Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 635/972 | < Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >

  • Animate/Ease an element to position when other elements disappear

    - by Jonathan
    Please take a look at this fiddle: http://jsfiddle.net/dhcyA/ Try clicking on a block. What I want is that when the other elements disapear, the selected block will animate/ease to his giving position instead of just jumping like it does now. Then the same animation repeats itself when clicking again on the box, but then back to place. Maybe to keep in mind: I'm using a reponsive design, which means those blocks can be vertical and horizontal after scaling the window. Any redevisions on the fiddle or suggustions would be great!

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • jQuery: Writing jquery in an object oriented way

    - by anoopkattodi
    Hi all, I am trying to write all my query code in an object oriented way. But I don't know how to implement this for each click function and hover function etc. I also wanted to know: What are the advantages of writing query in object oriented way? For query what is better the object oriented way or in the ordinary way?

    Read the article

  • How to get exactly typeof is object/array/null..?

    - by 3gwebtrain
    var obj = {},ar = [],nothing=null,empty=undefined,word ='string',headorTail = true; console.log(typeof obj) //object console.log(typeof ar)//object console.log(typeof nothing)//object console.log(typeof empty)//undefined console.log(typeof word)//string console.log(typeof headorTail)//boolean But how can i get the type of obj,ar,nothing as "object, array,null" - what is the best way to achieve this?

    Read the article

  • Setting CSS attributes on Change using jQuery

    - by Nick B
    I want to change css visibility and display attributes using jQuery on click when the state of another div's visibility attribute changes. (Many apologies for the obfuscated markup, but needing to manipulate someone else's construction): There are four instances of [data-label="Checkbox"] [data-label="Checked"] in this page. I want to set [data-label="trash"] and [data-label="Sort Options"] to visibility: visible; display: [empty value] when any of the [data-label="Checkbox"] [data-label="Checked"]'s attributes changes to 'visibility', 'visible'. Else, if none of [data-label="Checkbox"] [data-label="Checked"]'s have the attribute 'visibility', 'visible', I want to set [data-label="trash"] and [data-label="Sort Options"] back to their initial states: display: none; visibility: hidden;. Here's the markup: <div data-label="Sort Options" style="display: none; visibility: hidden;"> <div data-label="trash" style="display: none; visibility: hidden;"></div> </div> <div data-label="Checkbox"> <div data-label="Unchecked"></div> <div data-label="Checked" style="display: none; visibility: hidden;"></div> </div> Here is what I have tried unsuccessfully: $('[data-label="Checkbox"]').click(function() { if ('[data-label="Checkbox"] [data-label="Checked"]').css('visibility', 'visible') { $('[data-label="trash"], [data-label="Sort Options"]').css({'display': '', 'visibility': 'visible'}); } else { $('[data-label="trash"], [data-label="Sort Options"]').css({'display': 'none', 'visibility': 'hidden'}); } }); Any help would be greatly appreciated! Thanks

    Read the article

  • ANy way to fix the position of image

    - by Mirage
    I have an image on the left hand side and text on right side. Like two column layout. I want that when i scroll the text then the image should stay at center of page. I tried using position:fixed But then the problem , sometimes when i resize the IE window to small size then the image stay at same position and it comes out of the main content area when i scroll down. I want that image should scroll but should stay within the content area . It should not move outsid ethe main content aqrea

    Read the article

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • Hide 'Would you like to remember password' iFrame

    - by nsilva
    Basically I have a website called http://yellow-taxis.uk/ which features an online booking system that is placed on the web site within an iFrame. On the online booking, it automatically logs the user in as a 'Guest' for credit card payments. When the site loads it comes up with a window asking the viewer if they 'would like to remember the password'. I was wondering if there was anyway possible to not display this window as it would be a much simpler option than changing a lot of the code within the online booking. Just to add, the iFrame is hosted on the same server as the web site (not sure if this makes a difference) Any help would be much appreciated.

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • jQuery code works in Chrome, not in IE9

    - by Francis Ducharme
    Pretty new to jQuery here, I've got a chunk of code that works OK in Chrome, but fails in IE9 (have not tried FF yet). Here's the code: var textColor = $('#navmenu-body').css('color'); textColor = textColor.slice(4); In IE9, I get an error to the effect that slice can't be called because textColor is undefined. I was not sure if it's because jQuery just can't find the #navmenu-body element or that it can't find the CSS attribute color. So I did: var j = $('#navmenu-body'); var textColor = $('#navmenu-body').css('color'); textColor = textColor.slice(4); In IE9's console, j.length returns 0. So the selector is indeed, not working Here's the #navmenu-body HTML DOM <div id="navmenu-body" class="x-panel-body x-panel-body-cssmenu x-layout-fit x-panel-body-cssmenu" style="height: 398px; left: 0px; top: 0px; width: 200px;"> </div> Do I need to do something else for IE9 support ?

    Read the article

  • Delay image loading with jQuery

    - by DCD
    I have a page with several galleries including accordions and sliders. The problem is that the page takes forever to load. Is there a way of wrapping an image in a bit of code or applying a class to it to force it to load only after everything else is loaded?

    Read the article

  • How do i Convert a Select to a Checkbox

    - by streetparade
    That sounds pretty odd but i have this cod and i need to convert it to checkbox, with the same functionalities <select onchange="document.getElementById('reasonDiv{$test->id}').style.display = ''; document.getElementById('reason{$test->id}').value = this.value;" name='reasonId{$test->id}' id='reasonId{$test->id}'> <option value=''>Test</option> {foreach item=test from=$testtmp.6} <input type="checkbox" value='{include file='testen.tpl' blog=$test1 member=$test2 contents=$test->contents replyId=$test->predefinedreplyid }' label='{$test->predefinedreplyid}' {if $test->predefinedreplyid==$test1->declineId}selected="selected"{/if}>{$test->subject}</option> {/foreach} </select> How can i do that? Thanks for help

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >