Search Results

Search found 26810 results on 1073 pages for 'fixed point'.

Page 448/1073 | < Previous Page | 444 445 446 447 448 449 450 451 452 453 454 455  | Next Page >

  • django deployment apache

    - by Uszy Wieloryba
    I would like to create a python script, which will: Create a django project in the current directory. Fix settings.py, urls.py. Do syncdb Install new apache instance listening on specific port (command line argument), with WSGI configured to serve my project. I can't figure out how to do point 3. EDIT: Peter Rowell: I need the solution for both Linux and Windows I have root access This is a dedicated host Apache only

    Read the article

  • Should I learn FLEX, is it a marketable enough?

    - by aceinthehole
    I haven been recently laid off and was considering what to learn in the down time while trying to get another job. I had heard that Adobe's FLEX was starting to become more in-demand, and have seen it increasingly on job postings. Has anyone else been successful (career wise) in learning FLEX? Is it worth spending time to learn FLEX to add a bullet point to a resume, and lead to a possible job or should time be spent else where?

    Read the article

  • How to do smart resource planning for short Agile/Sprint cycles?

    - by Chanakya
    We use scrum technique to plan for short development lifecycle. It is very common that sometimes tasks gets moved or reallocated or deferred from the current sprint for multiple reasons. In that case there is a chance of resources getting freed up from the planned work. It may get difficult to allocate new tasks to them during sprint as mostly all projects are tied up at that point with planned work. What is the best way to plan resources in these situations?

    Read the article

  • How do I use multiple where clauses in GHCi?

    - by T.R.
    I'm playing around with GHCi for the first time, and I'm having some trouble writing multi-line functions. My code is as follows: Prelude> :{ Prelude| let diffSquares lst = abs $ squareOfSums lst - sumOfSquares lst Prelude| where Prelude| squareOfSums lst = (fst (sumsAndSquares lst))^2 Prelude| sumOfSquares lst = snd (sumsAndSquares lst) Prelude| sumsAndSquares = foldl (\(sms,sqrs) x -> (sms+x,sqrs+x^2)) (0,0) Prelude| :} It gives the following error: <interactive>:1:142: parse error on input `=' Could someone kindly point me in the direction of what I'm missing?

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • Which location to save uploaded files

    - by chupinette
    hello! I am using php and i have written codes to allow a user upload a file. For testing purposes, i have saved the file to D:/final/temp/test.xls. Then i generate another file and save it to the same location. This file can be downloaded by the user. But if an actual user would be using my application, where should the location point to? Thanks!

    Read the article

  • What is the difference between using IDisposable vs a destructor in C#?

    - by j0rd4n
    When would I implement IDispose on a class as opposed to a destructor? I read this article, but I'm still missing the point. My assumption is that if I implement IDispose on an object, I can explicitly 'destruct' it as opposed to waiting for the garbage collector to do it. Is this correct? Does that mean I should always explicitly call Dispose on an object? What are some common examples of this?

    Read the article

  • File upload progress bar

    - by Punit
    Anyone who has developed file upload progress bar with following: Ajax Javascript HTML C based CGI I am stuck at one point. I am not able to read each updated progress bar value from CGI script.

    Read the article

  • Windows Azure Table Storage Error when in the cloud

    - by Dan Jones
    hey, I downloaded the simple table storage sample on Cloudy in Seattle blog It works perfect when aimed at local storage but when I change to point to azure storage i get the following error Screenshot (on skydrive) http://cid-00341536d0f91b53.skydrive.live.com/self.aspx/.Public/error.png anyone see this before? thanks guys

    Read the article

  • what is a feature in sharepoint?

    - by raklos
    ...what are the essential components(files required) for a "Feature".. and can anyone point to any best practice tutorials on creating features (using the "12 hive")... sharepoint dev is new to me, and im just looking for best practice development. tutorial/screencasts will be a bonus thanks

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Qt training tips and tricks

    - by 0xDEAD BEEF
    I have just arrived at new company and have never worked with Qt before, but my task is to learn Qt in 2 weeks, so i can give training to others. So i got 2 weeks to learn Qt and prepare for 2 weeks long Qt training. I am so dead! Please point out some common mistakes, tricks, styles so i can make that training a bit better! Thank you!

    Read the article

  • Effect of 'myObj = [[[[MyClass alloc] init] autorelease] retain];'?

    - by filipe
    I've just downloaded the Facebook iOS SDK and I noticed that in the sample code that comes with the SDK whenever it creates an instance of the Facebook class it does it like this: _facebook = [[[[Facebook alloc] init] autorelease] retain]; where _facebook is a member variable of the calling object (i.e. not a local variable). Can anyone explain exactly what's the point of autoreleasing and then retaining it?

    Read the article

  • Retrieving & Displaying data from csv files using AJAX

    - by JJ
    I need to provide a feature such that the user is able to upload a csv file.Once the uploading is done I need to retrieve each value and show it on a grid which is implemented using far point(http://www.fpoint.com/products/spread/spread.aspx).But all this has to be done without the page being refreshed.I use asp.net 2.0 & Ajax Pro.Remember I cannot use the inbuilt AJAX feature provided by microsoft .To be precise I need something similar to the lines of attaching a file using gmail. Thanks & Regards Bikram

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • VS2010 almost always zooms text on scroll

    - by Chris Barr
    You know the neat text zoom feature in VS2010 where you hold down Ctrl and then use your scroll wheel? Well, this seems to happen by default (and without ever pressing Ctrl) to nearly every file I open. Usually I open a file and have to scroll to some lower point, but instead it starts zooming the text! I have found that by tapping the Ctrl key VS then realizes that it should scroll instead of zoom, but it's still very annoying. Any ideas?

    Read the article

  • Any Free Alternative to the ASP.net Calendar Control?

    - by Ronnie Overby
    Here are the problems I am having with the control from the factory: no easy way to get the first visible date (yeah I could use day render, but at that point in the page cycle, I can't do what I need to, which is manipulate a collection in viewstate) changing the visibledate property in my code does not raise the visiblemonthchanged event. That just doesn't make any sense to me. Can someone suggest a free, improved calendar control?

    Read the article

< Previous Page | 444 445 446 447 448 449 450 451 452 453 454 455  | Next Page >