Search Results

Search found 11068 results on 443 pages for 'print preview'.

Page 420/443 | < Previous Page | 416 417 418 419 420 421 422 423 424 425 426 427  | Next Page >

  • quick java question

    - by j-unit-122
    private static char[] quicksort (char[] array , int left , int right) { if (left < right) { int p = partition(array , left, right); quicksort(array, left, p - 1 ); quicksort(array, p + 1 , right); } for (char i : array) System.out.print(i + ” ”); System.out.println(); return array; } private static int partition(char[] a, int left, int right) { char p = a[left]; int l = left + 1, r = right; while (l < r) { while (l < right && a[l] < p) l++; while (r > left && a[r] >= p) r--; if (l < r) { char temp = a[l]; a[l] = a[r]; a[r] = temp; } } a[left] = a[r]; a[r] = p; return r; } } hi guys just a quick question regarding the above coding, i know that the above coding returns the following B I G C O M P U T E R B C E G I M P U T O R B C E G I M P U T O R B C E G I M P U T O R B C E G I M P U T O R B C E G I M O P T U R B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U B C E G I M O P R T U when the sequence BIGCOMPUTER is used but my question is can someone explain to me what is happening in the code and how? i know abit about the quick-sort algorithm but it doesnt seem to be the same in the above example.

    Read the article

  • Python-How to call up a function from another module?

    - by user2691540
    I am making a project where I need several modules which are imported into one main module to make a pizza ordering service. Upon finishing this (to a working standard) I decided to re-code it so that the whole order is completed with one tkinter window, now instead of using input(), I use tkinter.Entry() etc. etc. To do this I had to use functions for each step so it is broken up nicely, e.g. the code asks if the user wants pickup or delivery, the user clicks a button which sets some variables and one of the buttons is then configured to say "continue" and the command leads to the next step of the pizza ordering process e.g. getting the name. The problem I have is that when I get past the last function of the first module the configured button has a command to go to a function in the second module, but it says that the command is not defined??? I have tried my way around this but cannot import the configured button variable into the next module, and anything else I tried gave no result, it simply doesn't go to the next module after the first module is done. I have made the main tkinter window in the main module and have it that it will mainloop after importing the other modules so shouldn't the function I want to call upon be defined? How can I get from one function to the next if the latter is in a seperate module? Is this possible or do I have to rethink my approach and if so how? Ok then, have made some more code to show what my problem is, this isn't what I am actually using but it's a lot shorter and has the same issue: this is the main module: import tkinter mainwindow = tkinter.Tk() # here i set the window to a certain size etc. import mod1 import mod2 mainwindow.mainloop() this is mod1: import tkinter def button1(): label.destroy() button1.destroy() button2.config(text = "continue", command = func2) def button2(): label.destroy() button1.destroy() button2.config(text = "continue", command = func2) label = tkinter.Label(text = "example label") button1 = tkinter.Button(text = "button1", command = button1) button2 = tkinter.Button(text = "button2", command = button2) label.pack() button1.pack() button2.pack() this is mod2: def func2(): button2.destroy() print ("haha it works...") I still get the problem that func2 is not defined? Thanks in advance

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • using Object input\ output Streams with files and array list

    - by soad el-hayek
    hi every one .. i'm an it student , and it's time to finish my final project in java , i've faced too many problems , this one i couldn't solve it and i'm really ubset ! :S my code is like this : in Admin class : public ArrayList cos_info = new ArrayList(); public ArrayList cas_info = new ArrayList(); public int cos_count = 0 ; public int cas_count = 0 ; void coustmer_acount() throws FileNotFoundException, IOException{ String add=null; do{ person p = new person() ; cos_info.add(cos_count, p); cos_count ++ ; add =JOptionPane.showInputDialog("Do you want to add more coustmer..\n'y'foryes ..\n 'n'for No .."); } while(add.charAt(0) == 'Y'||add.charAt(0)=='y'); writenew_cos(); // add_acounts(); } void writenew_cos() throws IOException{ ObjectOutputStream aa = new ObjectOutputStream(new FileOutputStream("coustmer.txt")); aa.writeObject(cos_info); JOptionPane.showMessageDialog(null,"Added to file done sucessfuly.."); aa.close(); } in Coustmer class : void read_cos() throws IOException, ClassNotFoundException{ person p1= null ; int array_count = 0; ObjectInputStream d = new ObjectInputStream(new FileInputStrea ("coustmer.txt")); JOptionPane.showMessageDialog(null,d.available() ); for(int i = 0;d.available() == 0;i++){ a.add(array_count,(ArrayList) d.readObject()); array_count++; JOptionPane.showMessageDialog(null,"Haaaaai :D" ); JOptionPane.showMessageDialog(null,array_count ); } d.close(); JOptionPane.showMessageDialog(null,array_count +"1111" ); for(int i = 0 ; i<a.size()&& found!= true ; i++){ count++ ; p1 =(person)a.get(i); user=p1.user; pass = p1.pass; cas_checkpass(); } } it just print JOptionPane.showMessageDialog(null,d.available() ); and having excep. here a.add(array_count,(ArrayList) d.readObject()); p.s : person object from my own class and it's Serializabled

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • bad file descriptor with close() socket (c++)

    - by user321246
    hi everybody! I'm running out of file descriptors when my program can't connect another host. The close() system call doesn't work, the number of open sockets increases. I can se it with cat /proc/sys/fs/file-nr Print from console: connect: No route to host close: Bad file descriptor connect: No route to host close: Bad file descriptor .. Code: #include <stdio.h> #include <stdlib.h> #include <sys/socket.h> #include <netinet/in.h> #include <netdb.h> #include <string.h> #include <iostream> using namespace std; #define PORT 1238 #define MESSAGE "Yow!!! Are we having fun yet?!?" #define SERVERHOST "192.168.9.101" void write_to_server (int filedes) { int nbytes; nbytes = write (filedes, MESSAGE, strlen (MESSAGE) + 1); if (nbytes < 0) { perror ("write"); } } void init_sockaddr (struct sockaddr_in *name, const char *hostname, uint16_t port) { struct hostent *hostinfo; name->sin_family = AF_INET; name->sin_port = htons (port); hostinfo = gethostbyname (hostname); if (hostinfo == NULL) { fprintf (stderr, "Unknown host %s.\n", hostname); } name->sin_addr = *(struct in_addr *) hostinfo->h_addr; } int main() { for (;;) { sleep(1); int sock; struct sockaddr_in servername; /* Create the socket. */ sock = socket (PF_INET, SOCK_STREAM, 0); if (sock < 0) { perror ("socket (client)"); } /* Connect to the server. */ init_sockaddr (&servername, SERVERHOST, PORT); if (0 > connect (sock, (struct sockaddr *) &servername, sizeof (servername))) { perror ("connect"); sock = -1; } /* Send data to the server. */ if (sock > -1) write_to_server (sock); if (close (sock) != 0) perror("close"); } return 0; }

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Java NoSuchElementException using scanner.nextInt()

    - by othnin
    I am trying to read in a pgm file (512x512 array) and when I read in a larger file I get the error: java.util.NoSuchElementException on reading element (3,97). I have created a much smaller file to read (23x23) and it reads fine. Is there a size limit? I have checked the file and confirmed that there is an int for the value: This appears to be the line it crashes at: fileArray[row][col] = scan.nextInt(); Here is the file: import java.util.Scanner; import java.io.*; public class FileReader { public static void main(String[] args) throws IOException { String fileName = "lena.pgma"; int width, height, maxValue; FileInputStream fileInputStream = null; fileInputStream = new FileInputStream(fileName); Scanner scan = new Scanner(fileInputStream); // Discard the magic number scan.nextLine(); // Discard the comment line scan.nextLine(); // Read pic width, height and max value width = scan.nextInt(); System.out.println("Width: " + width); height = scan.nextInt(); System.out.println("Heigth: " + height); maxValue = scan.nextInt(); fileInputStream.close(); // Now parse the file as binary data FileInputStream fin = new FileInputStream(fileName); DataInputStream dis = new DataInputStream(fin); // look for 4 lines (i.e.: the header) and discard them int numnewlines = 4; while (numnewlines > 0) { char c; do { c = (char)(dis.readUnsignedByte()); } while (c != '\n'); numnewlines--; } // read the image data int[][] fileArray = new int[height][width]; for (int row = 0; row < height; row++) { for (int col = 0; col < width; col++) { fileArray[row][col] = scan.nextInt(); System.out.print("(" + row + " ," + col +"): " + fileArray[row][col]+ " "); } System.out.println(); } dis.close(); } } any advise would be appreciated.

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • Cross-site request forgery protections: Where do I put all these lines?

    - by brilliant
    Hello, I was looking for a python code that would be able to log in from "Google App Engine" to some of my accounts on some websites (like yahoo or eBay) and was given this code: import urllib, urllib2, cookielib url = "https://login.yahoo.com/config/login?" form_data = {'login' : 'my-login-here', 'passwd' : 'my-password-here'} jar = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(jar)) form_data = urllib.urlencode(form_data) # data returned from this pages contains redirection resp = opener.open(url, form_data) # yahoo redirects to http://my.yahoo.com, so lets go there instead resp = opener.open('http://mail.yahoo.com') print resp.read() Unfortunately, this code didn't work, so I asked another question here and one supporter among other things said this: "You send MD5 hash and not plain password. Also you'd have to play along with all kinds of CSRF protections etc. that they're implementing. Look: <input type="hidden" name=".tries" value="1"> <input type="hidden" name=".src" value="ym"> <input type="hidden" name=".md5" value=""> <input type="hidden" name=".hash" value=""> <input type="hidden" name=".js" value=""> <input type="hidden" name=".last" value=""> <input type="hidden" name="promo" value=""> <input type="hidden" name=".intl" value="us"> <input type="hidden" name=".bypass" value=""> <input type="hidden" name=".partner" value=""> <input type="hidden" name=".u" value="bd5tdpd5rf2pg"> <input type="hidden" name=".v" value="0"> <input type="hidden" name=".challenge" value="5qUiIPGVFzRZ2BHhvtdGXoehfiOj"> <input type="hidden" name=".yplus" value=""> <input type="hidden" name=".emailCode" value=""> <input type="hidden" name="pkg" value=""> <input type="hidden" name="stepid" value=""> <input type="hidden" name=".ev" value=""> <input type="hidden" name="hasMsgr" value="0"> <input type="hidden" name=".chkP" value="Y"> <input type="hidden" name=".done" value="http://mail.yahoo.com"> <input type="hidden" name=".pd" value="ym_ver=0&c=&ivt=&sg="> I am not quite sure where he got all these lines from and where in my code I am supposed to add them. Do You have any idea? I know I was supposed to ask him this question first, and I did, but he never returned, so I decided to ask a separate question here.

    Read the article

  • Is a many-to-many relationship with extra fields the right tool for my job?

    - by whichhand
    Previously had a go at asking a more specific version of this question, but had trouble articulating what my question was. On reflection that made me doubt if my chosen solution was correct for the problem, so this time I will explain the problem and ask if a) I am on the right track and b) if there is a way around my current brick wall. I am currently building a web interface to enable an existing database to be interrogated by (a small number of) users. Sticking with the analogy from the docs, I have models that look something like this: class Musician(models.Model): first_name = models.CharField(max_length=50) last_name = models.CharField(max_length=50) dob = models.DateField() class Album(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) class Instrument(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) Where I have one central table (Musician) and several tables of associated data that are related by either ForeignKey or OneToOneFields. Users interact with the database by creating filtering criteria to select a subset of Musicians based on data the data on the main or related tables. Likewise, the users can then select what piece of data is used to rank results that are presented to them. The results are then viewed initially as a 2 dimensional table with a single row per Musician with selected data fields (or aggregates) in each column. To give you some idea of scale, the database has ~5,000 Musicians with around 20 fields of related data. Up to here is fine and I have a working implementation. However, it is important that I have the ability for a given user to upload there own annotation data sets (more than one) and then filter and order on these in the same way they can with the existing data. The way I had tried to do this was to add the models: class UserDataSets(models.Model): user = models.ForeignKey(User) name = models.CharField(max_length=100) description = models.CharField(max_length=64) results = models.ManyToManyField(Musician, through='UserData') class UserData(models.Model): artist = models.ForeignKey(Musician) dataset = models.ForeignKey(UserDataSets) score = models.IntegerField() class Meta: unique_together = (("artist", "dataset"),) I have a simple upload mechanism enabling users to upload a data set file that consists of 1 to 1 relationship between a Musician and their "score". Within a given user dataset each artist will be unique, but different datasets are independent from each other and will often contain entries for the same musician. This worked fine for displaying the data, starting from a given artist I can do something like this: artist = Musician.objects.get(pk=1) dataset = UserDataSets.objects.get(pk=5) print artist.userdata_set.get(dataset=dataset.pk) However, this approach fell over when I came to implement the filtering and ordering of query set of musicians based on the data contained in a single user data set. For example, I could easily order the query set based on all of the data in the UserData table like this: artists = Musician.objects.all().order_by(userdata__score) But that does not help me order by the results of a given single user dataset. Likewise I need to be able to filter the query set based on the "scores" from different user data sets (eg find all musicians with a score 5 in dataset1 and < 2 in dataset2). Is there a way of doing this, or am I going about the whole thing wrong?

    Read the article

  • c++ i need help with this program. everytime i try to run it, i got a problem

    - by FOXMULDERIZE
    1-the program must read numeric data from a file. 2-only one line per number 3-half way between those numbers is a negative number. 4-the program must sum those who are above the negative number in a acumulator an those below the negative number in another acumulator. 5-the black screen shall print both results and determined who is grater or equal. include include using namespace std; void showvalues(int,int,int[]); void showvalues2(int,int); void sumtotal(int,int); int main() { int total1=0; int total2=0; const int SIZE_A= 9; int arreglo[SIZE_A]; int suma,total,a,b,c,d,e,f; ifstream archivo_de_entrada; archivo_de_entrada.open("numeros.txt"); //lee/// for(int count =0 ;count < SIZE_A;count++) archivo_de_entrada>>arreglo[count] ; archivo_de_entrada.close(); showvalues(0,3,arreglo); showvalues2(5,8); sumtotal(total1,total2); system("pause"); return 0; } void showvalues(int a,int b,int arreglos) { int total1=0; //muestra//////////////////////// cout<< "los num son "; for(int count = a ;count <= b;count++) total1 += arreglos[count]; cout < } void showvalues2(int c,int d) { ////////////////////////////// int total2=0; cout<< "los num 2 son "; for(count =5 ;count <=8;count++) total2 = total2 + arreglo[count]; cout < void sumtotal(int e,int f) { ///////////////////////////////// cout<<"la suma de t1 y t2 es "; total= total1 + total2; cout< }

    Read the article

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • How do I call a function name that is stored in a hash in Perl?

    - by Ether
    I'm sure this is covered in the documentation somewhere but I have been unable to find it... I'm looking for the syntactic sugar that will make it possible to call a method on a class whose name is stored in a hash (as opposed to a simple scalar): use strict; use warnings; package Foo; sub foo { print "in foo()\n" } package main; my %hash = (func => 'foo'); Foo->$hash{func}; If I copy $hash{func} into a scalar variable first, then I can call Foo->$func just fine... but what is missing to enable Foo->$hash{func} to work? (EDIT: I don't mean to do anything special by calling a method on class Foo -- this could just as easily be a blessed object (and in my actual code it is); it was just easier to write up a self-contained example using a class method.) EDIT 2: Just for completeness re the comments below, this is what I'm actually doing (this is in a library of Moose attribute sugar, created with Moose::Exporter): # adds an accessor to a sibling module sub foreignTable { my ($meta, $table, %args) = @_; my $class = 'MyApp::Dir1::Dir2::' . $table; my $dbAccessor = lcfirst $table; eval "require $class" or do { die "Can't load $class: $@" }; $meta->add_attribute( $table, is => 'ro', isa => $class, init_arg => undef, # don't allow in constructor lazy => 1, predicate => 'has_' . $table, default => sub { my $this = shift; $this->debug("in builder for $class"); ### here's the line that uses a hash value as the method name my @args = ($args{primaryKey} => $this->${\$args{primaryKey}}); push @args, ( _dbObject => $this->_dbObject->$dbAccessor ) if $args{fkRelationshipExists}; $this->debug("passing these values to $class -> new: @args"); $class->new(@args); }, ); } I've replaced the marked line above with this: my $pk_accessor = $this->meta->find_attribute_by_name($args{primaryKey})->get_read_method_ref; my @args = ($args{primaryKey} => $this->$pk_accessor); PS. I've just noticed that this same technique (using the Moose meta class to look up the coderef rather than assuming its naming convention) cannot also be used for predicates, as Class::MOP::Attribute does not have a similar get_predicate_method_ref accessor. :(

    Read the article

  • Downloading large file with php

    - by Alessandro
    Hi, I have to write a php script to download potentially large files. The file I'm reporting here works fine most of the times. However, if the client's connection is slow the request ends (with status code 200) in the middle of the downloading, but not always at the very same point, and not at the very same time. I tried to overwrite some php.ini variables (see the first statements) but the problem remains. I don't know if it's relevant but my hosting server is SiteGround, and for simple static file requests, the download works fine also with slow connections. I've found Forced downloading large file with php but I didn't understand mario's answer. I'm new to web programming. So here's my code. <?php ini_set('memory_limit','16M'); ini_set('post_max_size', '30M'); set_time_limit(0); include ('../private/database_connection.php'); $downloadFolder = '../download/'; $fileName = $_POST['file']; $filePath = $downloadFolder . $fileName; if($fileName == NULL) { exit; } ob_start(); session_start(); if(!isset($_SESSION['Username'])) { // or redirect to login (remembering this download request) $_SESSION['previousPage'] = 'download.php?file=' . $fileName; header("Location: login.php"); exit; } if (file_exists($filePath)) { header('Content-Description: File Transfer'); header('Content-Type: application/octet-stream'); //header('Content-Disposition: attachment; filename='.$fileName); header("Content-Disposition: attachment; filename=\"$fileName\""); header('Content-Transfer-Encoding: binary'); header('Expires: 0'); header('Cache-Control: must-revalidate, post-check=0, pre-check=0'); //header('Pragma: public'); header('Content-Length: ' . filesize($filePath)); ob_clean(); flush(); // download // 1 // readfile($filePath); // 2 $file = @fopen($filePath,"rb"); if ($file) { while(!feof($file)) { print(fread($file, 1024*8)); flush(); if (connection_status()!=0) { @fclose($file); die(); } } @fclose($file); } exit; } else { header('HTTP/1.1 404 File not found'); exit; } ?>

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • How to return the value from MySql Stored Proc ??

    - by karthik
    I am using the below storedproc to generate the Insert statements of a specified table It is build-ed without any errors. Now i want to return the result set in "V_string" as output of the SP DELIMITER $$ DROP PROCEDURE IF EXISTS `demo`.`InsertGenerator` $$ CREATE DEFINER=`root`@`localhost` PROCEDURE `InsertGenerator`() SWL_return: BEGIN -- SQLWAYS_EVAL# to retrieve column specific information -- SQLWAYS_EVAL# table DECLARE v_string NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# first half -- SQLWAYS_EVAL# tement DECLARE v_stringData NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# data -- SQLWAYS_EVAL# statement DECLARE v_dataType NATIONAL VARCHAR(1000); -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# columns DECLARE v_colName NATIONAL VARCHAR(50); DECLARE NO_DATA INT DEFAULT 0; DECLARE cursCol CURSOR FOR SELECT column_name,data_type FROM `columns` -- WHERE table_name = v_tableName; WHERE table_name = 'tbl_users'; DECLARE CONTINUE HANDLER FOR SQLEXCEPTION BEGIN SET NO_DATA = -2; END; DECLARE CONTINUE HANDLER FOR NOT FOUND SET NO_DATA = -1; OPEN cursCol; SET v_string = CONCAT('INSERT ',v_tableName,'('); SET v_stringData = ''; SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; IF NO_DATA <> 0 then -- NOT SUPPORTED print CONCAT('Table ',@tableName, ' not found, processing skipped.') close cursCol; LEAVE SWL_return; end if; WHILE NO_DATA = 0 DO IF v_dataType in('varchar','char','nchar','nvarchar') then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(',v_colName,'SQLWAYS_EVAL# ''+'); ELSE if v_dataType in('text','ntext') then -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# else SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 00)),'''')+'''''',''+'); ELSE IF v_dataType = 'money' then -- SQLWAYS_EVAL# doesn't get converted -- SQLWAYS_EVAL# implicitly SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# y,''''''+ isnull(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0.0000'')+''''''),''+'); ELSE IF v_dataType = 'datetime' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# time,''''''+ isnull(cast(',v_colName, 'SQLWAYS_EVAL# 0)),''0'')+''''''),''+'); ELSE IF v_dataType = 'image' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(convert(varbinary,',v_colName, 'SQLWAYS_EVAL# 6)),''0'')+'''''',''+'); ELSE SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0'')+'''''',''+'); end if; end if; end if; end if; end if; SET v_string = CONCAT(v_string,v_colName,','); SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; END WHILE; END $$ DELIMITER ;

    Read the article

< Previous Page | 416 417 418 419 420 421 422 423 424 425 426 427  | Next Page >