Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 635/972 | < Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >

  • IE firing anything else but click

    - by shabunc
    I just wonder is there's any way to fire any event via IE's event-triggering implementation - fireEvent. I've tried to use it but failed with all event except click. The only reason i've get interested with this issue it curiousity, thus, any answers like "just do not trigger events, it is a bad idea" - all such answers would be considered, well...not full))) thanks in advance

    Read the article

  • How do I unbind another jQuery function on .click()?

    - by Mike Barwick
    I have this script that run to fix my menu bar to the browser on scroll. Nothing really needs to change here (works as it should). However, you may need it... var div = $('#wizMenuWrap'); var editor = $('#main_wrapper'); var start = $(div).offset().top; $(function fixedPackage(){ $.event.add(window, "scroll", function() { var p = $(window).scrollTop(); $(div).css('position',((p)>start) ? 'fixed' : 'static'); $(div).css('top',((p)>start) ? '0px' : ''); //Adds TOP margin to #main_wrapper (required) $(editor).css('position',((p)>start) ? 'relative' : 'static'); $(editor).css('top',((p)>start) ? '88px' : ''); }); }); Now for the issue at hand. I have another script function that calls a modal pop-up (which again works as it should). However, it's not slick from a UI perspective when I scroll the page when the modals open. So I want to disable the script above when the modal script below is called. In other words, when I click to open the modal pop-up, the script above shouldn't work. $(function () { var setUp = $('.setupButton'); // SHOWS SPECIFIED VIEW $(setUp).click(function () { $('#setupPanel').modal('show'); //PREVENTS PACKAGE SELECT FIXED POSITION ON SCROLL $(setUp).unbind('click',fixedPackage); }); }) As you can see above, I tried to unbind the scroll function (the first code snippet), but this is not correct. These two scripts are in two separate js libraries.

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • More compact way to do this?

    - by Macha
    I have a couple of functions that loop around the surrounding cells of a cell. The grid is contained inside an array. In my code, I have checks to make sure it's not one of the edge cells, as checking an undefined cell causes an error. As such, I have code like this: if(x > 0) { var firstX = x - 1; } else { var firstX = x; } if(x < 199) { var lastX = x + 1; } else { var lastX = x; } if(y > 0) { var firstY = y - 1; } else { var firstY = y; } if(y < 199) { var lastY = y + 1; } else { var lastY = y; } A lot of lines of code to do very little. Is there a more elegant way to do this?

    Read the article

  • Jquery adding events

    - by JBone
    I want to add an event handler to some dynamically added elements. I simplified my problem into the basic code below. I am using the new JQuery 1.7 on feature to say "hey for all labels in the CancelSurvey id element call this notify function when they are clicked." function notify(event) { console.log(event.data.name); } $('#CancelSurvey').on('click', 'label', { name: $(this).attr("id") }, notify); I want to pass the id of the label as parameter "name". When I try to alert this it is undefined (they are defined in the html created). I believe that using the $(this) is not referencing the label selector in this case. It actually seems to be referencing the document itself. Any ideas on how to accomplish this?

    Read the article

  • Function to get the font and calculate the width of the string not working on first instance

    - by user3627265
    I'm trying to calculate the width of the string based on the font style and size. The user will provide the string, the font style and the font size, and then after giving all the data the user will hit the submit button and the function will trigger. Basically this script works but only when the submit button is hit twice or the font is selected twice,. I mean if you selec DNBlock as a font, it will not work for first time, but the second time you hit submit, it will then work. I'm not sure where is the problem here, but when I used the default font style like Arial, times new roman etc it works perfectly fine. Any Idea on this? I suspected that the font style is not being rendered by the script or something. Correct me if I'm wrong. Thanks //Repeat String String.prototype.repeat = function( num ) { return new Array( num + 1 ).join( this ); } //Calculate the width of string String.prototype.textWidth = function() { var fntStyle = document.getElementById("fntStyle").value; if(fntStyle == "1") { var fs = "DNBlock"; } else if(fntStyle == "2") { var fs = "DNBlockDotted"; } else if(fntStyle == "3") { var fs = "DNCursiveClassic"; } else if(fntStyle == "4") { var fs = "DNCursiveDotted"; } else if(fntStyle == "5") { var fs = "FoundationCursiveDots-Regul"; } var f = document.getElementById("fntSize").value.concat('px ', fs), o = $('<div>' + this + '</div>') .css({'position': 'absolute', 'float': 'left', 'white-space': 'nowrap', 'visibility': 'hidden', 'font': f}) .appendTo($('body')), w = o.width(); o.remove(); return w; } //Trigger the event $("#handwriting_gen").submit(function () { var rptNO = parseInt($('#rptNO').val()); $("[name='txtLine[]']").each(function(){ alert(this.value.repeat(rptNO).textWidth()); if(this.value.repeat(rptNO).textWidth() > 1000) { $(this).focus(); $(this).css({"background-color":"#f6d9d4"}).siblings('span.errorMsg').text('Text is too long.'); event.preventDefault(); } }); });

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Get backreferences values and modificate these values

    - by roasted
    Could you please explain why im not able to get values of backreferences from a matched regex result and apply it some modification before effective replacement? The expected result is replacing for example string ".coord('X','Y')" by "X * Y". But if X to some value, divide this value by 2 and then use this new value in replacement. Here the code im currently testing: See /*>>1<<*/ & /*>>2<<*/ & /*>>3<<*/, this is where im stuck! I would like to be able to apply modification on backrefrences before replacement depending of backreferences values. Difference between /*>>2<<*/ & /*>>3<<*/ is just the self call anonymous function param The method /*>>2<<*/ is the expected working solution as i can understand it. But strangely, the replacement is not working correctly, replacing by alias $1 * $2 and not by value...? You can test the jsfiddle //string to test ".coord('125','255')" //array of regex pattern and replacement //just one for the example //for this example, pattern matching alphanumerics is not necessary (only decimal in coord) but keep it as it var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { /*==>**1**/ //this one works as usual but dont let me get backreferences values $output.val(inputText.replace(regexes[i][0], regexes[i][2])); /*==>**2**/ //this one should works as i understand it $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][3]; })); /*==>**3**/ //this one is just a test by self call anonymous function $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][4]; }())); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); //HERE i should be able if lets say $1 > 200 divide it by 2 //then returning $1 value if($1 > 200) $1 = parseInt($1 / 2); return $1; }? Sure I'm missing something, but cannot get it! Thanks for your help, regards. EDIT WORKING METHOD: Finally get it, as mentionned by Eric: The key thing is that the function returns the literal text to substitute, not a string which is parsed for backreferences.?? JSFIDDLE So complete working code: (please note as pattern replacement will change for each matched pattern and optimisation of speed code is not an issue here, i will keep it like that) $('#btn').click(function() { testReg($('#input').val(), $('#output')); }); //array of regex pattern and replacement //just one for the example var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { var checkedValues = checkReplace(match, $1, $2, $3, $4); $1 = checkedValues[0]; $2 = checkedValues[1]; regexes[i][1] = regexes[i][1].replace('$1', $1).replace('$2', $2); return regexes[i][1]; })); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); if ($1 > 200) $1 = parseInt($1 / 2); if ($2 > 200) $2 = parseInt($2 / 2); return [$1,$2]; }

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Redirect Using jQuery

    - by tshauck
    Hi, So I'm using jquerymobile for an app I'm creating. I have a link that if all the validation passes I'd like to go through, but if something fails I'd like to redirect. In the jquery something like this. Since it is jquerymobile the link will be a new div on the same index.html page - if that helps. $(#link).click(function(){ if(validation_fails) link_elsewhere; else return true; }

    Read the article

  • Disable a form and all contained elements until an ajax query completes (or another solution to prev

    - by Max Williams
    I have a search form with inputs and selects, and when any input/select is changed i run some js and then make an ajax query with jquery. I want to stop the user from making further changes to the form while the request is in progress, as at the moment they can initiate several remote searches at once, effectively causing a race between the different searches. It seems like the best solution to this is to prevent the user from interacting with the form while waiting for the request to come back. At the moment i'm doing this in the dumbest way possible by hiding the form before making the ajax query and then showing it again on success/error. This solves the problem but looks horrible and isn't really acceptable. Is there another, better way to prevent interaction with the form? To make things more complicated, to allow nice-looking selects, the user actually interacts with spans which have js hooked up to them to tie them to the actual, hidden, selects. So, even though the spans aren't inputs, they are contained in the form and represent the actual interactive elements of the form. Grateful for any advice - max. Here's what i'm doing now: function submitQuestionSearchForm(){ //bunch of irrelevant stuff var questionSearchForm = jQuery("#searchForm"); questionSearchForm.addClass("searching"); jQuery.ajax({ async: true, data: jQuery.param(questionSearchForm.serializeArray()), dataType: 'script', type: 'get', url: "/questions", success: function(msg){ //more irrelevant stuff questionSearchForm.removeClass("searching"); }, error: function(msg){ questionSearchForm.removeClass("searching"); } }); return true; }

    Read the article

  • Checking for length of ul and removing an li element

    - by Legend
    I am trying to remove the last <li> element from a <ul> element only if it exceeds a particular length. For this, I am doing something like this: var selector = "#ulelement" if($(selector).children().length > threshold) { $(selector + " >:last").remove(); } I don't like the fact that I have to use the selector twice. Is there a shorter way to do this? Something like a "remove-if-length-greater-than-threshold" idea. I was thinking that maybe there is a way to do this using the live() function but I have no idea how.

    Read the article

  • Canvas draw calls are rendering out of sequence

    - by Tom Murray
    I have the following code for writing draw calls to a "back buffer" canvas, then placing those in a main canvas using drawImage. This is for optimization purposes and to ensure all images get placed in sequence. Before placing the buffer canvas on top of the main one, I'm using fillRect to create a dark-blue background on the main canvas. However, the blue background is rendering after the sprites. This is unexpected, as I am making its fillRect call first. Here is my code: render: function() { this.buffer.clearRect(0,0,this.w,this.h); this.context.fillStyle = "#000044"; this.context.fillRect(0,0,this.w,this.h); for (var i in this.renderQueue) { for (var ii = 0; ii < this.renderQueue[i].length; ii++) { sprite = this.renderQueue[i][ii]; // Draw it! this.buffer.fillStyle = "green"; this.buffer.fillRect(sprite.x, sprite.y, sprite.w, sprite.h); } } this.context.drawImage(this.bufferCanvas,0,0); } This also happens when I use fillRect on the buffer canvas, instead of the main one. Changing the globalCompositeOperation between 'source-over' and 'destination-over' (for both contexts) does nothing to change this. Paradoxically, if I instead place the blue fillRect inside the nested for loops with the other draw calls, it works as expected... Thanks in advance!

    Read the article

  • Accessing "pseudo-globals" by their name as a string

    - by rob
    I am now in the process of removing most globals from my code by enclosing everything in a function, turning the globals into "pseudo globals," that are all accessible from anywhere inside that function block. (function(){ var g = 1; var func f1 = function () { alert (g); } var func f2= function () { f1(); } })(); (technically this is only for my "release version", where I append all my files together into a single file and surround them with the above....my dev version still has typically one global per js file) This all works great except for one thing...there is one important place where I need to access some of these "globals" by string name. Previously, I could have done this: var name = "g"; alert (window[name]); and it did the same as alert(g); Now -- from inside the block -- I would like to do the same, on my pseudo-globals. But I can't, since they are no longer members of any parent object ("window"), even though are in scope. Any way to access them by string? Thanks...

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • The SVG text node disappear after change its text content

    - by sureone
    svg: <text xml:space="preserve" y="228" x="349.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_b">cur_b</text> <text xml:space="preserve" y="222" x="103.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_a">cur_a</text> <text xml:space="preserve" y="229" x="590.0211" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_c">cur_c</text> NSString* theJS = @ "var theNode0 = document.getElementById('cur_a'); theNode0.textContent='200A'; theNode0.setAttribute('fill','#FF0000'); var theNode1 = document.getElementById('cur_c'); theNode1.textContent='200A'; theNode1.setAttribute('fill','#00FF00');" [self.webView stringByEvaluatingJavaScriptFromString:theJS]; The SVG text node value is changed but disappeared after about one second.

    Read the article

  • XMLHttpRequest.status always returning 0

    - by Michael
    html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

    Read the article

  • jQuery: Load body of page into variable

    - by Nathan G.
    I'm using jQuery to load the result of a PHP script into a variable. The script is passed something that the user typed with a GET request. I want to take just what the script spit out into its <body> tag. Here's what I've tried: JS: function loader() { var typed = $('#i').val(); //get what user typed in $.get("script.php", {i: typed}, function(loaded) {dataloaded = loaded;}); alert($(dataloaded).find('body')) } But it just displays [Objec object]. How can I get a useful value that is just the contents of the body of a loaded page? I know the PHP works, I just need the JS. The script echos something like 1!!2 (two numbers separated by two exclamation points). Thanks!

    Read the article

  • How to achieve jQuery scrolling/overlay effect (video in description)

    - by waffl
    I have two columns. The left column contains text of dynamic lengths. The right column is of fixed height and will contain a set of images selected at random per page load. I am trying to create an effect where while the user scrolls, the Image 2 scrolls above Image 1. When it reaches the top, the Image 1 begins to scroll up until it disappears, then Image 3 comes in and repeats the process. As this is rather confusing, I made a short video describing the desired effect. Video - MP4 I have begun trying to get it working in this jsbin but am at a loss for when the user scrolls back down and also when more images are required. I am thinking my current path is not the right direction. I'm thinking that employing something like jQuery waypoints is more the direction I should be pursuing?

    Read the article

  • Call a method on Browser closure [X]

    - by Gaurav
    I am facing an issue in my application user directly clicked on browser close [X] button. Browser can be IE, Chrome, Mozilla, Firefox and many more. What I want to do : 1. as soon as User hits [X] button of browser, need to set there status as logged off in database for which we have a method in Login.aspx file which is within the masterpage. 2. We do not have any Logoff feature in the application I will be thanlful if anyone suggest a solution to call the method which sets the user status as logged off from master page. Thanks in advance.

    Read the article

  • Matching a String and then incrementing a number within HTML elements

    - by Abs
    Hello all, I have tags in a html list, here is an example of two tags. <div class="tags"> <ul> <li> <a onclick="tag_search('tag1');" href="#">tag1 <span class="num-active">1</span></a> </li> <li> <a onclick="tag_search('tag2');" href="#">tag2 <span class="num-active">1</span></a> </li> </ul> </div> I would like to write a function that I can pass a string to, that will match the strings in the a hyperlink i.e. "tag1" or "tag2", if there is a match then increment the number in the span, if not then add a new li. The bit I am having trouble with is how do I search for a string in the div with class tags and then when I find a match identifying the element. I can't even do the first bit as I am use to using an ID or a Class. I appreciate any help on this using JQuery Thanks all Code so far function change_tag_count(item){ alert(item);//alerts the string test $.fn.searchString = function(str) { return this.filter('*:contains("' + item + '")'); }; if($('body').searchString(item).length){ var n = $('a').searchString(item).children().text(); n = parseInt(n) + 1; $('a').searchString(item).children().text(n); }else{ alert('here');//does not alert this when no li contains the word test $("#all_tags ul").append('<a onclick="tag_search(\''+item+'\');" href="#">'+item+'<span class="num-active">1</span></a>'); } }

    Read the article

< Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >