Search Results

Search found 26810 results on 1073 pages for 'fixed point'.

Page 444/1073 | < Previous Page | 440 441 442 443 444 445 446 447 448 449 450 451  | Next Page >

  • capturing user identity for an online application

    - by Samuel
    We are designing an online application (college admission form) which mandates the user to upload a scanned copy of his photo along with his signature, so that this information can be used to cross verify the applicant when he appears for a exam + personal interview at a later point in time. This entire process requires a scanner for the applicant to scan his photo / signature into an appropriate size. Is there a better way to capture user identity for such purposes as usage of scanner for capturing signature, photo is a painful process.

    Read the article

  • Weighted Average and Ratings

    - by Danten
    Maths isn't my strong point and I'm at a loss here. Basically, all I need is a simple formula that will give a weighted rating on a scale of 1 to 5. If there are very few votes, they carry less influence and the rating pressess more towards the average (in this case I want it to be 3, not the average of all other ratings). I've tried a few different bayesian implementations but these haven't worked out. I believe the graphical representation I am looking for could be shown as: ___ / ___/ Cheers

    Read the article

  • IronPython overriding __setattr__ and __getattr__

    - by yodaj007
    I'm trying to implement a class in C# with a method that intercepts the Python __setattr__ and __getattr__ magic methods. I found this bug report: http://ironpython.codeplex.com/WorkItem/View.aspx?WorkItemId=8143 But that is from 2008, and nowhere can I find ICustomAttributes or PythonNameAttribute. I don't see anything useful in Interfaces.cs either. Can someone point me in the right direction?

    Read the article

  • How to clear an ImageView in Android?

    - by Pentium10
    I am resusing ImageViews for my displays, but at some point I don't have values to put it. So how to clear an ImageView in Android? I've tried: mPhotoView.invalidate(); mPhotoView.setImageBitmap(null); None of them have cleared the view, it still shows previous image.

    Read the article

  • Apache as Reverse Proxy for CouchDB

    - by Overflown
    I'm thinking of a web app that uses CouchDB extensively, to the point where there would be great gains from serving with the native erlang HTTP API as much as possible. Can you configure Apache as a reverse proxy to allow outside GETs to be proxied directly to CouchDB, whereas PUT/POST are sent to the application internal logic (for sanitation, authentication...)? Or is this unwise -- the CouchDB built-in authentication options just seem a little weak for a Web App. Thanks

    Read the article

  • What are the top javascript pitfalls?

    - by googletorp
    I'm planing on giving an introduction talk on JavaScript and in the preparation process I wondered what the top pitfalls are that rookies fall into. I know I've had a few gotchas before I fully understood closure, but much of the strange behavior in JavaScript is not something I think about any more... So, which pitfalls should you deffinately point out to the rookies?

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Load a list of localized strings at once in IOS

    - by Victor Ronin
    I want to show a table with the list of strings which are localized. The straightforward method would be: a) Point data source to my ViewController b) Define an array c) Allocate the array in my ViewController and init (arrayWithObjects) it with the strings from localized resources (NSLocalizedString) d) Use this array in UITableViewDataSource delegated methods Mainly my concern is item b). The construction looks quite heavy and I wonder whether I can somehow specify and load whole list of localized string at once.

    Read the article

  • Use one Socket to send and recieve data

    - by volody
    What makes more sense? use one socket to send and receive data to/from a embedded hardware device use one socket to send data and separate socket to read data Communication is not very intensive but the important point is to receive data as fast as possible. On application side is used Windows XP and up.

    Read the article

  • Replacing deprecated <:< Manifest type witness in Scala 2.10

    - by Josh
    Can someone point me at what I should be doing under scala 2.10 in place of this deprecated type witness on Manifest? reflect.ClassManifest.singleType(foo) <:< barManifest Honestly, my goal here is just to replace it with something that doesn't raise a deprecation warning. I'm happy to use the new reflection API. Here's the code in question in context, if that's important: https://github.com/azavea/geotrellis/blob/master/src/main/scala/geotrellis/feature/op/geometry/geometry.scala#L45

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • Autocompletion based on filenames in a directory

    - by Nils Riedemann
    Hi there, I want to have a function in my zsh for faster accessing my todo-files. It should look inside the folder ~/tasks where i put my todo-lists and stuff. Now i want to type task p and when I hit tab, it should use the files in that directory for autocompletition. Can anyone point me some direction? Or share some snippet to work with? Thanks

    Read the article

  • asp.net state server session - cross appDomain?

    - by newone1
    When using a State server for session, are sessions still appDomain specific? So for example, I have two different IIS applications(virtual directories) on a web server, and they both point to one state server for session. The session guid from the cookie will be the same across requests from both applications, so will the same session be accessible across both of these applications? Thanks.

    Read the article

  • JavaScript Music Player with progress bar?

    - by pfunc
    I am creating a little JavaScript music player that sits on the btottom of the page, a lot like streampad. But streampad uses a flash progress bar for the song and JavaScript for everything else and I am having a hard time finding anyone who does this with JavaScript alone. Can anyone point me in the right direction on how this can be done (preferably without using HTML5)?

    Read the article

  • problem with clear: right;

    - by toomanyairmiles
    Hi Everyone, I'm having a problem with this page http://www.gwynfryncottages.com/news.php The .blog-footer div needs to clear on the right to correct for the height of the pictures introducing clear:right; causes the huge gap to appear on the page in FF and IE. I'm at a loss, I've tried numerous ideas to get around the problem and at this point i've been staring at it too long to see the problem clearly. Can anyone help me out. Thanks in advance.

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • What is the best method to convert to an Integer in JavaScript?

    - by Mathew Byrne
    There are several different methods for converting floating point numbers to Integers in JavaScript. My question is what method gives the best performance, is most compatible, or is considered the best practice? Here are a few methods that I know of: var a = 2.5; window.parseInt(a); // 2 Math.floor(a); // 2 a | 0; // 2 I'm sure there are others out there. Suggestions?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Exporting dates properly formatted on Google Appengine in Python

    - by Chris M
    I think this is right but google appengine seems to get to a certain point and cop-out; Firstly is this code actually right; and secondly is there away to skip the record if it cant output (like an ignore errors and continue)? class TrackerExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'SearchRec', [('__key__', lambda key:key.name(), None), ('WebSite', str, None), ('DateStamp', lambda x: datetime.datetime.strptime(x, '%d-%m-%Y').date(), None), ('IP', str, None), ('UserAgent', str, None)]) Thanks

    Read the article

< Previous Page | 440 441 442 443 444 445 446 447 448 449 450 451  | Next Page >