Search Results

Search found 51290 results on 2052 pages for 'google image search'.

Page 512/2052 | < Previous Page | 508 509 510 511 512 513 514 515 516 517 518 519  | Next Page >

  • CSS - Overlaying one image on top of another

    - by Jack W-H
    Hey folks! I can't best describe this in words, so I'll show you with pictures. Here's how my designer intends the Gravatar images to look in the sidebar of our site: Here's the overlay image I made (screenshotted from Photoshop): Here's how it looks right now... Not quite ideal, I think you'll agree. This is the CSS code I am using: .gravatarsidebar { float:left; padding:0px; width:70px; } .gravataroverlay { width:68px; height:68px; background-image: url('http://localhost:8888/images/gravataroverlay.png'); } And here's the XHTML (and a sprinkle of PHP to fetch the Gravatar based on the user's email address, which is fetched from our database): <div class="gravataroverlay"></div> <div class="gravatarsidebar"> <?php $gravatar_link = 'http://www.gravatar.com/avatar/' . md5($email) . '?s=68'; echo '<img src="' . $gravatar_link . '" alt="Gravatar" />'; ?> </div> So what can I do? I can't use relative positioning as it makes the word 'Search' in the div below stay moved to the right. Thanks for your help! Jack

    Read the article

  • What is wrong with this CSS?

    - by Christopher
    I have the following CSS code: .yellow { background-image: url('/images/yellowlight.png'); background-repeat: no-repeat; height:100%; width:100%; } and the following HTML code: <div class="yellow">&nbsp;</div> However, the div on the page does not have the image. You can see this by clicking on the blue "Logs Status" button (in the tab box) at http://cl58logs.co.cc/. What's wrong with the CSS?

    Read the article

  • In search of a network file system with extended caching to speed up file access

    - by Brecht Machiels
    I'm running a small home server that stores my documents. The disks in this server are in a RAID 1 configuration (using Linux md) and it's also periodically being backup up to an external hard drive to make sure I don't lose them. However, I'm always accessing the files from other computers on the home network using an SMB share, and this results in a considerable speed penalty (especially when connected over WLAN). This is quite annoying when editing large files, such as digital camera RAWs, for example. I've been looking for a solution to this problem. It would have to offer some kind of local caching to speed up the file access. The client would preferably not keep a copy of all data on the server, as it consists of a very large collection of photographs, most of which I will not access frequently. Instead, it should only cache the accessed files and sync the changes back in the background. Ideally, it would also do some smart read-ahead (cache the files that are in the same directory as the currently opened file, for examples), but I suppose that's asking a bit much. Synchronization should be automatic (on file change). Conflicting file changes (at the same time on different clients) are unlikely to happen in my use case, but I would prefer if they are handled properly (notification to the user). I've come across the following options, so far: something similar to Dropbox. iFolder seems to be the only thing that comes close, but its reputation (stability) and requirements put me off. A distributed file system such as OpenAFS. I'm not sure this will speed up file access. It is probably overkill for what I need. Maybe NFS or even Samba offer these possibilities. I read a bit about Windows' Offline Files, but its operation seems limited (at least on Windows XP). As this is just for personal use, I'm not willing to spend a lot of money. A free solution would be preferred. Also, the server needs to run on Linux, and I need a client for at least Windows.

    Read the article

  • How do I use .htaccess conditional redirects for multiple domains?

    - by John
    I'm managing about 15 or so domains for a particular promotion. Each domain has specific redirects in place, as shown below. Rather than make 15 different .htaccess files that I would later have to manage separately, I'd like to use a single .htaccess file and use a symbolic link into each website's directory. The trouble is that, I can't figure out how to make the rules apply only for a specific domain. Every time I visit www.redirectsite2.com, it sends me to www.targetsite.com/search.html?state=PA&id=75, when it should instead be sending me to www.targetsite.com/search.html?state=NJ&id=68. How exactly do I make multiple RewriteRules apply for a given domain and only that domain? Is this even possible to do within a single .htaccess file? Options +FollowSymlinks # redirectsite1.com RewriteEngine On RewriteBase / # start processing rules for www.redirectsite1.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite1\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,L] RewriteRule ^PGN$ http://targetsite.com/search.html?state=PA&id=26 [QSA,R,NC,L] RewriteRule ^NS$ http://targetsite.com/search.html?state=PA&id=27 [QSA,R,NC,L] RewriteRule ^INQ$ http://targetsite.com/search.html?state=PA&id=28 [QSA,R,NC,L] RewriteRule ^AA$ http://targetsite.com/search.html?state=PA&id=29 [QSA,R,NC,L] RewriteRule ^PI$ http://targetsite.com/search.html?state=PA&id=30 [QSA,R,NC,L] RewriteRule ^GV$ http://targetsite.com/search.html?state=PA&id=31 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=PA&id=75 [QSA,R,NC,L] # end processing rules for www.redirectsite1.com # begin rules for redirectsite2.com RewriteCond %{QUERY_STRING} ^$ RewriteCond %{HTTP_HOST} ^www\.redirectsite2\.com$ # rule for organic visit first RewriteRule ^$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,L] RewriteRule ^SL$ http://targetsite.com/search.html?state=NJ&id=6 [QSA,R,NC,L] RewriteRule ^APP$ http://targetsite.com/search.html?state=NJ&id=8 [QSA,R,NC,L] # catch-all rule, using the same id as the organic visit RewriteRule ^([a-z]+)?$ http://targetsite.com/search.html?state=NJ&id=68 [QSA,R,NC,L] Thanks for any help you may be able to provide!

    Read the article

  • Using Java Executor on AppEngine causes AccessControlException

    - by Drew
    How do you get java.util.concurrent.Executor or CompletionService to work on Google AppEngine? The classes are all officially white-listed, but I get a runtime security error when trying to submit asynchronous tasks. Code: // uses the async API but this factory makes it so that tasks really // happen sequentially Executor executor = java.util.concurrent.Executors.newSingleThreadExecutor(); // wrap Executor in CompletionService CompletionService<String> completionService = new ExecutorCompletionService<String>(executor); final SomeTask someTask = new SomeTask(); // this line throws exception completionService.submit(new Callable<String>(){ public String call() { return someTask.doNothing("blah"); } }); // alternately, send Runnable task directly to Executor, // which also throws an exception executor.execute(new Runnable(){ public void run() { someTask.doNothing("blah"); } }); } private class SomeTask{ public String doNothing(String message){ return message; } } Exception: java.security.AccessControlException: access denied (java.lang.RuntimePermission modifyThreadGroup) at java.security.AccessControlContext.checkPermission(AccessControlContext.java:323) at java.security.AccessController.checkPermission(AccessController.java:546) at java.lang.SecurityManager.checkPermission(SecurityManager.java:532) at com.google.appengine.tools.development.DevAppServerFactory$CustomSecurityManager.checkPermission(DevAppServerFactory.java:166) at com.google.appengine.tools.development.DevAppServerFactory$CustomSecurityManager.checkAccess(DevAppServerFactory.java:191) at java.lang.ThreadGroup.checkAccess(ThreadGroup.java:288) at java.lang.Thread.init(Thread.java:332) at java.lang.Thread.(Thread.java:565) at java.util.concurrent.Executors$DefaultThreadFactory.newThread(Executors.java:542) at java.util.concurrent.ThreadPoolExecutor.addThread(ThreadPoolExecutor.java:672) at java.util.concurrent.ThreadPoolExecutor.addIfUnderCorePoolSize(ThreadPoolExecutor.java:697) at java.util.concurrent.ThreadPoolExecutor.execute(ThreadPoolExecutor.java:652) at java.util.concurrent.Executors$DelegatedExecutorService.execute(Executors.java:590) at java.util.concurrent.ExecutorCompletionService.submit(ExecutorCompletionService.java:152) This code works fine when run on Tomcat or via command-line JVM. However, it chokes in the AppEngine SDK Jetty container (tried with Eclipse plugin and the maven-gae-plugin). AppEngine is likely designed to not allow potentially dangerous programs to run, so I could see them completely disabling thread creation. However, why would Google allow you to create a class, but not allow you to call methods on it? White-listing java.util.concurrent is misleading. Is there some other way to do parallel/simultaneous/concurrent tasks on GAE?

    Read the article

  • Unexpected result in C algebra for search algorithm.

    - by Rhys
    Hi, I've implemented this search algorithm for an ordered array of integers. It works fine for the first data set I feed it (500 integers), but fails on longer searches. However, all of the sets work perfectly with the other four search algorithms I've implemented for the assignment. This is the function that returns a seg fault on line 178 (due to an unexpected negative m value). Any help would be greatly appreciated. CODE: 155 /* perform Algortihm 'InterPolationSearch' on the set 156 * and if 'key' is found in the set return it's index 157 * otherwise return -1 */ 158 int 159 interpolation_search(int *set, int len, int key) 160 { 161 int l = 0; 162 int r = len - 1; 163 int m; 164 165 while (set[l] < key && set[r] >= key) 166 { 167 168 printf ("m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l])\n"); 169 170 printf ("m = %d + ((%d - %d) * (%d - %d)) / (%d - %d);\n", l, key, set[l], r, l, set[r], set[l]); 171 m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]); 172 printf ("m = %d\n", m); 173 174 #ifdef COUNT_COMPARES 175 g_compares++; 176 #endif 177 178 if (set[m] < key) 179 l = m + 1; 180 else if (set[m] > key) 181 r = m - 1; 182 else 183 return m; 184 } 185 186 if (set[l] == key) 187 return l; 188 else 189 return -1; 190 } OUTPUT: m = l + ((key - set[l]) * (r - l)) / (set[r] - set[l]) m = 0 + ((68816 - 0) * (100000 - 0)) / (114836 - 0); m = -14876 Thankyou! Rhys

    Read the article

  • PHP - How to use Php inside Php?

    - by Dodi300
    Hello. Can someone tell/show me how to use PHP inside PHP. I'm trying to make the URL of an image change depending on what value is in a MySQL database. Here's an example of what I'm trying to do. Bear in mind that $idx already has a value from the URL of the page. <?php $query = "SELECT * FROM comment WHERE uname='$idx'"; $result = mysql_query($query); while($row = mysql_fetch_array($result, MYSQL_ASSOC)) { echo "<img src='' name='comm' width='75px' height='60px' id='mainimage' />"; } ?> How would I make the source value, for the image, come from a different table?

    Read the article

  • Change the source of image by clicking thumbnail using updatePanel

    - by Batu
    For example, i have this ImageViewer.ascx UserControl: <div class="ImageTumbnails"> <asp:ListView ID="ImageList" runat="server" ItemPlaceholderID="ItemContainer"> <LayoutTemplate> <asp:PlaceHolder ID="ItemContainer" runat="server" /> </LayoutTemplate> <ItemTemplate> <asp:HyperLink runat="server" NavigateUrl='<%# Link.ToProductImage(Eval("ImageFile").ToString())%>'> <asp:Image runat="server" ImageUrl='<%# Link.ToThumbnail(Eval("ImageFile").ToString()) %>' /> </asp:HyperLink> </ItemTemplate> </asp:ListView> </div> <div class="ImageBig"> <asp:Image ID="ProductImageBig" runat="server" ImageUrl="" /> </div> When the thumbnail is clicked it will change the source of ProductImageBig with its hyperlink target. How can i achieve this using UpdatePanel ? ( Or will i be able to )

    Read the article

  • Facebook Graph API - Image Uploading (as3/flash)

    - by lollertits
    I have been trying to get a bit more familiar with the Graph API for facebook. Its very convenient although the documentation is poor at some places. Im having trouble uploading an image to an album. Anyone know how to do it ? This is the code im currently working on :) private function uploadNewPic(albumId:String):void { var bmd1:BitmapData = new BitmapData(200, 200, false, 0x666666); var bm1:Bitmap = new Bitmap(bmd1); var jpgEncoder:JPGEncoder = new JPGEncoder(); var ba:ByteArray = jpgEncoder.encode(bmd1); var data:URLVariables = new URLVariables(); data.message = "Message"; data.image = ba; data.photos = ba; data.url = ba; var method:String = URLRequestMethod.POST; var loader:URLLoader = facebook.call(albumId + "/photos", data, method); loader.addEventListener(FacebookOAuthGraphEvent.ERROR, onPicError); loader.addEventListener(FacebookOAuthGraphEvent.DATA, onPicUploaded); } Im pretty much down to trial and error :) Any ideas ?

    Read the article

  • Memory leak with NSData

    - by Kamchatka
    I'm having a leak with this code without being able to find where it's coming from. This function get called within an autorelease pool. I release the IplImage* image argument. When I run the ObjAlloc tool, it tells me that "NSData* data" is leaking. If I try to manually release the UIImage returned by this function, I get an EXC_BAD_ACCESS error, probably because this UIImage is autoreleased. I'm a bit confused, any hint would be appreciated. Thanks! UIImage *UIImageFromIplImage(IplImage *image) { NSLog(@"IplImage (%d, %d) %d bits by %d channels, %d bytes/row %s", image->width, image->height, image->depth, image->nChannels, image->widthStep, image->channelSeq); CGColorSpaceRef colorSpace = CGColorSpaceCreateDeviceRGB(); NSData *data = [NSData dataWithBytes:image->imageData length:image->imageSize]; CGDataProviderRef provider = CGDataProviderCreateWithCFData((CFDataRef)data); CGImageRef imageRef = CGImageCreate(image->width, image->height, image->depth, image->depth * image->nChannels, image->widthStep, colorSpace, kCGImageAlphaNone|kCGBitmapByteOrderDefault, provider, NULL, false, kCGRenderingIntentDefault); UIImage *ret = [UIImage imageWithCGImage:imageRef]; CGImageRelease(imageRef); CGDataProviderRelease(provider); CGColorSpaceRelease(colorSpace); return ret; }

    Read the article

  • search data from FileReader in Java

    - by maya
    hi I'm new in java how to read and search data from file (txt) and then display the data in TextArea or Jtable. for example I have file txt contains data and I need to display this data in textarea after I clicked a button, I have used FileReader , and t1 t2 tp are attributes in the file import java.io.FileReader; import java.io.IOException; String t1,t2,tp; Ffile f1= new Ffile(); FileReader fin = new FileReader("test2.txt"); Scanner src = new Scanner(fin); while (src.hasNext()) { t1 = src.next(); textarea.setText(t1); t2 = src.next(); textarea.setText(t2); tp = src.next(); textarea.setText(tp); f1.insert(t1,t2,tp); } fin.close(); also I have used the inputstream DataInputStream dis = null; String dbRecord = null; try { File f = new File("text2.text"); FileInputStream fis = new FileInputStream(f); BufferedInputStream bis = new BufferedInputStream(fis); dis = new DataInputStream while ( (dbRecord = dis.readLine()) != null) { StringTokenizer st = new StringTokenizer(dbRecord, ":"); String t1 = st.nextToken(); String t2 = st.nextToken(); String tp = st.nextToken(); textarea.setText(textarea.getText()+t1); textarea.setText(textarea.getText()+t2); textarea.setText(textarea.getText()+tp); } } catch (IOException e) { // catch io errors from FileInputStream or readLine() System.out.println("Uh oh, got an IOException error: " + e.getMessage()); } finally { } but both of them don't work ,so please any one help me I want to know how to read data and also search it from file and i need to display the data in textarea . thanks in advance

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Setting UIImage dimensions on UITableViewCell image

    - by bbrown
    I've got a standard UITableViewCell where I'm using the text and image properties to display a favicon.ico and a label. For the most part, this works really well since UIImage supports the ICO format. However, some sites (like Amazon.com say) have favicon.icos that make use of the ICO format's ability to store multiple sizes in the same file. Amazon stores four different sizes, all the way up to 48x48. This results in most images being 16x16 except for a few that come in at 32x32 or 48x48 and make everything look terrible. I have searched here, the official forum, the documentation, and elsewhere without success. I have tried everything that I could think of to constrain the image size. The only thing that worked was an undocumented method, which I'm not about to use. This is my first app and my first experience with Cocoa (came from C#). In case I wasn't clear in what I'm looking for, ideally the advice would center around setting the dimensions of the UIImage so that the 48x48 version would scale down to 16x16 or a method to tell UIImage to use the 16x16 version present in the ICO file. I don't necessarily need code: just a suggestion of an approach would do me fine. Does anyone have any suggestions? (I asked in the official forum as well because I've sunk more than a day into this already. If a solution is posted there, I'll put it here as well.)

    Read the article

  • Help Email Account Management among multiple users

    - by CogitoErgoSum
    So I preface this with saying this may belong in IT Security, not too sure feel free to move. Currently we have an email account [email protected] - hosted via google apps (as is all our email). We had an incident where we had to terminate an employee. This employee however had the password for this account as we have 20-30 people utilizing it at any given point to manage customer emails etc. Thinking on this I feel there must be a better way to manage access. With Google you can associate upto 10 email accounts to another the problem is we have more like 20-30 people going. We were evaluating tools such as SalesForce and Assistly where people have their own login credentials and then the system contains the appropriate smtp information for the [email protected] email address to send emails from it rather than a users personal account. Aside from those options does anyone have any other thoughts? One suggestion floated was moving everyone to desktop clients and saving the PW info there so they could only login from their physical workstation but we may have situations where we'd like employees to work remotely. Does anyone have experience with this sort of system where ~20-30 people are responding from one email box and how to manage security and access?

    Read the article

  • review count and rating using an image - schema.org

    - by Joel
    I need some help getting some rich snippets to my site I inserted the review microdata following the instructions given on schema.org here http://schema.org/docs/gs.html#advanced_missing using the star-image for rating and the text for review count, but testing it with the test tool it showed nothing. Example page where we use the microdata for the reviews. and here is what I used <div itemprop="reviews" itemscope itemtype="http://schema.org/AggregateRating"> <A HREF="javascript:an();"><img src="/images/stars/4.5.gif" border=0></a> <meta itemprop="ratingValue" content="4.5" /> <meta itemprop="bestRating" content="5" /> <BR><span class="bottomnavfooter"><A HREF="javascript:an();">Read (<span itemprop="ratingCount">70</span>) Reviews</A </span></div> I then created a static test page and made some change using instructions Google provided here http://www.google.com/support/webmasters/bin/answer.py?answer=172705 (which is different from what I found on schema.org!!) but still the test returned only product name not the price or the reviews. Here is my test page - Can you please see where I'm going wrong Thanks much!!

    Read the article

  • Change virtual QEMU image location

    - by dallasclark
    I've got an existing QEMU Virtual Server running on Fedora 11. Having troubles trying to find out how to change the location of where the Virtual Images are stored. Can anybody provide any help please? Thanks in advance! I'm also new to Linux Server Administration - n00b in other words - so this might seem lazy but I need to know commands or where to look

    Read the article

  • CSS background image being downloaded more than once

    - by Nick Clarke
    I noticed in my current project that Firefox (3.5.4) downloads the background image (set in CSS) for my divs more than once. I've checked with both firebug and wireshark and it really does appear that it does not wait for the first request to finish and then simply use the cached version. Wireshark also confirms that Chrome and IE8 do as expected and only request the image once. Any ideas what might be causing this? Here is a small test: Sample Page or <html> <head> <style> #one { height: 300px; width:100%; background: #FFF url('random.jpg'); } #two { height: 300px; width:100%; background: #FFF url('random.jpg'); } #three { height: 300px; width:100%; background: #FFF url('random.jpg'); } </style> </head> <body> <div id="one"></div> <div id="two"></div> <div id="three"></div> </body> EDIT I opened up a bug request as I could not find one already on bugzilla, but it turns out to be an old bug with 3.5. https://bugzilla.mozilla.org/show_bug.cgi?id=497665

    Read the article

  • browser blocking image download when nginx was placed infront of apache to serve static content

    - by railscoder
    I was tying to place nginx infront of apache to server static content. This set up was performing better than just having apache. but suddenly some change caused images getting blocked for like 2-3sec before actually downloading with apache+nginx setup. It doesnt happen with apache only set up? Any idea why it is happening with nginx? this was happening even i removed all external js from the page

    Read the article

  • newbie: how to upload images from a form with PHP and mySQL

    - by paracaudex
    I'm creating a web app (locally, so security doesn't matter) in PHP where the user uploads a set of information and a small .jpeg, which is then inserted into a mySQL table. I can do this no problem with all the text data, but I'm not sure how to cause the image to upload alongside it. I assume I will have to use the blob data type and input type="file", but I fooled around with that a little bit and the solution doesn't seem to be an intuitive extension of how input type="text" works. Do I need to do a lot more PHP scripting to get this to work? Is it possible to upload an image with a form, or is there a necessary intermediate step?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Hosting solution for images for website written in PHP

    - by tomaszs
    I've written a website in PHP and it will have ability for users to upload images. My website will have more than 100.000 users. Aprox. 1k users will upload image about 50 KB. And every image will be displayed on this website 5k times so it's transfer of: 1k x 50 KB x 5k = 250 GB per month. So my question is: Do you know any good solution (hosting or CDN network or else) that: will be payed for transfer not space used and no entrance fee will have API to upload images easily with PHP is extremely easy to use will be good for low budget will not require any special, complicated registration and formal things will allow commercial use will allow using this images in website layout ?

    Read the article

  • multiple keys and values with google-collections

    - by flash3000
    Hello, I would like use google-collection in order to save the following file in a Hash with multiple keys and values Key1_1, Key2_1, Key3_1, data1_1, 0, 0 Key1_2, Key2_2, Key3_2, data1_2, 0, 0 Key1_3, Key2_3, Key3_3, data1_3, 0, 0 Key1_4, Key2_4, Key3_4, data1_4, 0, 0 The first three columns are the different keys and the last two integer are the two different values. I have already prepare a code which spilt the lines in chunks. import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; public class HashMapKey { public static void main(String[] args) throws FileNotFoundException, IOException { String inputFile = "inputData.txt"; BufferedReader br = new BufferedReader(new FileReader(inputFile)); String strLine; while ((strLine = br.readLine()) != null) { String[] line = strLine.replaceAll(" ", "").trim().split(","); for (int i = 0; i < line.length; i++) { System.out.print("[" + line[i] + "]"); } System.out.println(); } } } Unfortunately, I do not know how to save these information in google-collection? Thank you in advance. Best regards,

    Read the article

  • jquery image hover popup cant detect browser edge and change its direction

    - by Salman
    hi guys i am trying to implement jquery image hover popup but facing a problem when the popup is closer to browser edge it goes beyond its edge i want it to change its direction when it finds that space is not enough to show that popup, i have see this effect in many plugins where popups, tooltips and drop down menus change their direction if they are close to browser window edge can any one guide me in right direction here is the screen shot for reference http://img512.imageshack.us/img512/4990/browseredge.png here is the jquery hover code function imagePreview(){ /* CONFIG */ xOffset = 10; yOffset = 30; // these 2 variable determine popup's distance from the cursor // you might want to adjust to get the right result /* END CONFIG */ $("a.preview").hover(function(e){ this.t = this.title; this.title = ""; var c = (this.t != "") ? "<br>" + this.t : ""; var newName = this.name; //console.log(this.name); newName=newName.replace("/l/","/o/"); //console.log(newName); $("body").append("<p id='preview'><img src='"+ this.name +"' alt='Image preview' style='margin-bottom:5px;'>"+ c +"</p>"); $("#preview img").error(function () { $("#preview img").attr("src" ,newName).css({'width': '400px', 'height': 'auto'}); }); $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px") .fadeIn("fast"); }, function(){ this.title = this.t; $("#preview").remove(); }); $("a.preview").mousemove(function(e){ $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px"); }); }; any help will be appriciated Thanks Salman

    Read the article

  • Printing images in Flex

    - by TERACytE
    In s Flex 3 app, I have canvas with a PNG image for a background. The image is the same width & height as the canvas. I also have some other controls in the canvas: <mx:Canvas id="form" backgroundImage="@Embed(source='images/formBkg.png')" width="640" height="480" > <mx:label .../> <mx:label .../> I print the canvas using the following code: var printJob:FlexPrintJob = new FlexPrintJob(); if (printJob.start()) { printJob.addObject(form, FlexPrintJobScaleType.SHOW_ALL); printJob.send(); } On screen it looks great, but when I print it the quality of the png degrades. It is not terrible, but not as sharp as what is shown on screen. Is there anything I can do to improve the quality of the printed png?

    Read the article

< Previous Page | 508 509 510 511 512 513 514 515 516 517 518 519  | Next Page >