Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 633/972 | < Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >

  • greasemonkey code modification

    - by muqtar
    Hi,all.. A user has helped me find hidden values in a page and display it using alert. If there are radio buttons and one of them is related to this value,is there a way to select the radio button automatically rathar than displaying the value in alert box.. Thanks... the code is as follows: var inputs = document.getElementsByTagName('input'); for (i=0; i<inputs.length; i++) { if (inputs[i].getAttribute("name") == "ans") { alert(inputs[i].getAttribute("value")); } } this "value" must be selected in the radio button rathar than alerting...

    Read the article

  • Need help with some functions and variables

    - by Doug
    function createXMLHTTP() { xmlhttp = =new XMLHttpRequest(); return xmlhttp; } I'm trying to create 3 instances of this, but it all has the same variable name which is xmlhttp. How can I dynamically create different variable names? I'm not sure if that's the right way to ask the question. I want to create like xmlhttp1, xmlhttp2, xmlhttp3, so then I can reference each one.

    Read the article

  • jQuery trigger custom event synchronously?

    - by Miguel Angelo
    I am using the jQuery trigger method to call an event... but it behaves inconsistently. Sometimes it call the event, sometimes it does not. <a href="#" onclick=" $(this).trigger('custom-event'); window.location.href = 'url'; return false; ">text</a> The custom-event has lots of listeners added to it. It is as if the trigger method is not synchronous, allowing the window.location.href be changed before executing the events. And when window.location.href is changed a navigation occurs, interrupting everything. How can I trigger events synchronously? Using jQuery 1.8.1. Thanks! EDIT I have found that the event, when called has a stack trace like this: jQuery.fx.tick (jquery-1.8.1.js:9021) tick (jquery-1.8.1.js:8499) jQuery.Callbacks.self.fireWith (jquery-1.8.1.js:1082) jQuery.Callbacks.fire (jquery-1.8.1.js:974) jQuery.speed.opt.complete (jquery-1.8.1.js:8991) $.customEvent (myfile.js:28) This proves that jQuery trigger method is asynchronous. Oohhh my... =\

    Read the article

  • Is there a way to delete a form element without using jQuery .remove()?

    - by Tommy
    Using .remove() so that the select all check box is not submitted to the server. However, it is visible to the user as the select all checkbox is "physically" removed from the web page, upon submit. Instead, I would like removing the select all check box to appear seamless but NOT on the server side. i.e. - I would like to keep the input on the page but remove the element in the form array before it is sent. Can I manipulate the element[] array of the form before it is sent to the server and delete it there? Thank you.

    Read the article

  • Change cookies when doing jQuery.ajax requests in Chrome Extensions

    - by haskellguy
    I have wrote a plugin for facebook that sends data to testing-fb.local. The request goes through if the user is logged in. Here is the workflow: User logs in from testing-fb.local Cookies are stored When $.ajax() are fired from the Chrome extension Chrome extension listen with chrome.webRequest.onBeforeSendHeaders Chrome extension checks for cookies from chrome.cookies.get Chrome changes the Set-Cookies header to be sent And the request goes through. I wrote this part of code that shoud be this: function getCookies (callback) { chrome.cookies.get({url:"https://testing-fb.local", name: "connect.sid"}, function(a){ return callback(a) }) } chrome.webRequest.onBeforeSendHeaders.addListener( function(details) { getCookies(function(a){ // Here something happens }) }, {urls: ["https://testing-fb.local/*"]}, ['blocking']); Here is my manifest.json: { "name": "test-fb", "version": "1.0", "manifest_version": 1, "description": "testing", "permissions": [ "cookies", "webRequest", "tabs", "http://*/*", "https://*/*" ], "background": { "scripts": ["background.js"] }, "content_scripts": [ { "matches": ["http://*.facebook.com/*", "https://*.facebook.com/*"], "exclude_matches" : [ "*://*.facebook.com/ajax/*", "*://*.channel.facebook.tld/*", "*://*.facebook.tld/pagelet/generic.php/pagelet/home/morestories.php*", "*://*.facebook.tld/ai.php*" ], "js": ["jquery-1.8.3.min.js", "allthefunctions.js"] } ] } In allthefunction.js I have the $.ajax calls, and in background.js is where I put the code above which however looks not to run.. In summary, I have not clear: What I should write in Here something happens If this strategy is going to work Where should I put this code?

    Read the article

  • JQuery within a partial view not being called

    - by XN16
    I have a view that has some jQuery to load a partial view (via a button click) into a div in the view. This works without a problem. However within the partial view I have a very similar bit of jQuery that will load another partial view into a div in the first partial view, but this isn't working, it almost seems like the jQuery in the first partial view isn't being loaded. I have tried searching for solutions, but I haven't managed to find an answer. I have also re-created the jQuery function in a @Ajax.ActionLink which works fine, however I am trying to avoid the Microsoft helpers as I am trying to learn jQuery. Here is the first partial view which contains the jQuery that doesn't seem to work, it also contains the @Ajax.ActionLink that does work: @model MyProject.ViewModels.AddressIndexViewModel <script> $(".viewContacts").click(function () { $.ajax({ url: '@Url.Action("CustomerAddressContacts", "Customer")', type: 'POST', data: { addressID: $(this).attr('data-addressid') }, cache: false, success: function (result) { $("#customerAddressContactsPartial-" + $(this).attr('data-addressid')) .html(result); }, error: function () { alert("error"); } }); return false; }); </script> <table class="customers" style="width: 100%"> <tr> <th style="width: 25%"> Name </th> <th style="width: 25%"> Actions </th> </tr> </table> @foreach (Address item in Model.Addresses) { <table style="width: 100%; border-top: none"> <tr id="[email protected]"> <td style="width: 25%; border-top: none"> @Html.DisplayFor(modelItem => item.Name) </td> <td style="width: 25%; border-top: none"> <a href="#" class="viewContacts standardbutton" data-addressid="@item.AddressID">ContactsJQ</a> @Ajax.ActionLink("Contacts", "CustomerAddressContacts", "Customer", new { addressID = item.AddressID }, new AjaxOptions { UpdateTargetId = "customerAddressContactsPartial-" + @item.AddressID, HttpMethod = "POST" }, new { @class = "standardbutton"}) </td> </tr> </table> <div id="[email protected]"></div> } If someone could explain what I am doing wrong here and how to fix it then I would be very grateful. Thanks very much.

    Read the article

  • Is jQuery modular? How to trim it down?

    - by usr
    Uncompressed, jQuery is 160KB in size. I did not see a way to exclude seldomly used parts of it like with jQuery UI. How can I reduce the (compressed and minified) file size of jQuery? I am quite concerned because dial-up lines and slow machines/browsers are very common among users of my site.

    Read the article

  • How do you send an array as part of an (jquery) ajax request

    - by Ankur
    I tried to send an array as part of an ajax request like this: var query = []; // in between I add some values to 'query' $.ajax({ url: "MyServlet", data: query, dataType: "json", success: function(noOfResults) { alert(noOfResults); } }); } I wanted to see what I get back in the servlet, so I used this line: System.out.println(request.getParameterMap().toString()); Which returned {} suggesting an empty map. Firebug tells me I am getting a 400 bad request error If I send a queryString like attribute=value as the 'data' then everything works fine, so it has to do with not being able to send an array as is. What do I have to do to get that data into the servlet for further processing. I don't want to pull it out and turn it into a queryString in the JS if I can avoid it. EDIT: I used the .serializeArray() (jQuery) function before sending the data. I don't get the 400 but nothing useful is being sent through.

    Read the article

  • Prevent initial array from sorting

    - by George
    I have an array where the order of the objects is important for when I finally output the array in a document. However, I'm also sorting the array in a function to find the highest value. The problem is that I after I run the function to find the highest value, I can't get the original sort order of the array back. // html document var data = [75,300,150,500,200]; createGraph(data); // js document function createGraph(data) { var maxRange = getDataRange(data); // simpleEncode() = google encoding function for graph var dataSet = simpleEncode(data,maxRange); } function getDataRange(dataArray) { var num = dataArray.sort(sortNumber); return num[0]; } I've also tried setting data to dataA and dataB and using dataB in the getDataRange function and dataA in the simpleEncode function. Either way, data always end up being sorted from highest to lowest.

    Read the article

  • Creating a page selector with JSP/JSTL

    - by zakSyed
    I am working on a project where I am required to build a page somewhat similar to the one you see when you visit a website like blockbuster. When you click on browse more you are taken to a page with a bar on top with different page numbers and a drop down to select the number of pages you want to view on that page. I want to include a feature like that on my page but I am not sure where to start. In my page I have list of 200 items which I want to display page by page. I was suggested to use custom tags, but is there a more simpler or efficient way to create that functionality. My web application uses Spring MVC framework and is coded entirely in Java. Any suggestions will be appreciated.

    Read the article

  • Any alternative to jQuery change() to detect when user selects new file via dialog box in IE8?

    - by ecu
    I am unable to detect when input type="file" changes its value after user selects file and the dialog box closes. $('.myInput').change(function(){ alert($(this).val()); }) Above jQuery code works perfectly in all browsers apart from IE. For some reason IE detects the change only after input field loses focus. Is there a way to detect the change immediately after dialog box closes? Or maybe to force input field to lose focus after dialog box closes so IE can detect it? I'm puzzled. Thanks for any help.

    Read the article

  • How do I return something in JQuery?

    - by TIMEX
    function vote_helper(content_id, thevote){ var result = ""; $.ajax({ type:"POST", url:"/vote", data:{'thevote':thevote, 'content_id':content_id}, beforeSend:function() { }, success:function(html){ result = html; } }); return result; }; I want to return the result. But it's returning blank string.

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Parent - child event jquery

    - by Tom Rider
    I have have a 2 div element. One is child and one is parent like : <div id="p"> <div id="c"> </div> </div> The parent div has 2 event attached click and dblclick and child div has 1 event attached click. Now my problem is when i clicked on the child div the parent div click event also executed. I tried e.stopPropagation(); but still same behavior. Help me ?

    Read the article

  • Why ajax doesn't work unless I refresh or use location.href?

    - by Connor Tang
    I am working on a html project, which will eventually package by Phonegap. So I am trying to encode the data from html form to JSON format, then use ajax send to a php file resides on server, and receive the response to do something else. Now I use <a href='login.html'> in my index.html to open the login page. In my login page, I have this <script> $(document).ready(function(e) { $('#loginform').submit(function(){ var jData = { "email": $('#emailLogin').val(), "password": $('#Password').val()}; $.ajax({ url: 'PHP/login.php', type:'POST', data: jData, dataType: 'json', async: false, error: function(xhr,status){ //reload(); location.href='index.html'; alert('Wrong email and password'); }, success: function(data){ if(data[1] == 1){ var Id_user = data[0]; location.href='loginSuccess.html'; } } }); }); }); </script> to send my data to server. But I found that it won't work, it's still in the login page. I tried to enter data and submit again, it's still nothing happen. Until I refresh the login page and enter data again, it can give an error message or go to the loginsuccess page. However, when I use <script> function loadLogin(){ location.href='login.html'; } </script> to open the login page, everything works well. So what cause this? How can I modify this piece of code to make it better?

    Read the article

  • Disable a form and all contained elements until an ajax query completes (or another solution to prev

    - by Max Williams
    I have a search form with inputs and selects, and when any input/select is changed i run some js and then make an ajax query with jquery. I want to stop the user from making further changes to the form while the request is in progress, as at the moment they can initiate several remote searches at once, effectively causing a race between the different searches. It seems like the best solution to this is to prevent the user from interacting with the form while waiting for the request to come back. At the moment i'm doing this in the dumbest way possible by hiding the form before making the ajax query and then showing it again on success/error. This solves the problem but looks horrible and isn't really acceptable. Is there another, better way to prevent interaction with the form? To make things more complicated, to allow nice-looking selects, the user actually interacts with spans which have js hooked up to them to tie them to the actual, hidden, selects. So, even though the spans aren't inputs, they are contained in the form and represent the actual interactive elements of the form. Grateful for any advice - max. Here's what i'm doing now: function submitQuestionSearchForm(){ //bunch of irrelevant stuff var questionSearchForm = jQuery("#searchForm"); questionSearchForm.addClass("searching"); jQuery.ajax({ async: true, data: jQuery.param(questionSearchForm.serializeArray()), dataType: 'script', type: 'get', url: "/questions", success: function(msg){ //more irrelevant stuff questionSearchForm.removeClass("searching"); }, error: function(msg){ questionSearchForm.removeClass("searching"); } }); return true; }

    Read the article

  • jQuery and array of objects

    - by sepoto
    $(document).ready(function () { output = ""; $.ajax({ url: 'getevents.php', data: { ufirstname: 'ufirstname' }, type: 'post', success: function (output) { alert(output); var date = new Date(); var d = date.getDate(); var m = date.getMonth(); var y = date.getFullYear(); $('#calendar').fullCalendar({ header: { left: 'prev,next today', center: 'title', right: 'month,basicWeek,basicDay' }, editable: true, events: output }); } }); }); I have code like this and if I copy the text verbatim out of my alert box and replace events: output with events: [{ id: 1, title: 'Birthday', start: new Date(1355011200*1000), end: new Date(1355011200*1000), allDay: true, url: 'http://www.yahoo.com/'},{ id: 2, title: 'Birthday Hangover', start: new Date(1355097600*1000), end: new Date(1355097600*1000), allDay: false, url: 'http://www.yahoo.com'},{ id: 3, title: 'Sepotomus Maximus Christmas', start: new Date(1356393600*1000), end: new Date(1356393600*1000), allDay: false, url: 'http://www.yahoo.com/'},] Everything works just fine. What can I do to fix this problem? I though that using events: output would place the text in that location but it does not seem to be working. Thank you all kindly in advance for any comments or answers!

    Read the article

< Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >