Read the article

  • How to interpret kernel panics?

    - by Owen
    Hi all, I'm new to linux kernel and could barely understand how to debug kernel panics. I have this error below and I don't know where in the C code should I start checking. I was thinking maybe I could echo what functions are being called so I could check where in the code is this null pointer dereferenced. What print function should I use ? How do you interpret the error message below? Unable to handle kernel NULL pointer dereference at virtual address 0000000d pgd = c7bdc000 [0000000d] *pgd=4785f031, *pte=00000000, *ppte=00000000 Internal error: Oops: 17 [#1] PREEMPT Modules linked in: bcm5892_secdom_fw(P) bcm5892_lcd snd_bcm5892 msr bcm5892_sci bcm589x_ohci_p12 bcm5892_skeypad hx_decoder(P) pinnacle hx_memalloc(P) bcm_udc_dwc scsi_mod g_serial sd_mod usb_storage CPU: 0 Tainted: P (2.6.27.39-WR3.0.2ax_standard #1) PC is at __kmalloc+0x70/0xdc LR is at __kmalloc+0x48/0xdc pc : [c0098cc8] lr : [c0098ca0] psr: 20000093 sp : c7a9fd50 ip : c03a4378 fp : c7a9fd7c r10: bf0708b4 r9 : c7a9e000 r8 : 00000040 r7 : bf06d03c r6 : 00000020 r5 : a0000093 r4 : 0000000d r3 : 00000000 r2 : 00000094 r1 : 00000020 r0 : c03a4378 Flags: nzCv IRQs off FIQs on Mode SVC_32 ISA ARM Segment user Control: 00c5387d Table: 47bdc008 DAC: 00000015 Process sh (pid: 1088, stack limit = 0xc7a9e260) Stack: (0xc7a9fd50 to 0xc7aa0000) fd40: c7a6a1d0 00000020 c7a9fd7c c7ba8fc0 fd60: 00000040 c7a6a1d0 00000020 c71598c0 c7a9fd9c c7a9fd80 bf06d03c c0098c64 fd80: c71598c0 00000003 c7a6a1d0 bf06c83c c7a9fdbc c7a9fda0 bf06d098 bf06d008 fda0: c7159880 00000000 c7a6a2d8 c7159898 c7a9fde4 c7a9fdc0 bf06d130 bf06d078 fdc0: c79ca000 c7159880 00000000 00000000 c7afbc00 c7a9e000 c7a9fe0c c7a9fde8 fde0: bf06d4b4 bf06d0f0 00000000 c79fd280 00000000 0f700000 c7a9e000 00000241 fe00: c7a9fe3c c7a9fe10 c01c37b4 bf06d300 00000000 c7afbc00 00000000 00000000 fe20: c79cba84 c7463c78 c79fd280 c7473b00 c7a9fe6c c7a9fe40 c00a184c c01c35e4 fe40: 00000000 c7bb0005 c7a9fe64 c79fd280 c7463c78 00000000 c00a1640 c785e380 fe60: c7a9fe94 c7a9fe70 c009c438 c00a164c c79fd280 c7a9fed8 c7a9fed8 00000003 fe80: 00000242 00000000 c7a9feb4 c7a9fe98 c009c614 c009c2a4 00000000 c7a9fed8 fea0: c7a9fed8 00000000 c7a9ff64 c7a9feb8 c00aa6bc c009c5e8 00000242 000001b6 fec0: 000001b6 00000241 00000022 00000000 00000000 c7a9fee0 c785e380 c7473b00 fee0: d8666b0d 00000006 c7bb0005 00000300 00000000 00000000 00000001 40002000 ff00: c7a9ff70 c79b10a0 c79b10a0 00005402 00000003 c78d69c0 ffffff9c 00000242 ff20: 000001b6 c79fd280 c7a9ff64 c7a9ff38 c785e380 c7473b00 00000000 00000241 ff40: 000001b6 ffffff9c 00000003 c7bb0000 c7a9e000 00000000 c7a9ff94 c7a9ff68 ff60: c009c128 c00aa380 4d18b5f0 08000000 00000000 00071214 0007128c 00071214 ff80: 00000005 c0027ee4 c7a9ffa4 c7a9ff98 c009c274 c009c0d8 00000000 c7a9ffa8 ffa0: c0027d40 c009c25c 00071214 0007128c 0007128c 00000241 000001b6 00000000 ffc0: 00071214 0007128c 00071214 00000005 00073580 00000003 000713e0 400010d0 ffe0: 00000001 bef0c7b8 000269cc 4d214fec 60000010 0007128c 00000000 00000000 Backtrace: [] (__kmalloc+0x0/0xdc) from [] (gs_alloc_req+0x40/0x70 [g_serial]) r8:c71598c0 r7:00000020 r6:c7a6a1d0 r5:00000040 r4:c7ba8fc0 [] (gs_alloc_req+0x0/0x70 [g_serial]) from [] (gs_alloc_requests+0x2c/0x78 [g_serial]) r7:bf06c83c r6:c7a6a1d0 r5:00000003 r4:c71598c0 [] (gs_alloc_requests+0x0/0x78 [g_serial]) from [] (gs_start_io+0x4c/0xac [g_serial]) r7:c7159898 r6:c7a6a2d8 r5:00000000 r4:c7159880 [] (gs_start_io+0x0/0xac [g_serial]) from [] (gs_open+0x1c0/0x224 [g_serial]) r9:c7a9e000 r8:c7afbc00 r7:00000000 r6:00000000 r5:c7159880 r4:c79ca000 [] (gs_open+0x0/0x224 [g_serial]) from [] (tty_open+0x1dc/0x314) [] (tty_open+0x0/0x314) from [] (chrdev_open+0x20c/0x22c) [] (chrdev_open+0x0/0x22c) from [] (__dentry_open+0x1a0/0x2b8) r8:c785e380 r7:c00a1640 r6:00000000 r5:c7463c78 r4:c79fd280 [] (__dentry_open+0x0/0x2b8) from [] (nameidata_to_filp+0x38/0x50) [] (nameidata_to_filp+0x0/0x50) from [] (do_filp_open+0x348/0x6f4) r4:00000000 [] (do_filp_open+0x0/0x6f4) from [] (do_sys_open+0x5c/0x170) [] (do_sys_open+0x0/0x170) from [] (sys_open+0x24/0x28) r8:c0027ee4 r7:00000005 r6:00071214 r5:0007128c r4:00071214 [] (sys_open+0x0/0x28) from [] (ret_fast_syscall+0x0/0x2c) Code: e59c4080 e59c8090 e3540000 159c308c (17943103) ---[ end trace be196e7cee3cb1c9 ]--- note: sh[1088] exited with preempt_count 2 process '-/bin/sh' (pid 1088) exited. Scheduling for restart. Welcome to Wind River Linux

    Read the article

  • CSS Graph- Bars not showing correctly

    - by Olivia
    I'm trying to create a CSS/HTML based graph using this tutorial here. However instead of putting the data directly into the html code I'm importing it from a CSV file using PHP with the following code. <?PHP /* Open CSV file */ $handle = fopen("defects.csv", "r"); $c = 0; /* gets data from csv file */ while (($data = fgetcsv($handle, 1000, ",")) !== FALSE) { /* stores dates as variable $date */ $date[$c] = $data[0]; $c++; /* inserts defect data into html code */ echo "<dd class=\"p" . $data[2] . "\"><span><b>" . $data[2] . "</b></span></dd>"; echo "<dd class=\"sub p" . $data[3] . "\" ><span><b>" . $data[3] . "</b></span></dd>"; } echo "</dl>"; echo "<ul class=\"xAxis\">"; /* X AXIS */ /* inserts date data into html code for x axis */ for ($d=0; $d < $c; $d++) { echo "<li>" . $date[$d] . "</li>"; } ?> The values are being placed correctly on the chart, but the bars aren't appearing. The CSS code I have for the bars is: /* default column styling */ dl#csschart span{ height:50%; background:url(../images/barx.png) repeat-y; } dl#csschart .sub{ margin-left:-33px; } dl#csschart .sub span{ background:url(../images/subBarx.png) repeat-y; } Just in case it helps, I've print screened how the graph should look. You can see it at: http://allured.info/graph/failgraph.png

    Read the article

  • cakephp datetime insertion behaviour

    - by littlechad
    hi everyone this is a cakePHP question about datetime database insertion mismatch, i jumped in to this project while the whole thing is already built around 70%. here's what happen, every time i insert a data that contain a datetime, the inserted time doesn't match the inputted date, and the mismatch has no pattern or what ever, in some table the differences is 5 hours, while in others it could be 12 hours, 7 hours, or even 15 hours. i have traced this by investigating the controller, the model, the app_controller, everything but i don't find anything that indicate a datetime insertion rules. if the view : echo $form->input('start_date', array('label' => __l('start date')); i can't even find in the controller anything like: $this->data['current_controller']['start_date'] = $this->data['current_controller']['start_date']; when i use pr($this-data); to print the posted data, this is shown: [start_date] => Array ( [month] => 02 [day] => 16 [year] => 2011 [hour] => [min] => [meridian] => ) so i figured doing something like: $yearMonDay = $this->data['current_controller']['start_date']['year']."-"; $yearMonDay .= $this->data['current_controller']['start_date']['month']."-"; $yearMonDay .= $this->data['current_controller']['start_date']['day']; if(!empty($this->data['current_controller']['start_date']['hour'])){ $hourMinSec = $this->data['current_controller']['start_date']['hour'].":"; $hourMinSec .= $this->data['current_controller']['start_date']['min'].":"; $hourMinSec .= $this->data['current_controller']['start_date']['meridian']; }else{ $hourMinSec = "00:00:00"; } $this->data['Deal']['start_date'] = $yearMonDay." ".$hourMinSec; just to make sure the funny thing is that those posted datetime is inserted into the database with the mismatch value anyway. it's getting pretty frustrating, is there any suggestion on where else should i find the codes that define how the datetime should be inserted? or probably give me a clue on how to override those mismatched insertion rules? thanks

    Read the article

  • how to use TinyMCE(rich text editor) in google-maps info window..

    - by zjm1126
    this is the demo rar file:http://omploader.org/vM3U1bA when i drag the red block to the google-maps ,it will be changed to a marker, and it will has TinyMCE when you click the info window, but my program is : it can not be written when i click it the second time, the first time: the second time(can not be written): and my code is : <!DOCTYPE html PUBLIC "-//WAPFORUM//DTD XHTML Mobile 1.0//EN" "http://www.wapforum.org/DTD/xhtml-mobile10.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <meta name="viewport" content="width=device-width,minimum-scale=0.3,maximum-scale=5.0,user-scalable=yes"> </head> <body onload="initialize()" onunload="GUnload()"> <style type="text/css"> *{ margin:0; padding:0; } </style> <!--<div style="width:100px;height:100px;background:blue;"> </div>--> <div id="map_canvas" style="width: 500px; height: 300px;"></div> <div class=b style="width: 20px; height: 20px;background:red;position:absolute;left:700px;top:200px;"></div> <div class=b style="width: 20px; height: 20px;background:red;position:absolute;left:700px;top:200px;"></div> <script src="jquery-1.4.2.js" type="text/javascript"></script> <script type="text/javascript" src="tiny_mce.js"></script> <script src="jquery-ui-1.8rc3.custom.min.js" type="text/javascript"></script> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=ABQIAAAA-7cuV3vqp7w6zUNiN_F4uBRi_j0U6kJrkFvY4-OX2XYmEAa76BSNz0ifabgugotzJgrxyodPDmheRA&sensor=false"type="text/javascript"></script> <script type="text/javascript"> var aFn; //********** function initialize() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map_canvas")); var center=new GLatLng(39.9493, 116.3975); map.setCenter(center, 13); aFn=function(x,y){ var point =new GPoint(x,y) point = map.fromContainerPixelToLatLng(point); //console.log(point.x+" "+point.y) var marker = new GMarker(point,{draggable:true}); var a=$( '<form method="post" action="" style="height:100px;overflow:hidden;width:220px;">'+ '<textarea id="" class="mce" name="content" cols="22" rows="5" style="border:none">sss</textarea>'+ '</form>') a.click(function(){ // }) GEvent.addListener(marker, "click", function() { marker.openInfoWindowHtml(a[0]); }); /****************** GEvent.addListener(marker, 'click', function() { marker.openInfoWindowHtml('<div contentEditable="true" ' + 'style="height: 100px; overflow: auto;">' + 'wwww</div>'); }); ***************/ map.addOverlay(marker); /********** var marker = new GMarker(point, {draggable: true}); GEvent.addListener(marker, "dragstart", function() { map.closeInfoWindow(); }); GEvent.addListener(marker, "dragend", function() { marker.openInfoWindowHtml("????..."); }); map.addOverlay(marker); //*/ } $(".b").draggable({ revert: true, revertDuration: 0 }); $("#map_canvas").droppable({ drop: function(event,ui) { //console.log(ui.offset.left+' '+ui.offset.top) aFn(event.pageX-$("#map_canvas").offset().left,event.pageY-$("#map_canvas").offset().top); } }); } } //********** $(".mce").live("click", function(){ var once=0; mce(); }); function mce(once){ if(once)return; tinyMCE.init({ // General options mode : "textareas", theme : "advanced", plugins : "safari,pagebreak,style,layer,table,save,advhr,advimage,advlink,emotions,iespell,inlinepopups,insertdatetime,preview,media,searchreplace,print,contextmenu,paste,directionality,fullscreen,noneditable,visualchars,nonbreaking,xhtmlxtras,template", // Theme options theme_advanced_buttons1 : "bold,forecolor,|,justifyleft,justifycenter,justifyright,|,fontsizeselect", theme_advanced_buttons2 : "", theme_advanced_buttons3 : "", theme_advanced_buttons4 : "", theme_advanced_toolbar_location : "top", theme_advanced_toolbar_align : "left", theme_advanced_statusbar_location : "bottom", theme_advanced_resizing : true, // Example content CSS (should be your site CSS) content_css : "css/example.css", // Drop lists for link/image/media/template dialogs template_external_list_url : "js/template_list.js", external_link_list_url : "js/link_list.js", external_image_list_url : "js/image_list.js", media_external_list_url : "js/media_list.js", // Replace values for the template plugin template_replace_values : { username : "Some User", staffid : "991234" } }); once=1; } //********** </script> </body> </html>

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

< Previous Page | 416 417 418 419 420 421 422 423 424 425 426 427  | Next Page >