Search Results

Search found 12846 results on 514 pages for 'ghost answer'.

Page 484/514 | < Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >

  • Javascript scope problem with object and setTimeout

    - by Shabbyrobe
    I'm trying to make a jQuery plugin that executes a method on a timer. I'd like it to work on multiple elements on a page independently. I've reached a point where the timer executes for each element, but the method called in the setTimeout seems to only know about the last instance of the plugin. I know I'm doing something fundamentally stupid here, but I'm danged if I know what. I know stuff like this has been asked 8 million times on here before, but I've not managed to find an answer that relates to my specific problem. Here's a script that demonstrates the structure of what I'm doing. <html> <head> <script type="text/javascript" src="assets/jquery.min.js"></script> <script type="text/javascript"> var crap = 0; (function($) { jQuery.fn.pants = function(options) { var trousers = { id: null, current: 0, waitTimeMs: 1000, begin: function() { var d = new Date(); this.id = crap++; console.log(this.id); // do a bunch of stuff window.setTimeout(function(self) {return function() {self.next();}}(this), this.waitTimeMs); }, next: function() { this.current ++; console.log(this.id); window.setTimeout(function(self) {return function() {self.next();}}(this), this.waitTimeMs); }, }; options = options || {}; $.extend(trousers, options); this.each(function(index, element) { trousers.begin(); }); return this; }; } )(jQuery); jQuery(document).ready(function() { jQuery("div.wahey").pants(); }); </script> </head> <body> <div class="wahey"></div> <div class="wahey"></div> </body> </html> The output I get is this: 0 1 1 1 1 1 The output I expect to get is this: 0 1 0 1 0 1

    Read the article

  • how to refactor user-permission system?

    - by John
    Sorry for lengthy question. I can't tell if this should be a programming question or a project management question. Any advice will help. I inherited a reasonably large web project (1 year old) from a solo freelancer who architected it then abandoned it. The project was a mess, but I cleaned up what I could, and now the system is more maintainable. I need suggestions on how to extend the user-permission system. As it is now, the database has a t_user table with the column t_user.membership_type. Currently, there are 4 membership types with the following properties: 3 of the membership types are almost functionally the same, except for the different monthly fees each must pay 1 of the membership type is a "fake-user" type which has limited access ( different business logic also applies) With regards to the fake-user type, if you look in the system's business logic files, you will see a lot of hard-coded IF statements that do something like if (fake-user) { // do something } else { // a paid member of type 1,2 or 3 // proceed normally } My client asked me to add 3 more membership types to the system, each of them with unique features to be implemented this month, and substantive "to-be-determined" features next month. My first reaction is that I need to refactor the user-permission system. But it concerns me that I don't have enough information on the "to-be-determined" membership type features for next month. Refactoring the user-permission system will take a substantive amount of time. I don't want to refactor something and throw it out the following month. I get substantive feature requests on a monthly basis that come out of the blue. There is no project road map. I've asked my client to provide me with a roadmap of what they intend to do with the new membership types, but their answer is along the lines of "We just want to do [feature here] this month. We'll think of something new next month." So questions that come to mind are: 1) Is it dangerous for me to refactor the user permission system not knowing what membership type features exist beyond a month from now? 2) Should I refactor the user permission system regardless? Or just continue adding IF statements as needed in all my controller files? Or can you recommend a different approach to user permission systems? Maybe role-based ? 3) Should this project have a road map? For a 1 year old project like mine, how far into the future should this roadmap project? 4) Any general advice on the best way to add 3 new membership types?

    Read the article

  • How to draw a filled envelop like a cone on OpenGL (using GLUT)?

    - by ashishsony
    Hi, I am relatively new to OpenGL programming...currently involved in a project that uses freeglut for opengl rendering... I need to draw an envelop looking like a cone (2D) that has to be filled with some color and some transparency applied. Is the freeglut toolkit equipped with such an inbuilt functionality to draw filled geometries(or some trick)?? or is there some other api that has an inbuilt support for filled up geometries.. Thanks. Best Regards. Edit1: just to clarify the 2D cone thing... the envelop is the graphical interpretation of the coverage area of an aircraft during interception(of an enemy aircraft)...that resembles a sector of a circle..i should have mentioned sector instead.. and glutSolidCone doesnot help me as i want to draw a filled sector of a circle...which i have already done...what remains to do is to fill it with some color... how to fill geometries with color in opengl?? Thanks. Edit2: Ok thanks for replying...all the answers posted to this questions can work for my problem in a way.. But i would definitely would want to know a way how to fill a geometry with some color. Say if i want to draw an envelop which is a parabola...in that case there would be no default glut function to actually draw a filled parabola(or is there any??).. So to generalise this question...how to draw a custom geometry in some solid color?? Thanks. Edit3: The answer that mstrobl posted works for GL_TRIANGLES but for such a code: glBegin(GL_LINE_STRIP); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 0.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(200.0, 0.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(200.0, 200.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 200.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 0.0, 0.0); glEnd(); which draws a square...only a wired square is drawn...i need to fill it with blue color. anyway to do it? if i put some drawing commands for a closed curve..like a pie..and i need to fill it with a color is there a way to make it possible... i dont know how its possible for GL_TRIANGLES... but how to do it for any closed curve?? Thanks.

    Read the article

  • Selenium: How to use stored value in a javascript comparison

    - by dstrube
    I've searched around for the answer to this and found lots of much more complicated questions, but none that gave me insight enough to figure this one out. What I'm doing: 1- open a page with a number that will probably be large 2- get the X Path to where that number is and store it to a variable 3- do a javascript to compare the above stored variable to see if it is bigger than 10, if so, set a new varaible to true; else false (because that is the default value) 4- verify the variable in #3 is true Sounds simple enough, no? Where it goes wrong: At step 3, comparing the variable from step #2 to 10 isn't allowed, at least not the way I'm writing it. Why? Details: <tr> <td>open</td> <td>http://www.google.com/search?hl=en&q=selenium+verifyEval</td> <td></td> </tr> <tr> <td>store</td> <td>/html/body/div[5]/div/p/b[3]</td> <td>resultCount</td> </tr> <tr> <td>storeEval</td> <td>var isMoreThan10 = new Boolean(); isMoreThan10 = (resultCount &gt; 10);</td> <td>isMoreThan10</td> </tr> <tr> <td>verifyExpression</td> <td>${isMoreThan10}</td> <td>true</td> </tr> I just thought of one possible workaround: Exapnd the javascript code to get the value there & assign it to a variable there so I'll be more likely to be able to use that variable in the javascript. Not sure exactly how that would be done- anyone wanna help with that? But surely there is be a better way, isn't there? I must be able to assign a value to a variable in Selenium, then in the next line use that variable in a javascript, right?

    Read the article

  • overwrite existing entity via bulkloader.Loader

    - by Ray Yun
    I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • Internet Explorer 8 + Deflate

    - by Andreas Bonini
    I have a very weird problem.. I really do hope someone has an answer because I wouldn't know where else to ask. I am writing a cgi application in C++ which is executed by Apache and outputs HTML code. I am compressing the HTML output myself - from within my C++ application - since my web host doesn't support mod_deflate for some reason. I tested this with Firefox 2, Firefox 3, Opera 9, Opera 10, Google Chrome, Safari, IE6, IE7, IE8, even wget.. It works with ANYTHING except IE8. IE8 just says "Internet Explorer cannot display the webpage", with no information whatsoever. I know it's because of the compression only because it works if I disable it. Do you know what I'm doing wrong? I use zlib to compress it, and the exact code is: /* Compress it */ int compressed_output_size = content.length() + (content.length() * 0.2) + 16; char *compressed_output = (char *)Alloc(compressed_output_size); int compressed_output_length; Compress(compressed_output, compressed_output_size, (void *)content.c_str(), content.length(), &compressed_output_length); /* Send the compressed header */ cout << "Content-Encoding: deflate\r\n"; cout << boost::format("Content-Length: %d\r\n") % compressed_output_length; cgiHeaderContentType("text/html"); cout.write(compressed_output, compressed_output_length); static void Compress(void *to, size_t to_size, void *from, size_t from_size, int *final_size) { int ret; z_stream stream; stream.zalloc = Z_NULL; stream.zfree = Z_NULL; stream.opaque = Z_NULL; if ((ret = deflateInit(&stream, CompressionSpeed)) != Z_OK) COMPRESSION_ERROR("deflateInit() failed: %d", ret); stream.next_out = (Bytef *)to; stream.avail_out = (uInt)to_size; stream.next_in = (Bytef *)from; stream.avail_in = (uInt)from_size; if ((ret = deflate(&stream, Z_NO_FLUSH)) != Z_OK) COMPRESSION_ERROR("deflate() failed: %d", ret); if (stream.avail_in != 0) COMPRESSION_ERROR("stream.avail_in is not 0 (it's %d)", stream.avail_in); if ((ret = deflate(&stream, Z_FINISH)) != Z_STREAM_END) COMPRESSION_ERROR("deflate() failed: %d", ret); if ((ret = deflateEnd(&stream)) != Z_OK) COMPRESSION_ERROR("deflateEnd() failed: %d", ret); if (final_size) *final_size = stream.total_out; return; }

    Read the article

  • How to adjust microphone gain from C# (needs to work on XP & W7)...

    - by Ed
    First, note that I know there are a few questions like this already posted; however they don't seem to address the problem adequately. I have a C# application, with all the pInvoke hooks to talk to the waveXXX API, and I'm able to do capture and play back of audio with that. I'm also able to adjust speaker (WaveOut) volume with that API. The problem is that for whatever reason, that API does not allow me to adjust microphone (WaveIn) volume. So, I managed to find some mixer code that I've also pulled in and access through pInvoke and that allows me to adjust microphone volume, but only on my W7 PC. The mixer code I started with comes from here: http://social.msdn.microsoft.com/Forums/en-US/isvvba/thread/05dc2d35-1d45-4837-8e16-562ee919da85 and it works, but is written to adjust speaker volume. I added the SetMicVolume method shown here... public static void SetMicVolume(int mxid, int percentage) { bool rc; int mixer, vVolume; MIXERCONTROL volCtrl = new MIXERCONTROL(); int currentVol; mixerOpen(out mixer, mxid, 0, 0, MIXER_OBJECTF_WAVEIN); int type = MIXERCONTROL_CONTROLTYPE_VOLUME; rc = GetVolumeControl(mixer, MIXERLINE_COMPONENTTYPE_SRC_MICROPHONE, type, out volCtrl, out currentVol); if (rc == false) { mixerClose(mixer); mixerOpen(out mixer, 0, 0, 0, 0); rc = GetVolumeControl(mixer, MIXERLINE_COMPONENTTYPE_SRC_MICROPHONE, type, out volCtrl, out currentVol); if (rc == false) throw new Exception("SetMicVolume/GetVolumeControl() failed"); } vVolume = ((int)((float)(volCtrl.lMaximum - volCtrl.lMinimum) / 100.0F) * percentage); rc = SetVolumeControl(mixer, volCtrl, vVolume); if (rc == false) throw new Exception("SetMicVolume/SetVolumeControl() failed"); mixerClose(mixer); } Note the "second attempt" to call GetVolumeControl(). This is done because on XP, in the first call to GetVolumeControl (refer to site above for that code), the call to mixerGetLineControlsA() fails with XP systems returning MIXERR_INVALCONTROL. Then, with this second attempt using mixerOpen(out mixer, 0, 0, 0, 0), the code doesn't return a failure but the mic gain is unaffected. Note, as I said above, this works on W7 (the second attempt is never executed because it doesn't fail using mixerOpen(out mixer, mxid, 0, 0, MIXER_OBJECTF_WAVEIN)). I admit to not having a good grasp on the mixer API, so that's what I'm looking into now; however if anyone has a clue why this would work on W7, but not XP, I'd sure like to hear it. Meanwhile, if I figure it out before I get a response, I'll post my own answer...

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • Values of generated column not appearing in table

    - by msh210
    I'm using mysql version 5.1.41-3ubuntu12.10 (Ubuntu). mysql> show create table tt\G *************************** 1. row *************************** Table: tt Create Table: CREATE TABLE `tt` ( `pz` int(8) DEFAULT NULL, `os` varchar(8) DEFAULT NULL, `uz` int(11) NOT NULL, `p` bigint(21) NOT NULL DEFAULT '0', `c` decimal(23,0) DEFAULT NULL, KEY `pz` (`pz`), KEY `uz` (`uz`), KEY `os` (`os`), KEY `pz_2` (`pz`,`uz`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 1 row in set (0.00 sec) mysql> select pz,uz,pz*uz, -> if(pz*uz,1,.5), -> left(pz,2) pl,left(lpad(uz,5,0),2) ul, -> p from tt limit 10; +-------+----+-------+----------------+--------+----+--------+ | pz | uz | pz*uz | if(pz*uz,1,.5) | pl | ul | p | +-------+----+-------+----------------+--------+----+--------+ | NULL | 0 | NULL | 0.5 | NULL | 00 | 4080 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 323754 | | 89101 | 0 | 0 | 0.5 | 89 | 00 | 6880 | | 0 | 0 | 0 | 0.5 | 0 | 00 | 11591 | | 89110 | 0 | 0 | 0.5 | 89 | 00 | 72 | | 78247 | 0 | 0 | 0.5 | 78 | 00 | 27 | | 90062 | 0 | 0 | 0.5 | 90 | 00 | 5 | | 63107 | 0 | 0 | 0.5 | 63 | 00 | 4 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 54561 | | 94102 | 0 | 0 | 0.5 | 94 | 00 | 12499 | +-------+----+-------+----------------+--------+----+--------+ So far so good. As you see, 0.5 appears as a value of if(pz*uz,1,.5). The problem is: mysql> select os, -> if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5) uptwo, -> if(pz*uz,left(pz,3)<=>left(lpad(uz,5,0),3),.5) upthree, -> sum(p) p,sum(c) c -> from tt t -> group by os,uptwo,upthree order by null; +----+-------+---------+---------+-------+ | os | uptwo | upthree | p | c | +----+-------+---------+---------+-------+ | u | 1 | 1 | 52852 | 318 | | i | 1 | 1 | 7046563 | 21716 | | m | 1 | 1 | 1252166 | 7337 | | i | 0 | 0 | 1830284 | 4033 | | m | 0 | 0 | 294612 | 1714 | | i | 1 | 0 | 911486 | 3560 | | m | 1 | 0 | 145182 | 1136 | | u | 0 | 0 | 12144 | 23 | | u | 1 | 0 | 1571 | 8 | +----+-------+---------+---------+-------+ Although I group by uptwo, 0.5 doesn't appear in that column. What happened to the 0.5 values? Edit: As noted in the comments to Todd Gibson's answer, I also tried it with if(pz*uz,cast(left(pz,2)<=>left(lpad(uz,5,0),2) as decimal),.5) instead of if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5), but it, too, didn't work.

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • MySQL - Calculating fields on the fly vs storing calculated data

    - by Christian Varga
    Hi Everyone, I apologise if this has been asked before, but I can't seem to find an answer to a question that I have about calculating on the fly vs storing fields in a database. I read a few articles that suggested it was preferable to calculate when you can, but I would just like to know if that still applies to the following 2 examples. Example 1. Say you are storing data relating to a car. You store the fuel tank size in litres, and how many litres it uses per 100km. You also want to know how many KMs it can travel, which can be calculated from the tank size and economy. I see 2 ways of doing this: When a car is added or updated, calculate the amount of KMs and store this as a static field in the database. Every time a car is accessed, calculate the amount of KMs on the fly. Because the cars economy/tank size doesn't change (although it could be edited), the KMs is a pretty static value. I don't see why we would calculate it every single time the car is accessed. Wouldn't this waste cpu time as opposed to simply storing it in a separate field in the database and calculating only when a car is added or updated? My next example, which is almost an entirely different question (but on the same topic), relates to counting children. Let's say we have a app which has categories and items. We have a view where we display all the categories, and a count of all the items inside each category. Again, I'm wondering what's better. To perform a MySQL query to count all the items in each category every single time the page is accessed? Or store the count in a field in the categories table and update when an item is added / deleted? I know it is redundant to store anything that can be calculated, but I worry that calculating fields or counting records might be slow as opposed to storing the data in a field. If it's not then please let me know, I just want to learn about when to use either method. On a small scale I guess it wouldn't matter either way, but apps like Facebook, would they really count the amount of friends you have every time someone views your profile or would they just store it as a field? I'd appreciate any responses to both of these scenarios, and any resource that might explain the benefits of calculating vs storing. Thanks in advance, Christian

    Read the article

  • Loading the last related record instantly for multiple parent records using Entity framework

    - by Guillaume Schuermans
    Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • GHC.Generics and Type Families

    - by jberryman
    This is a question related to my module here, and is simplified a bit. It's also related to this previous question, in which I oversimplified my problem and didn't get the answer I was looking for. I hope this isn't too specific, and please change the title if you can think if a better one. Background My module uses a concurrent chan, split into a read side and write side. I use a special class with an associated type synonym to support polymorphic channel "joins": {-# LANGUAGE TypeFamilies #-} class Sources s where type Joined s newJoinedChan :: IO (s, Messages (Joined s)) -- NOT EXPORTED --output and input sides of channel: data Messages a -- NOT EXPORTED data Mailbox a instance Sources (Mailbox a) where type Joined (Mailbox a) = a newJoinedChan = undefined instance (Sources a, Sources b)=> Sources (a,b) where type Joined (a,b) = (Joined a, Joined b) newJoinedChan = undefined -- and so on for tuples of 3,4,5... The code above allows us to do this kind of thing: example = do (mb , msgsA) <- newJoinedChan ((mb1, mb2), msgsB) <- newJoinedChan --say that: msgsA, msgsB :: Messages (Int,Int) --and: mb :: Mailbox (Int,Int) -- mb1,mb2 :: Mailbox Int We have a recursive action called a Behavior that we can run on the messages we pull out of the "read" end of the channel: newtype Behavior a = Behavior (a -> IO (Behavior a)) runBehaviorOn :: Behavior a -> Messages a -> IO () -- NOT EXPORTED This would allow us to run a Behavior (Int,Int) on either of msgsA or msgsB, where in the second case both Ints in the tuple it receives actually came through separate Mailboxes. This is all tied together for the user in the exposed spawn function spawn :: (Sources s) => Behavior (Joined s) -> IO s ...which calls newJoinedChan and runBehaviorOn, and returns the input Sources. What I'd like to do I'd like users to be able to create a Behavior of arbitrary product type (not just tuples) , so for instance we could run a Behavior (Pair Int Int) on the example Messages above. I'd like to do this with GHC.Generics while still having a polymorphic Sources, but can't manage to make it work. spawn :: (Sources s, Generic (Joined s), Rep (Joined s) ~ ??) => Behavior (Joined s) -> IO s The parts of the above example that are actually exposed in the API are the fst of the newJoinedChan action, and Behaviors, so an acceptable solution can modify one or all of runBehaviorOn or the snd of newJoinedChan. I'll also be extending the API above to support sums (not implemented yet) like Behavior (Either a b) so I hoped GHC.Generics would work for me. Questions Is there a way I can extend the API above to support arbitrary Generic a=> Behavior a? If not using GHC's Generics, are there other ways I can get the API I want with minimal end-user pain (i.e. they just have to add a deriving clause to their type)?

    Read the article

  • waiting for 2 different events in a single thread

    - by João Portela
    component A (in C++) - is blocked waiting for alarm signals (not relevant) and IO signals (1 udp socket). has one handler for each of these. component B (java) - has to receive the same information the component A udp socket receives. periodicaly gives instructions that should be sent through component A udp socket. How to join both components? it is strongly desirable that: the changes to attach component B to component A are minimal (its not my code and it is not very pleasent to mess with). the time taken by the new operations (usually communicating with component B) interfere very little with the usual processing time of component A - this means that if the operations are going to take a "some" time I would rather use a thread or something to do them. note: since component A receives udp packets more frequently that it has component B instructions to forward, if necessary, it can only forward the instructions (when available) from the IO handler. my initial ideia was to develop a component C (in C++) that would sit inside the component A code (is this called an adapter?) that when instanciated starts the java process and makes the necessary connections (that not so little overhead in the initialization is not a problem). It would have 2 stacks, one for the data to give component B (lets call it Bstack) and for the data to give component A (lets call it Astack). It would sit on its thread (lets call it new-thread) waiting for data to be available in Bstack to send it over udp, and listen on the udp socket to put data on the Astack. This means that the changes to component A are only: when it receives a new UDP packet put it on the Bstack, and if there is something on the Astack sent it over its UDP socket (I decided for this because this socket would only be used in the main thread). One of the problems is that I don't know how to wait for both of these events at the same time using only one thread. so my questions are: Do I really need to use the main thread to send the data over component A socket or can I do it from the new-thread? (I think the answer is no, but I'm not sure about race conditions on sockets) how to I wait for both events? boost::condition_variable or something similar seems the solution in the case of the stack and boost::asio::io_service io_service.run() seems like the thing to use for the socket. Is there any other alternative solution for this problem that I'm not aware of? Thanks for reading this long text but I really wanted you to understand the problem.

    Read the article

  • Image animation problem in silverlight

    - by Jak
    Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • Why does std::map operator[] create an object if the key doesn't exist?

    - by n1ck
    Hi, I'm pretty sure I already saw this question somewhere (comp.lang.c++? Google doesn't seem to find it there either) but a quick search here doesn't seem to find it so here it is: Why does the std::map operator[] create an object if the key doesn't exist? I don't know but for me this seems counter-intuitive if you compare to most other operator[] (like std::vector) where if you use it you must be sure that the index exists. I'm wondering what's the rationale for implementing this behavior in std::map. Like I said wouldn't it be more intuitive to act more like an index in a vector and crash (well undefined behavior I guess) when accessed with an invalid key? Refining my question after seeing the answers: Ok so far I got a lot of answers saying basically it's cheap so why not or things similar. I totally agree with that but why not use a dedicated function for that (I think one of the comment said that in java there is no operator[] and the function is called put)? My point is why doesn't map operator[] work like a vector? If I use operator[] on an out of range index on a vector I wouldn't like it to insert an element even if it was cheap because that probably mean an error in my code. My point is why isn't it the same thing with map. I mean, for me, using operator[] on a map would mean: i know this key already exist (for whatever reason, i just inserted it, I have redundancy somewhere, whatever). I think it would be more intuitive that way. That said what are the advantage of doing the current behavior with operator[] (and only for that, I agree that a function with the current behavior should be there, just not operator[])? Maybe it give clearer code that way? I don't know. Another answer was that it already existed that way so why not keep it but then, probably when they (the ones before stl) choose to implement it that way they found it provided an advantage or something? So my question is basically: why choose to implement it that way, meaning a somewhat lack of consistency with other operator[]. What benefit do it give? Thanks

    Read the article

  • To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

    - by Globalkeith
    Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • One registry key for many products not deleted on uninstall

    - by NC1
    My company has many products, we want to create a registry key Software\$(var.Manufacturer)that will have all of our products if our customers have installed more than one (which is likely) I then want to have a secondary key for each of our products which get removed on uninstall but the main one does not. I have tried to achieve this like below but my main key gets deleted so all of my other products also get deleted from the registry. I know this is trivial but I cannot find an answer. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="*" MultiInstance="yes" Permanent="yes"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="*" MultiInstance="yes" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef> EDIT: I have got my registry keys to stay using the following code. However they only all delete wen all products are deleted, not one by one as they need to. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="FF75CA48-27DE-430E-B78F-A1DC9468D699" Permanent="yes" Shared="yes" Win64="$(var.Win64)"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="D94FA576-970F-4503-B6C6-BA6FBEF8A60A" Win64="$(var.Win64)" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" ForceDeleteOnUninstall="yes"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef>

    Read the article

< Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >