Search Results

Search found 2692 results on 108 pages for 'ts gateway'.

Page 63/108 | < Previous Page | 59 60 61 62 63 64 65 66 67 68 69 70  | Next Page >

  • Convert local time (10 digit number) to a readable datetime format

    - by djerry
    Hey all, I'm working with pbx for voip calls. One aspect of pbx is that you can choose to receive CDR packages. Those packages have 2 timestamps : "utc" and "local", but both seem to always be the same. Here's an example of a timestamp : "1268927156". At first sight, there seems to be no logic in it. So i tried converting it several ways, but with no good result. That value should provide a time around 11am (+1GMT) today. Things i tried: Datetime dt = new Datetime(number); Timespan ts = new Timespan(number); DateTime utc = new DateTime(number + 504911232000000000, DateTimeKind.Utc) and some others i can't remember right now. Am i missing something stupid here? Thanks in advance

    Read the article

  • Internet Explorer visual element stacking issue

    - by Michael
    Gday All, I know this issue is well known, however I have searched high and low for a solution to no avail. I have created a menu system using nested ordered lists where the menu functionality is controlled by CSS and Jquery. The menu works perfectly in FF, Chrome, Opera and Epiphany. However in IE 6/7/8 my popup menu is being displayed underneath a table. See the image below. The very top box is a div element containing my menu system. I am working with legacy code that uses tables for display so the next box and the "ts found. Try a different subcate" text is in a "td" element of a table. I have tried to force the table to have a lower z-index but this does not work. Any insights into why this is only present in IE would be appreciated. Cheers, Michael

    Read the article

  • How do you measure latency in low-latency environments?

    - by Ajaxx
    Here's the setup... Your system is receiving a stream of data that contains discrete messages (usually between 32-128 bytes per message). As part of your processing pipeline, each message passes through two physically separate applications which exchange the data using a low-latency approach (such as messaging over UDP) or RDMA and finally to a client via the same mechanism. Assuming you can inject yourself at any level, including wire protocol analysis, what tools and/or techniques would you use to measure the latency of your system. As part of this, I'm assuming that every message that is delivered to the system results in a corresponding (though not equivalent) message being pushed through the system and delivered to the client. The only tool that I've seen on the market like this is TS-Associates TipOff. I'm sure that with the right access you could probably measure the same information using a wire analysis tool (ala wireshark) and the right dissectors, but is this the right approach or are there any commodity solutions that I can use?

    Read the article

  • Typescript + requirejs: How to handle circular dependencies?

    - by Aymeric Gaurat-Apelli
    I am in the process of porting my JS+requirejs code to typescript+requirejs. One scenario I haven't found how to handle is circular dependencies. Require.js returns undefined on modules that are also dependent on the current and to solve this problem you can do: MyClass.js define(["Modules/dataModel"], function(dataModel){ return function(){ dataModel = require("Modules/dataModel"); ... } }); Now in typescript, I have: MyClass.ts import dataModel = require("Modules/dataModel"); class MyClass { dataModel: any; constructor(){ this.dataModel = require("Modules/dataModel"); // <- this kind of works but I lose typechecking ... } } How to call require a second time and yet keep the type checking benefits of typescript? dataModel is a module { ... }

    Read the article

  • How do I set the user's locale on a JSP

    - by ebynum
    I have a .jsp page that the user loads directly. The request it with a URL like the following: http://www.example.com/myfile.jsp?country=CA&language=fr In the JSP, I pull the URL GET parameters and attempt to set the locale using them as follows: <% String myLanguage = request.getParameter("language"); String myCountry = request.getParameter("country"); Locale myLocale = new Locale(myLanguage, myCountry); pageContext.setAttribute("myLocale", myLocale, PageContext.PAGE_SCOPE); %> <fmt:setLocale value="${myLocale}" scope="page" /> There are several places in the JSP that then display a message pulled from a localized resource bundle using <bean:message bundle="ts" key="..." /> from Struts. On the first request for this page (after changing the language in the URL), it is returned in US English (the default Locale), and then subsequent refreshes will return the properly localized content.

    Read the article

  • How to block the possibility to add the same record to a SPList?

    - by truthseeker
    Hi, Is there a possibility to block chance to add the same data to SPList? I know that two records always are different regarding the ID field. I would like to validate other custom fields added previously by me, and don't allow of adding same field's value. Can anybody tell me how to implement this? I can guess that event receivers could be the answer but I couldn't find how to add a receiver to SPList. Can anybody tel me If I'm right and what is step by step procedure to add such event receiver? I would like to know how to build it and install it using Feature file. Best Regards T.S.

    Read the article

  • qmake translations doesn't seem to work

    - by gordebak
    I have a Qt app with a Czech translation. I can get my translation compiled and installed fine with the following code. But when I run the app, translation doesn't work. What am I missing? I even tried to chmod 644 to change the permissions of the translation file, but it didn't work either. Thanks in advance. TRANSLATIONS += cs_CZ.ts isEmpty(QMAKE_LRELEASE) { win32|os2:QMAKE_LRELEASE = $$[QT_INSTALL_BINS]\lrelease.exe else:QMAKE_LRELEASE = $$[QT_INSTALL_BINS]/lrelease unix { !exists($$QMAKE_LRELEASE) { QMAKE_LRELEASE = lrelease-qt4 } } else { !exists($$QMAKE_LRELEASE) { QMAKE_LRELEASE = lrelease } } } updateqm.input = TRANSLATIONS updateqm.output = qm/${QMAKE_FILE_BASE}.qm updateqm.commands = $$QMAKE_LRELEASE -silent ${QMAKE_FILE_IN} -q qm/${QMAKE_FILE_BASE}.qm updateqm.CONFIG += no_link target_predeps QMAKE_EXTRA_COMPILERS += updateqm INSTALLS += translations translations.path = /usr/share/app translations.files = qm/cs_CZ.qm

    Read the article

  • Microsoft Team System Equivalent stack.

    - by Nix
    I am looking for a free alternative to TS. What would be the best alternative stack(source control, bug tracking, project management/planning, wiki, automated builds (ci))? Keeping in mind that it would be nice if they all integrated well. For example, it would be nice to be able to link bugs to source control, and then be able to link to a project plan and then be able to automate building. I do not have issues with using Microsoft project to manage project planing. I know i would like to use these....: SVN TeamCity NUnit But i am struggling to find a good Wiki/Project Planning/Bug tracking, that would integrate well. Any questions let me know.

    Read the article

  • Ignoring characters in a file while parsing

    - by sfactor
    i need to parse through a text file and process the data. the valid data is usually denoted by either a timestamp with TS followed by 10 numbers (TS1040501134) or values with a alpabet followed by nine numbers (A098098098)...so it will be like TS1040501134A111111111B222222222...........TS1020304050A000000000........ However, there are cases when there will be filler 0s when there is no data. So, such a case might be 00000000000000000000TS1040501134A111111111B2222222220000000000TS1020304050A000000000........` Now as we can see I need to ignore these zeros. how might i do this? I am using gnu C.

    Read the article

  • Cannot eliminate canvas page in facebook app.

    - by hunterp
    Hello, I have set a canvas page, and now, my facebook app page goes to a horrible place: http://apps.facebook.com/hificorder/?ref=ts whereas it is supposed to go to: http://www.facebook.com/apps/application.php?id=123018831077733 So, set the canvas page to the latter link...right? WRONG....when you do so, it causes an error. Set the canvas page to nothing??? FB does not allow. What do I do??? FYI, when you search for "HiFiCorder" in the normal facebook search, the canvas page is what comes up...this is horrible, please help.

    Read the article

  • PrintingPermissionLevel, SafePrinting, and restrictions

    - by Steve Cooper
    There is a PrintingPermission attribute in the framework which takes a PrintingPermissionLevel enumeration with one of these values; NoPrinting: Prevents access to printers. NoPrinting is a subset of SafePrinting. SafePrinting: Provides printing only from a restricted dialog box. SafePrinting is a subset of DefaultPrinting. DefaultPrinting: Provides printing programmatically to the default printer, along with safe printing through semirestricted dialog box. DefaultPrinting is a subset of AllPrinting. AllPrinting: Provides full access to all printers. The documentation is really sparse, and I wondered if anyone can tell me more about the SafePrinting option. What does the documentation mean when it says "Provides printing only from a restricted dialog box." I have no idea what this means. Can anyone shed any light? This subject is touched in the MS certification 70-505: TS: Microsoft .NET Framework 3.5, Windows Forms Application Development and so I'm keen to find out more.

    Read the article

  • Is there a way to access a php class method using javascript through jquery?

    - by Starx
    I have a js script, which is $("#feedbacksubmit").click(function() { if($("#frmfeedback").valid()) { var tname = $("#name").val(); var temail = $("#email").val(); var tphone = $("#phone").val(); var tcontent = $("#content").val(); var tsend = $(this).attr('ts'); $.post ( "bll/index.php", { action: 'mailfeedback', name: tname, email: temail, phone: tphone, content: tcontent, send: tsend }, function(data) { $('.msgbox').html(data); $("#frmfeedback")[0].reset(); }); return false; } }); however, I am trying to see if there is a way to access the class method of bll/index.php directly from the script, instead of posting parameters, to access it

    Read the article

  • Do I need to declare all my JQuery prototypes in a JQueryStatic definition file with typescript?

    - by Marilou
    I have the following code: ///<reference path="../typescript/jquery.d.ts" /> function addThemePrototypes() { var templateSetup = new Array(); $.fn.addTemplateSetup = function(func, prioritary) { if (prioritary) { templateSetup.unshift(func); } else { templateSetup.push(func); } }; } When I try to add the following: $('a').addTemplateSetup( Into this same file I notice there is no intellisense and typescript does not seem to know about the addTemplateSetup prototype that I just added. Is this the correct way for it to work or do I always need to add things like the definition for addTemplateSetup to an JQueryStatic definition file and then include that?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • ?asting String to Time makes 01:00:00

    - by kawtousse
    Hi everyone, when i do the following: String start = request.getParameter("startp"); SimpleDateFormat sdf = new SimpleDateFormat("hh:mm:ss"); long ms=0; try { ms = sdf.parse(start).getTime(); } catch (ParseException e1) { e1.printStackTrace(); } Time ts = new Time(ms); it is inserted with this value 01:00:00 witch is not the correct one (entered by user). I didn't undertstand the error here. Please help. Thanks

    Read the article

  • DD-WRT No Internet connection over LAN

    - by algorithms
    I flashed the DD-WRT firmware on my TP-Link WR1043ND router and although after cloning the PC's MAC-Address it gets the correct IP from my ISP, the internet connection over LAN just won't work. The strange thing is it does work flawlessly over W-LAN, which tells me the problem should lie somehow in the default LAN settings or the PC. Any idea what the problem might be? UPDATE: It seems the problem is the desktop PC, since the laptop can connect to the interet via ethernet without any problems. ipconfig /all seems totally normal (dhcp, dns, gateway all set to 192.168.1.1) I already tried the following things without success: disabling firewall rebooting router/modem/pc router hard-reset resetting tcp/ip and winsock manual setting of DNS/IP/Gateway Here is the ipconfig /all: Windows-IP-Konfiguration Hostname . . . . . . . . . . . . : Nitro-PC Primäres DNS-Suffix . . . . . . . : Knotentyp . . . . . . . . . . . . : Hybrid IP-Routing aktiviert . . . . . . : Nein WINS-Proxy aktiviert . . . . . . : Nein Ethernet-Adapter LAN-Verbindung 2: Medienstatus. . . . . . . . . . . : Medium getrennt Verbindungsspezifisches DNS-Suffix: Beschreibung. . . . . . . . . . . : TAP-Win32 Adapter V9 Physikalische Adresse . . . . . . : 00-FF-56-CA-66-8D DHCP aktiviert. . . . . . . . . . : Ja Autokonfiguration aktiviert . . . : Ja Ethernet-Adapter LAN-Verbindung: Verbindungsspezifisches DNS-Suffix: Beschreibung. . . . . . . . . . . : Realtek PCIe GBE Family Controller Physikalische Adresse . . . . . . : 48-5B-39-5B-DE-17 DHCP aktiviert. . . . . . . . . . : Ja Autokonfiguration aktiviert . . . : Ja Verbindungslokale IPv6-Adresse . : fe80::6934:b121:9eab:c6ce%10(Bevorzugt) IPv4-Adresse . . . . . . . . . . : 192.168.1.18(Bevorzugt) Subnetzmaske . . . . . . . . . . : 255.255.255.0 Lease erhalten. . . . . . . . . . : Donnerstag, 30. August 2012 10:52:30 Lease läuft ab. . . . . . . . . . : Freitag, 31. August 2012 10:52:30 Standardgateway . . . . . . . . . : 192.168.1.1 DHCP-Server . . . . . . . . . . . : 192.168.1.1 DHCPv6-IAID . . . . . . . . . . . : 239622969 DHCPv6-Client-DUID. . . . . . . . : 00-01-00-01-17-43-0D-B2-48-5B-39-5B-DE-17 DNS-Server . . . . . . . . . . . : 192.168.1.1 NetBIOS über TCP/IP . . . . . . . : Aktiviert Tunneladapter isatap.{56CA668D-9112-4399-9D9A-F1D42F0E52DE}: Medienstatus. . . . . . . . . . . : Medium getrennt Verbindungsspezifisches DNS-Suffix: Beschreibung. . . . . . . . . . . : Microsoft-ISATAP-Adapter Physikalische Adresse . . . . . . : 00-00-00-00-00-00-00-E0 DHCP aktiviert. . . . . . . . . . : Nein Autokonfiguration aktiviert . . . : Ja Tunneladapter Teredo Tunneling Pseudo-Interface: Verbindungsspezifisches DNS-Suffix: Beschreibung. . . . . . . . . . . : Teredo Tunneling Pseudo-Interface Physikalische Adresse . . . . . . : 00-00-00-00-00-00-00-E0 DHCP aktiviert. . . . . . . . . . : Nein Autokonfiguration aktiviert . . . : Ja IPv6-Adresse. . . . . . . . . . . : 2001:0:5ef5:79fd:1432:3dcd:3f57:feed(Bevorzugt) Verbindungslokale IPv6-Adresse . : fe80::1432:3dcd:3f57:feed%12(Bevorzugt) Standardgateway . . . . . . . . . : :: NetBIOS über TCP/IP . . . . . . . : Deaktiviert Tunneladapter isatap.{AD21069D-D2AF-423E-BF59-0B1CD0D235E8}: Medienstatus. . . . . . . . . . . : Medium getrennt Verbindungsspezifisches DNS-Suffix: Beschreibung. . . . . . . . . . . : Microsoft-ISATAP-Adapter #2 Physikalische Adresse . . . . . . : 00-00-00-00-00-00-00-E0 DHCP aktiviert. . . . . . . . . . : Nein Autokonfiguration aktiviert . . . : Ja Tunneladapter 6TO4 Adapter: Medienstatus. . . . . . . . . . . : Medium getrennt Verbindungsspezifisches DNS-Suffix: Beschreibung. . . . . . . . . . . : Microsoft-6zu4-Adapter Physikalische Adresse . . . . . . : 00-00-00-00-00-00-00-E0 DHCP aktiviert. . . . . . . . . . : Nein Autokonfiguration aktiviert . . . : Ja route PRINT IPv4-Routentabelle =========================================================================== Aktive Routen: Netzwerkziel Netzwerkmaske Gateway Schnittstelle Metrik 0.0.0.0 0.0.0.0 192.168.1.1 192.168.1.18 10 127.0.0.0 255.0.0.0 Auf Verbindung 127.0.0.1 306 127.0.0.1 255.255.255.255 Auf Verbindung 127.0.0.1 306 127.255.255.255 255.255.255.255 Auf Verbindung 127.0.0.1 306 192.168.1.0 255.255.255.0 Auf Verbindung 192.168.1.18 266 192.168.1.18 255.255.255.255 Auf Verbindung 192.168.1.18 266 192.168.1.255 255.255.255.255 Auf Verbindung 192.168.1.18 266 224.0.0.0 240.0.0.0 Auf Verbindung 127.0.0.1 306 224.0.0.0 240.0.0.0 Auf Verbindung 192.168.1.18 266 255.255.255.255 255.255.255.255 Auf Verbindung 127.0.0.1 306 255.255.255.255 255.255.255.255 Auf Verbindung 192.168.1.18 266 =========================================================================== Stndige Routen: Keine

    Read the article

  • High CPU usage with Team Speak 3.0.0-rc2

    - by AlexTheBird
    The CPU usage is always around 40 percent. I use push-to-talk and I had uninstalled pulseaudio. Now I use Alsa. I don't even have to connect to a Server. By simply starting TS the cpu usage goes up 40 percent and stays there. The CPU usage of 3.0.0-rc1 [Build: 14468] is constantly 14 percent. This is the output of top, mpstat and ps aux while I am running TS3 ... of course: alexandros@alexandros-laptop:~$ top top - 18:20:07 up 2:22, 3 users, load average: 1.02, 0.85, 0.77 Tasks: 163 total, 1 running, 162 sleeping, 0 stopped, 0 zombie Cpu(s): 5.3%us, 1.9%sy, 0.1%ni, 91.8%id, 0.7%wa, 0.1%hi, 0.1%si, 0.0%st Mem: 2061344k total, 964028k used, 1097316k free, 69116k buffers Swap: 3997688k total, 0k used, 3997688k free, 449032k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 2714 alexandr 20 0 206m 31m 24m S 37 1.6 0:12.78 ts3client_linux 868 root 20 0 47564 27m 10m S 8 1.4 3:21.73 Xorg 1 root 20 0 2804 1660 1204 S 0 0.1 0:00.53 init 2 root 20 0 0 0 0 S 0 0.0 0:00.00 kthreadd 3 root RT 0 0 0 0 S 0 0.0 0:00.01 migration/0 4 root 20 0 0 0 0 S 0 0.0 0:00.45 ksoftirqd/0 5 root RT 0 0 0 0 S 0 0.0 0:00.00 watchdog/0 6 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/1 7 root 20 0 0 0 0 S 0 0.0 0:00.08 ksoftirqd/1 8 root RT 0 0 0 0 S 0 0.0 0:00.00 watchdog/1 9 root 20 0 0 0 0 S 0 0.0 0:01.17 events/0 10 root 20 0 0 0 0 S 0 0.0 0:00.81 events/1 11 root 20 0 0 0 0 S 0 0.0 0:00.00 cpuset 12 root 20 0 0 0 0 S 0 0.0 0:00.00 khelper 13 root 20 0 0 0 0 S 0 0.0 0:00.00 async/mgr 14 root 20 0 0 0 0 S 0 0.0 0:00.00 pm 16 root 20 0 0 0 0 S 0 0.0 0:00.00 sync_supers 17 root 20 0 0 0 0 S 0 0.0 0:00.00 bdi-default 18 root 20 0 0 0 0 S 0 0.0 0:00.00 kintegrityd/0 19 root 20 0 0 0 0 S 0 0.0 0:00.00 kintegrityd/1 20 root 20 0 0 0 0 S 0 0.0 0:00.05 kblockd/0 21 root 20 0 0 0 0 S 0 0.0 0:00.02 kblockd/1 22 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpid 23 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpi_notify 24 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpi_hotplug 25 root 20 0 0 0 0 S 0 0.0 0:00.99 ata/0 26 root 20 0 0 0 0 S 0 0.0 0:00.92 ata/1 27 root 20 0 0 0 0 S 0 0.0 0:00.00 ata_aux 28 root 20 0 0 0 0 S 0 0.0 0:00.00 ksuspend_usbd 29 root 20 0 0 0 0 S 0 0.0 0:00.00 khubd alexandros@alexandros-laptop:~$ mpstat Linux 2.6.32-32-generic (alexandros-laptop) 16.06.2011 _i686_ (2 CPU) 18:20:15 CPU %usr %nice %sys %iowait %irq %soft %steal %guest %idle 18:20:15 all 5,36 0,09 1,91 0,68 0,07 0,06 0,00 0,00 91,83 alexandros@alexandros-laptop:~$ ps aux USER PID %CPU %MEM VSZ RSS TTY STAT START TIME COMMAND root 1 0.0 0.0 2804 1660 ? Ss 15:58 0:00 /sbin/init root 2 0.0 0.0 0 0 ? S 15:58 0:00 [kthreadd] root 3 0.0 0.0 0 0 ? S 15:58 0:00 [migration/0] root 4 0.0 0.0 0 0 ? S 15:58 0:00 [ksoftirqd/0] root 5 0.0 0.0 0 0 ? S 15:58 0:00 [watchdog/0] root 6 0.0 0.0 0 0 ? S 15:58 0:00 [migration/1] root 7 0.0 0.0 0 0 ? S 15:58 0:00 [ksoftirqd/1] root 8 0.0 0.0 0 0 ? S 15:58 0:00 [watchdog/1] root 9 0.0 0.0 0 0 ? S 15:58 0:01 [events/0] root 10 0.0 0.0 0 0 ? S 15:58 0:00 [events/1] root 11 0.0 0.0 0 0 ? S 15:58 0:00 [cpuset] root 12 0.0 0.0 0 0 ? S 15:58 0:00 [khelper] root 13 0.0 0.0 0 0 ? S 15:58 0:00 [async/mgr] root 14 0.0 0.0 0 0 ? S 15:58 0:00 [pm] root 16 0.0 0.0 0 0 ? S 15:58 0:00 [sync_supers] root 17 0.0 0.0 0 0 ? S 15:58 0:00 [bdi-default] root 18 0.0 0.0 0 0 ? S 15:58 0:00 [kintegrityd/0] root 19 0.0 0.0 0 0 ? S 15:58 0:00 [kintegrityd/1] root 20 0.0 0.0 0 0 ? S 15:58 0:00 [kblockd/0] root 21 0.0 0.0 0 0 ? S 15:58 0:00 [kblockd/1] root 22 0.0 0.0 0 0 ? S 15:58 0:00 [kacpid] root 23 0.0 0.0 0 0 ? S 15:58 0:00 [kacpi_notify] root 24 0.0 0.0 0 0 ? S 15:58 0:00 [kacpi_hotplug] root 25 0.0 0.0 0 0 ? S 15:58 0:00 [ata/0] root 26 0.0 0.0 0 0 ? S 15:58 0:00 [ata/1] root 27 0.0 0.0 0 0 ? S 15:58 0:00 [ata_aux] root 28 0.0 0.0 0 0 ? S 15:58 0:00 [ksuspend_usbd] root 29 0.0 0.0 0 0 ? S 15:58 0:00 [khubd] root 30 0.0 0.0 0 0 ? S 15:58 0:00 [kseriod] root 31 0.0 0.0 0 0 ? S 15:58 0:00 [kmmcd] root 34 0.0 0.0 0 0 ? S 15:58 0:00 [khungtaskd] root 35 0.0 0.0 0 0 ? S 15:58 0:00 [kswapd0] root 36 0.0 0.0 0 0 ? SN 15:58 0:00 [ksmd] root 37 0.0 0.0 0 0 ? S 15:58 0:00 [aio/0] root 38 0.0 0.0 0 0 ? S 15:58 0:00 [aio/1] root 39 0.0 0.0 0 0 ? S 15:58 0:00 [ecryptfs-kthrea] root 40 0.0 0.0 0 0 ? S 15:58 0:00 [crypto/0] root 41 0.0 0.0 0 0 ? S 15:58 0:00 [crypto/1] root 48 0.0 0.0 0 0 ? S 15:58 0:03 [scsi_eh_0] root 50 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_1] root 53 0.0 0.0 0 0 ? S 15:58 0:00 [kstriped] root 54 0.0 0.0 0 0 ? S 15:58 0:00 [kmpathd/0] root 55 0.0 0.0 0 0 ? S 15:58 0:00 [kmpathd/1] root 56 0.0 0.0 0 0 ? S 15:58 0:00 [kmpath_handlerd] root 57 0.0 0.0 0 0 ? S 15:58 0:00 [ksnapd] root 58 0.0 0.0 0 0 ? S 15:58 0:03 [kondemand/0] root 59 0.0 0.0 0 0 ? S 15:58 0:02 [kondemand/1] root 60 0.0 0.0 0 0 ? S 15:58 0:00 [kconservative/0] root 61 0.0 0.0 0 0 ? S 15:58 0:00 [kconservative/1] root 213 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_2] root 222 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_3] root 234 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_4] root 235 0.0 0.0 0 0 ? S 15:58 0:01 [usb-storage] root 255 0.0 0.0 0 0 ? S 15:58 0:00 [jbd2/sda5-8] root 256 0.0 0.0 0 0 ? S 15:58 0:00 [ext4-dio-unwrit] root 257 0.0 0.0 0 0 ? S 15:58 0:00 [ext4-dio-unwrit] root 290 0.0 0.0 0 0 ? S 15:58 0:00 [flush-8:0] root 318 0.0 0.0 2316 888 ? S 15:58 0:00 upstart-udev-bridge --daemon root 321 0.0 0.0 2616 1024 ? S<s 15:58 0:00 udevd --daemon root 526 0.0 0.0 0 0 ? S 15:58 0:00 [kpsmoused] root 528 0.0 0.0 0 0 ? S 15:58 0:00 [led_workqueue] root 650 0.0 0.0 0 0 ? S 15:58 0:00 [radeon/0] root 651 0.0 0.0 0 0 ? S 15:58 0:00 [radeon/1] root 652 0.0 0.0 0 0 ? S 15:58 0:00 [ttm_swap] root 654 0.0 0.0 2612 984 ? S< 15:58 0:00 udevd --daemon root 656 0.0 0.0 0 0 ? S 15:58 0:00 [hd-audio0] root 657 0.0 0.0 2612 916 ? S< 15:58 0:00 udevd --daemon root 674 0.6 0.0 0 0 ? S 15:58 0:57 [phy0] syslog 715 0.0 0.0 34812 1776 ? Sl 15:58 0:00 rsyslogd -c4 102 731 0.0 0.0 3236 1512 ? Ss 15:58 0:02 dbus-daemon --system --fork root 740 0.0 0.1 19088 3380 ? Ssl 15:58 0:00 gdm-binary root 744 0.0 0.1 18900 4032 ? Ssl 15:58 0:01 NetworkManager avahi 749 0.0 0.0 2928 1520 ? S 15:58 0:00 avahi-daemon: running [alexandros-laptop.local] avahi 752 0.0 0.0 2928 544 ? Ss 15:58 0:00 avahi-daemon: chroot helper root 753 0.0 0.1 4172 2300 ? S 15:58 0:00 /usr/sbin/modem-manager root 762 0.0 0.1 20584 3152 ? Sl 15:58 0:00 /usr/sbin/console-kit-daemon --no-daemon root 836 0.0 0.1 20856 3864 ? Sl 15:58 0:00 /usr/lib/gdm/gdm-simple-slave --display-id /org/gnome/DisplayManager/Display1 root 856 0.0 0.1 4836 2388 ? S 15:58 0:00 /sbin/wpa_supplicant -u -s root 868 2.3 1.3 36932 27924 tty7 Rs+ 15:58 3:22 /usr/bin/X :0 -nr -verbose -auth /var/run/gdm/auth-for-gdm-a46T4j/database -nolisten root 891 0.0 0.0 1792 564 tty4 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty4 root 901 0.0 0.0 1792 564 tty5 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty5 root 908 0.0 0.0 1792 564 tty2 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty2 root 910 0.0 0.0 1792 568 tty3 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty3 root 913 0.0 0.0 1792 564 tty6 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty6 root 917 0.0 0.0 2180 1072 ? Ss 15:58 0:00 acpid -c /etc/acpi/events -s /var/run/acpid.socket daemon 924 0.0 0.0 2248 432 ? Ss 15:58 0:00 atd root 927 0.0 0.0 2376 900 ? Ss 15:58 0:00 cron root 950 0.0 0.0 11736 1372 ? Ss 15:58 0:00 /usr/sbin/winbindd root 958 0.0 0.0 11736 1184 ? S 15:58 0:00 /usr/sbin/winbindd root 974 0.0 0.1 6832 2580 ? Ss 15:58 0:00 /usr/sbin/cupsd -C /etc/cups/cupsd.conf root 1078 0.0 0.0 1792 564 tty1 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty1 gdm 1097 0.0 0.0 3392 772 ? S 15:58 0:00 /usr/bin/dbus-launch --exit-with-session root 1112 0.0 0.1 19216 3292 ? Sl 15:58 0:00 /usr/lib/gdm/gdm-session-worker root 1116 0.0 0.1 5540 2932 ? S 15:58 0:01 /usr/lib/upower/upowerd root 1131 0.0 0.1 6308 3824 ? S 15:58 0:00 /usr/lib/policykit-1/polkitd 108 1163 0.0 0.2 16788 4360 ? Ssl 15:58 0:01 /usr/sbin/hald root 1164 0.0 0.0 3536 1300 ? S 15:58 0:00 hald-runner root 1188 0.0 0.0 3612 1256 ? S 15:58 0:00 hald-addon-input: Listening on /dev/input/event6 /dev/input/event5 /dev/input/event2 root 1194 0.0 0.0 3612 1224 ? S 15:58 0:00 /usr/lib/hal/hald-addon-rfkill-killswitch root 1200 0.0 0.0 3608 1240 ? S 15:58 0:00 /usr/lib/hal/hald-addon-generic-backlight root 1202 0.0 0.0 3616 1236 ? S 15:58 0:02 hald-addon-storage: polling /dev/sr0 (every 2 sec) root 1204 0.0 0.0 3616 1236 ? S 15:58 0:00 hald-addon-storage: polling /dev/sdb (every 2 sec) root 1211 0.0 0.0 3624 1220 ? S 15:58 0:00 /usr/lib/hal/hald-addon-cpufreq 108 1212 0.0 0.0 3420 1200 ? S 15:58 0:00 hald-addon-acpi: listening on acpid socket /var/run/acpid.socket 1000 1222 0.0 0.1 24196 2816 ? Sl 15:58 0:00 /usr/bin/gnome-keyring-daemon --daemonize --login 1000 1240 0.0 0.3 28228 7312 ? Ssl 15:58 0:00 gnome-session 1000 1274 0.0 0.0 3284 356 ? Ss 15:58 0:00 /usr/bin/ssh-agent /usr/bin/dbus-launch --exit-with-session gnome-session 1000 1277 0.0 0.0 3392 772 ? S 15:58 0:00 /usr/bin/dbus-launch --exit-with-session gnome-session 1000 1278 0.0 0.0 3160 1652 ? Ss 15:58 0:00 /bin/dbus-daemon --fork --print-pid 5 --print-address 7 --session 1000 1281 0.0 0.2 8172 4636 ? S 15:58 0:00 /usr/lib/libgconf2-4/gconfd-2 1000 1287 0.0 0.5 24228 10896 ? Ss 15:58 0:03 /usr/lib/gnome-settings-daemon/gnome-settings-daemon 1000 1290 0.0 0.1 6468 2364 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd 1000 1293 0.0 0.6 38104 13004 ? S 15:58 0:03 metacity 1000 1296 0.0 0.1 30280 2628 ? Ssl 15:58 0:00 /usr/lib/gvfs//gvfs-fuse-daemon /home/alexandros/.gvfs 1000 1301 0.0 0.0 3344 988 ? S 15:58 0:03 syndaemon -i 0.5 -k 1000 1303 0.0 0.1 8060 3488 ? S 15:58 0:00 /usr/lib/gvfs/gvfs-gdu-volume-monitor root 1306 0.0 0.1 15692 3104 ? Sl 15:58 0:00 /usr/lib/udisks/udisks-daemon 1000 1307 0.4 1.0 50748 21684 ? S 15:58 0:34 python -u /usr/share/screenlets/DigiClock/DigiClockScreenlet.py 1000 1308 0.0 0.9 35608 18564 ? S 15:58 0:00 python /usr/share/screenlets-manager/screenlets-daemon.py 1000 1309 0.0 0.3 19524 6468 ? S 15:58 0:00 /usr/lib/policykit-1-gnome/polkit-gnome-authentication-agent-1 1000 1311 0.0 0.5 37412 11788 ? S 15:58 0:01 gnome-power-manager 1000 1312 0.0 1.0 50772 22628 ? S 15:58 0:03 gnome-panel 1000 1313 0.1 1.5 102648 31184 ? Sl 15:58 0:10 nautilus root 1314 0.0 0.0 5188 996 ? S 15:58 0:02 udisks-daemon: polling /dev/sdb /dev/sr0 1000 1315 0.0 0.6 51948 12464 ? SL 15:58 0:01 nm-applet --sm-disable 1000 1317 0.0 0.1 16956 2364 ? Sl 15:58 0:00 /usr/lib/gvfs/gvfs-afc-volume-monitor 1000 1318 0.0 0.3 20164 7792 ? S 15:58 0:00 bluetooth-applet 1000 1321 0.0 0.1 7260 2384 ? S 15:58 0:00 /usr/lib/gvfs/gvfs-gphoto2-volume-monitor 1000 1323 0.0 0.5 37436 12124 ? S 15:58 0:00 /usr/lib/notify-osd/notify-osd 1000 1324 0.0 1.9 197928 40456 ? Ssl 15:58 0:06 /home/alexandros/.dropbox-dist/dropbox 1000 1329 0.0 0.3 20136 7968 ? S 15:58 0:00 /usr/bin/gnome-screensaver --no-daemon 1000 1331 0.0 0.1 7056 3112 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd-trash --spawner :1.6 /org/gtk/gvfs/exec_spaw/0 root 1340 0.0 0.0 2236 1008 ? S 15:58 0:00 /sbin/dhclient -d -sf /usr/lib/NetworkManager/nm-dhcp-client.action -pf /var/run/dhcl 1000 1348 0.0 0.1 42252 3680 ? Ssl 15:58 0:00 /usr/lib/bonobo-activation/bonobo-activation-server --ac-activate --ior-output-fd=19 1000 1384 0.0 1.7 80244 35480 ? Sl 15:58 0:02 /usr/bin/python /usr/lib/deskbar-applet/deskbar-applet/deskbar-applet --oaf-activate- 1000 1388 0.0 0.5 26196 11804 ? S 15:58 0:01 /usr/lib/gnome-panel/wnck-applet --oaf-activate-iid=OAFIID:GNOME_Wncklet_Factory --oa 1000 1393 0.1 0.5 25876 11548 ? S 15:58 0:08 /usr/lib/gnome-applets/multiload-applet-2 --oaf-activate-iid=OAFIID:GNOME_MultiLoadAp 1000 1394 0.0 0.5 25600 11140 ? S 15:58 0:03 /usr/lib/gnome-applets/cpufreq-applet --oaf-activate-iid=OAFIID:GNOME_CPUFreqApplet_F 1000 1415 0.0 0.5 39192 11156 ? S 15:58 0:01 /usr/lib/gnome-power-manager/gnome-inhibit-applet --oaf-activate-iid=OAFIID:GNOME_Inh 1000 1417 0.0 0.7 53544 15488 ? Sl 15:58 0:00 /usr/lib/gnome-applets/mixer_applet2 --oaf-activate-iid=OAFIID:GNOME_MixerApplet_Fact 1000 1419 0.0 0.4 23816 9068 ? S 15:58 0:00 /usr/lib/gnome-panel/notification-area-applet --oaf-activate-iid=OAFIID:GNOME_Notific 1000 1488 0.0 0.3 20964 7548 ? S 15:58 0:00 /usr/lib/gnome-disk-utility/gdu-notification-daemon 1000 1490 0.0 0.1 6608 2484 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd-burn --spawner :1.6 /org/gtk/gvfs/exec_spaw/1 1000 1510 0.0 0.1 6348 2084 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd-metadata 1000 1531 0.0 0.3 19472 6616 ? S 15:58 0:00 /usr/lib/gnome-user-share/gnome-user-share 1000 1535 0.0 0.4 77128 8392 ? Sl 15:58 0:00 /usr/lib/evolution/evolution-data-server-2.28 --oaf-activate-iid=OAFIID:GNOME_Evoluti 1000 1601 0.0 0.5 69576 11800 ? Sl 15:59 0:00 /usr/lib/evolution/2.28/evolution-alarm-notify 1000 1604 0.0 0.7 33924 15888 ? S 15:59 0:00 python /usr/share/system-config-printer/applet.py 1000 1701 0.0 0.5 37116 11968 ? S 15:59 0:00 update-notifier 1000 1892 4.5 7.0 406720 145312 ? Sl 17:11 3:09 /opt/google/chrome/chrome 1000 1896 0.0 0.1 69812 3680 ? S 17:11 0:02 /opt/google/chrome/chrome 1000 1898 0.0 0.6 91420 14080 ? S 17:11 0:00 /opt/google/chrome/chrome --type=zygote 1000 1916 0.2 1.3 140780 27220 ? Sl 17:11 0:12 /opt/google/chrome/chrome --type=extension --disable-client-side-phishing-detection - 1000 1918 0.7 1.8 155720 37912 ? Sl 17:11 0:31 /opt/google/chrome/chrome --type=extension --disable-client-side-phishing-detection - 1000 1921 0.0 1.0 135904 21052 ? Sl 17:11 0:02 /opt/google/chrome/chrome --type=extension --disable-client-side-phishing-detection - 1000 1927 6.5 3.6 194604 74960 ? Sl 17:11 4:32 /opt/google/chrome/chrome --type=renderer --disable-client-side-phishing-detection -- 1000 2156 0.4 0.7 48344 14896 ? Rl 18:03 0:04 gnome-terminal 1000 2157 0.0 0.0 1988 712 ? S 18:03 0:00 gnome-pty-helper 1000 2158 0.0 0.1 6504 3860 pts/0 Ss 18:03 0:00 bash 1000 2564 0.2 0.1 6624 3984 pts/1 Ss+ 18:17 0:00 bash 1000 2711 0.0 0.0 4208 1352 ? S 18:19 0:00 /bin/bash /home/alexandros/Programme/TeamSpeak3-Client-linux_x86_back/ts3client_runsc 1000 2714 36.5 1.5 210872 31960 ? SLl 18:19 0:18 ./ts3client_linux_x86 1000 2743 0.0 0.0 2716 1068 pts/0 R+ 18:20 0:00 ps aux Output of vmstat: alexandros@alexandros-laptop:~$ vmstat procs -----------memory---------- ---swap-- -----io---- -system-- ----cpu---- r b swpd free buff cache si so bi bo in cs us sy id wa 0 0 0 1093324 69840 449496 0 0 27 10 476 667 6 2 91 1 Output of lsusb alexandros@alexandros-laptop:~$ lspci 00:00.0 Host bridge: Silicon Integrated Systems [SiS] 671MX 00:01.0 PCI bridge: Silicon Integrated Systems [SiS] PCI-to-PCI bridge 00:02.0 ISA bridge: Silicon Integrated Systems [SiS] SiS968 [MuTIOL Media IO] (rev 01) 00:02.5 IDE interface: Silicon Integrated Systems [SiS] 5513 [IDE] (rev 01) 00:03.0 USB Controller: Silicon Integrated Systems [SiS] USB 1.1 Controller (rev 0f) 00:03.1 USB Controller: Silicon Integrated Systems [SiS] USB 1.1 Controller (rev 0f) 00:03.3 USB Controller: Silicon Integrated Systems [SiS] USB 2.0 Controller 00:05.0 IDE interface: Silicon Integrated Systems [SiS] SATA Controller / IDE mode (rev 03) 00:06.0 PCI bridge: Silicon Integrated Systems [SiS] PCI-to-PCI bridge 00:07.0 PCI bridge: Silicon Integrated Systems [SiS] PCI-to-PCI bridge 00:0d.0 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL-8139/8139C/8139C+ (rev 10) 00:0f.0 Audio device: Silicon Integrated Systems [SiS] Azalia Audio Controller 01:00.0 VGA compatible controller: ATI Technologies Inc Mobility Radeon X2300 02:00.0 Ethernet controller: Atheros Communications Inc. AR5001 Wireless Network Adapter (rev 01) The Team Speak log file : 2011-06-19 19:04:04.223522|INFO | | | Logging started, clientlib version: 3.0.0-rc2 [Build: 14642] 2011-06-19 19:04:04.761149|ERROR |SoundBckndIntf| | /home/alexandros/Programme/TeamSpeak3-Client-linux_x86_back/soundbackends/libpulseaudio_linux_x86.so error: NOT_CONNECTED 2011-06-19 19:04:05.871770|INFO |ClientUI | | Failed to init text to speech engine 2011-06-19 19:04:05.894623|INFO |ClientUI | | TeamSpeak 3 client version: 3.0.0-rc2 [Build: 14642] 2011-06-19 19:04:05.895421|INFO |ClientUI | | Qt version: 4.7.2 2011-06-19 19:04:05.895571|INFO |ClientUI | | Using configuration location: /home/alexandros/.ts3client/ts3clientui_qt.conf 2011-06-19 19:04:06.559596|INFO |ClientUI | | Last update check was: Sa. Jun 18 00:08:43 2011 2011-06-19 19:04:06.560506|INFO | | | Checking for updates... 2011-06-19 19:04:07.357869|INFO | | | Update check, my version: 14642, latest version: 14642 2011-06-19 19:05:52.978481|INFO |PreProSpeex | 1| Speex version: 1.2rc1 2011-06-19 19:05:54.055347|INFO |UIHelpers | | setClientVolumeModifier: 10 -8 2011-06-19 19:05:54.057196|INFO |UIHelpers | | setClientVolumeModifier: 11 2 Thanks for taking the time to read my message. UPDATE: Thanks to nickguletskii's link I googled for "alsa cpu usage" (without quotes) and it brought me to a forum. A user wrote that by directly selecting the hardware with "plughw:x.x" won't impact the performance of the system. I have selected it in the TS 3 configuration and it worked. But this solution is not optimal because now no other program can access the sound output. If you need any further information or my question is unclear than please tell me.

    Read the article

  • Apache - create multiple aliases

    - by mc3mcintyre
    I'm trying to setup two websites on my Apache server. One is www.domain.com and the other is test.domain.com. Currently, my 000-default.conf file reads as follows: <VirtualHost www:80> # The ServerName directive sets the request scheme, hostname and port that # the server uses to identify itself. This is used when creating # redirection URLs. In the context of virtual hosts, the ServerName # specifies what hostname must appear in the request's Host: header to # match this virtual host. For the default virtual host (this file) this # value is not decisive as it is used as a last resort host regardless. # However, you must set it for any further virtual host explicitly. #ServerName www.domain.com #ServerAlias www ServerAdmin [email protected] DocumentRoot /var/www/domain.com/ # Available loglevels: trace8, ..., trace1, debug, info, notice, warn, # error, crit, alert, emerg. # It is also possible to configure the loglevel for particular # modules, e.g. #LogLevel info ssl:warn ErrorLog ${APACHE_LOG_DIR}/domain.error.log CustomLog ${APACHE_LOG_DIR}/domain.access.log combined UseCanonicalName on allow from all Options +Indexes # For most configuration files from conf-available/, which are # enabled or disabled at a global level, it is possible to # include a line for only one particular virtual host. For example the # following line enables the CGI configuration for this host only # after it has been globally disabled with "a2disconf". #Include conf-available/serve-cgi-bin.conf </VirtualHost> <VirtualHost test:80> DocumentRoot "/var/www/domain.com/test/" ServerName test.domain.com ServerAdmin [email protected] ErrorLog ${APACHE_LOG_DIR}/test.domain.error.log CustomLog ${APACHE_LOG_DIR}/test.domain.access.log combined UseCanonicalName on allow from all Options +Indexes </VirtualHost> # vim: syntax=apache ts=4 sw=4 sts=4 sr noet As is, when I use a browser to go to the www location, it show me a directory listing. However, if I remove the www:80 on Line 1 and replace it with *:80, it correctly displays the webpage. I don't understand why. Can anyone help me configure this 000-default.conf file so that www goes to "/var/www/domain.com" and that test goes to "/var/www/domain.com/test"? Thank you.

    Read the article

  • Application stuck in TCP retransmit

    - by SandeepJ
    I am running Linux kernel 3.13 (Ubuntu 14.04) on two Virtual Machines each of which operates inside two different servers running ESXi 5.1. There is a zeromq client-server application running between the two VMs. After running for about 10-30 minutes, this application consistently hangs due to inability to retransmit a lost packet. When I run the same setup over Ubuntu 12.04 (Linux 3.11), the application never fails If you notice below, "ss" (socket statistics) shows 1 packet lost, sk_wmem_queued of 14110 (i.e. w14110) and a high rto (120000). State Recv-Q Send-Q Local Address:Port Peer Address:Port ESTAB 0 12350 192.168.2.122:41808 192.168.2.172:55550 timer:(on,16sec,10) uid:1000 ino:35042 sk:ffff880035bcb100 <- skmem:(r0,rb648720,t0,tb1164800,f2274,w14110,o0,bl0) ts sack cubic wscale:7,7 rto:120000 rtt:7.5/3 ato:40 mss:8948 cwnd:1 ssthresh:21 send 9.5Mbps unacked:1 retrans:1/10 lost:1 rcv_rtt:1476 rcv_space:37621 Since this has happened so consistently, I was able to capture the TCP log in wireshark. I found that the packet which is lost does get retransmitted and even acknowledged by the TCP in the other OS (the sequence number is seen in the ACK), but the sender doesn't seem to understand this ACK and continues retransmitting. MTU is 9000 on both virtual machines and througout the route. The packets being sent are large in size. As I said earlier, this does not happen on Ubuntu 12.04 (kernel 3.11). So I did a diff on the TCP config options (seen via "sysctl -a |grep tcp ") between 14.04 and 12.04 and found the following differences. I also noticed that net.ipv4.tcp_mtu_probing=0 in both configurations. Left side is 3.11, right side is 3.13 <<net.ipv4.tcp_abc = 0 <<net.ipv4.tcp_cookie_size = 0 <<net.ipv4.tcp_dma_copybreak = 4096 14c11 << net.ipv4.tcp_early_retrans = 2 --- >> net.ipv4.tcp_early_retrans = 3 17c14 << net.ipv4.tcp_fastopen = 0 >> net.ipv4.tcp_fastopen = 1 20d16 << net.ipv4.tcp_frto_response = 0 26,27c22 << net.ipv4.tcp_max_orphans = 16384 << net.ipv4.tcp_max_ssthresh = 0 >> net.ipv4.tcp_max_orphans = 4096 29,30c24,25 << net.ipv4.tcp_max_tw_buckets = 16384 << net.ipv4.tcp_mem = 94377 125837 188754 >> net.ipv4.tcp_max_tw_buckets = 4096 >> net.ipv4.tcp_mem = 23352 31138 46704 34a30 >> net.ipv4.tcp_notsent_lowat = -1 My question to the networking experts on this forum : Are there any other debugging tools or options I can install/enable to dig further into why this TCP retransmit failure is occurring so consistently ? Are there any configuration changes which might account for this weird behaviour.

    Read the article

  • Using a Dell DRAC virtual console through a NAT firewall

    - by jetboy
    I have two Dell Poweredge R210 servers, both running Ubuntu 10 Server x64. Server A has a Dell DRAC ILO card (on 172.16.96.91), and both the server and the DRAC use Server B as a gateway (with server B's WAN IP being xxx.xxx.xxx.xx). Server B uses the following NAT rules in IPTables to route traffic through to Server A's DRAC: *NAT --append PREROUTING --in-interface eth1 --protocol tcp --destination xxx.xxx.xxx.xx --destination-port 8019 --jump DNAT --to-destination 172.16.96.91:443 --append POSTROUTING --out-interface eth1 --jump SNAT --to-source xxx.xxx.xxx.xx This works fine for accessing Server A's DRAC via Server B, apart from the Java virtual console. This fails with the following error: com.sun.deploy.net.FailedDownloadException: Unable to load resource: https://xxx.xxx.xxx.xx:443/software/avctKVM.jar at com.sun.deploy.net.DownloadEngine.actionDownload(Unknown Source) etc. I know that the Java console uses port 5900, and possibly ports 83 and 5891. Can anyone help me in getting this working?

    Read the article

  • why is port 500 in use and how can I free it? VPNC error

    - by kirill_igum
    i tried to use network manager to connect to my university's vpn; it didn't work. then i used a command line vpnc: > sudo vpnc [sudo] password for kirill: Enter IPSec gateway address: vpn.net.**.edu Enter IPSec ID for vpn.net.**.edu: ** Enter IPSec secret for **@vpn.net.**.edu: Enter username for vpn.net.**.edu: ** Enter password for **@vpn.net.**.edu: vpnc: Error binding to source port. Try '--local-port 0' Failed to bind to 0.0.0.0:500: Address already in use then i did this: sudo vpnc --local-port 0 with the same config and it all worked. i'd like to be able to use network manager gui to connect to vpn. I wanted to find out which program uses the port 500: > sudo netstat -a |grep 500 tcp 0 0 *:17500 *:* LISTEN udp 0 0 *:4500 *:* udp 0 0 *:17500 *:* unix 3 [ ] STREAM CONNECTED 63500 unix 3 [ ] STREAM CONNECTED 12500 @/tmp/.X11-unix/X0 there is nothing that uses 500 i'm using ubuntu 10.10 on thinkpad x201t

    Read the article

  • Static IP settings on Windows 2003 server not getting saved

    - by Prashant Mandhare
    We have a Dell PowerEgde 1950 server with Broadcom NetXtreme gigabit ethernet card, and we are facing a strange problem with static IP assignment. When we assign a static IP to this broadcom NIC, settings are not getting saved. Following are the steps to reproduce problem open TCP/IP properties window for broadcom NIC manually enter static IP address and other details like gateway, DNS, etc. apply and close properties dialog. re-open TCP/IP properties windows, you will see your static IP settings lost and changed to "obtain IP address manually" but when checked using ipconfig command, you will still see your same static IP settings but, when checked using ipconfig command after rebooting server, these static ip settings are completely gone and automatically obtained IP is assigned Supplementary information: Recently we had formatted this server and installed windows 2003 from OEM windows setup CD (not from OS installation CD received from Dell). After windows installation was over, broadcom NIC drivers were installed.

    Read the article

  • WDS "No response" only when notify and wait for approval

    - by Cylindric
    I have a WDS server setup for use with MDT2010, and everything was working fine until this morning. Now, whenever I try to boot from LAN, I get an error: Downloaded WDSNBP... Architecture: x64 WDSNBP started using DHCP Referral. Contacting Server: 10.50.10.12 (Gateway: 0.0.0.0) No response from Windows Deployment Services server. Launching pxeboot.com My PXE Response Policy setting on the WDS is set to this: [ ] Do not respond to any client computer [ ] Respond only to known client computers [o] Respond to all (known and unknown) client computers [X] For unknown clients, notify administrator and respond after approval The odd thing is that if I clear the approval option (so any computer gets a response) it works fine. I have delegated permissions on the AD OU to the computer object WDS is running on, but that doesn't seem to have helped. As it works without approval, I can only assume my DHCP options are fine and this is some sort of AD permission problem. (Server is Windows Server 2008 SP2)

    Read the article

  • How to set a management IP on a Dell powerconnect 5524/5548 switch?

    - by John Little
    When you first power on a 5524, connected via the serial console, you are offered a setup wizard where you can enter the management IP/Net/Gateway and enter the admin password. HOWEVER, if you dont do this in 60 seconds, the wizard dissapears, and there seems to be no way to run it again - even if you reboot the box. No commands work in the CLI, it just gives you this prompt: If you type say enable, or login, it gives: >login Unknown parameter May be one from the following list: debug help So no commands seem to work. The CLI reference guide does not seem to have any way to run the wizard, or to set the management port or admin passwords. So by not responding in 60 secons after boot, the unit is bricked. Any ideas?

    Read the article

  • Ubuntu 8.04 server is not retaining a static IP address

    - by James Pierce
    I recently setup a linux box running Ubuntu 8.04 (to match another server with 8.04). I need to insure that this box has a static IP address and I changed /etc/network/interfaces to set up the static IP address and when I run sudo /etc/init.d/networking restart it works fine for a while, but always reverts back to 10.0.1.24 after being idle for a while. I also tried stopping/removing the dhcp client, but that didn't help. sudo /etc/init.d/dhcp stop sudo apt-get remove dhcp3-client Here is my /etc/init.d/networking: # The loopback network interface auto lo iface lo inet loopback # The primary network interface auto eth0 iface eth0 inet static address 10.0.1.4 netmask 255.255.255.0 broadcast 10.0.1.255 gateway 10.0.1.1 Any thoughts? Thanks.

    Read the article

< Previous Page | 59 60 61 62 63 64 65 66 67 68 69 70  | Next Page >