Search Results

Search found 37844 results on 1514 pages for 'function composition'.

Page 634/1514 | < Previous Page | 630 631 632 633 634 635 636 637 638 639 640 641  | Next Page >

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Explain a block of crazy JS code inside Sizzle(the CSS selector engine)

    - by Andy Li
    So, here is the function for pre-filtering "CHILD": function(match){ if ( match[1] === "nth" ) { // parse equations like 'even', 'odd', '5', '2n', '3n+2', '4n-1', '-n+6' var test = /(-?)(\d*)n((?:\+|-)?\d*)/.exec( match[2] === "even" && "2n" || match[2] === "odd" && "2n+1" || !/\D/.test( match[2] ) && "0n+" + match[2] || match[2]); // calculate the numbers (first)n+(last) including if they are negative match[2] = (test[1] + (test[2] || 1)) - 0; match[3] = test[3] - 0; } // TODO: Move to normal caching system match[0] = done++; return match; } The code is extracted from line 442-458 of sizzle.js. So, why is the line var test = ..., have the exec inputing a boolean? Or is that really a string? Can someone explain it by splitting it into a few more lines of code?

    Read the article

  • question about asynchronous http

    - by rantravee
    Hi , I just want to check if I understood well the way asynchronous Http request work on Android. Suppose I make such a request and set a ResponseHandler<String> responseHandler to handle the response. By doing this is it possible to have the UI thread blocked waiting for the response ? The implication being that the code in the function: public String handleResponse(HttpResponse response) is also executed on the UI thread or is there silently spawned a thread that waits for the response and calls the handleResponse(HttpResponse response) function when the response arrives ?

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • [PHP] - Output buffer based progress bar

    - by KPL
    Hello people, I have been trying to get the following code working. It's a progress bar trick which uses ob_get_clean() function. Don't know why but this script just don't work! Only the initial percent - 1% comes up and nothing after that. <?php error_reporting(8191); function flush_buffers(){ @ob_end_flush(); @ob_flush(); @flush(); @ob_start(); } $ini = 2; echo '<script>document.getElementById(\'lpt\').style.width=\'1%\';</script><br>'; for($i=1;$i<=100;$i++) { $k=$ini-1; $str=str_replace("width=\'$k%\'","width=\'$i%\'",ob_get_clean()); $ini++; echo $str; flush_buffers(); } ?>

    Read the article

  • XCode, error: '_object' undeclared. Need some help solving this problem

    - by user309030
    I've got this code in my viewController.m file - (void)viewDidLoad { [super viewDidLoad]; GameLogic *_game = [[GameLogic alloc] init]; [_game initGame]; ....... } GameLogic is another class which I created. in the same viewController.m file, I have got another function - (void)test { if([_game returnElecFence]) { NSLog(@"YES"); } else { NSLog(@"NO"); } } Problem is, whenever the test function is called, I get an error saying '_game' undeclared. I tried putting the GameLogic init code in the .h file and on top of the @implementation to make it global but every method I tried resulted in a worse error. TIA to anyone who can suggest some ideas to clear this error up

    Read the article

  • Validate zip and display error with onBlur event

    - by phil
    Check if zip is 5 digit number, if not then display 'zip is invalid'. I want to use onBlur event to trigger the display. But it's not working. <script> $(function(){ function valid_zip() { var pat=/^[0-9]{5}$/; if ( !pat.test( $('#zip').val() ) ) {$('#zip').after('<p>zip is invalid</p>');} } }) </script> zip (US only) <input type="text" name='zip' id='zip' maxlength="5" onBlur="valid_zip()">

    Read the article

  • tablednd post issue help please

    - by netrise
    Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

    Read the article

  • Why is FLD1 loading NaN instead?

    - by Bernd Jendrissek
    I have a one-liner C function that is just return value * pow(1.+rate, -delay); - it discounts a future value to a present value. The interesting part of the disassembly is 0x080555b9 : neg %eax 0x080555bb : push %eax 0x080555bc : fildl (%esp) 0x080555bf : lea 0x4(%esp),%esp 0x080555c3 : fldl 0xfffffff0(%ebp) 0x080555c6 : fld1 0x080555c8 : faddp %st,%st(1) 0x080555ca : fxch %st(1) 0x080555cc : fstpl 0x8(%esp) 0x080555d0 : fstpl (%esp) 0x080555d3 : call 0x8051ce0 0x080555d8 : fmull 0xfffffff8(%ebp) While single-stepping through this function, gdb says (rate is 0.02, delay is 2; you can see them on the stack): (gdb) si 0x080555c6 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 =R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 R2: Valid 0x4004ff147ae147ae1800 +63.77000000000000313 R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1861 IE PE SF TOP: 3 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0000 Instruction Pointer: 0x73:0x080555c3 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xdd45 And after the fld1: (gdb) si 0x080555c8 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 =R2: Special 0xffffc000000000000000 Real Indefinite (QNaN) R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1261 IE PE SF C1 TOP: 2 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0020 Instruction Pointer: 0x73:0x080555c6 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xd9e8 After this, everything goes to hell. Things get grossly over or undervalued, so even if there were no other bugs in my freeciv AI attempt, it would choose all the wrong strategies. Like sending the whole army to the arctic. (Sigh, if only I were getting that far.) I must be missing something obvious, or getting blinded by something, because I can't believe that fld1 should ever possibly fail. Even less that it should fail only after a handful of passes through this function. On earlier passes the FPU correctly loads 1 into ST(0). The bytes at 0x080555c6 definitely encode fld1 - checked with x/... on the running process. What gives?

    Read the article

  • How should I port this Prototype to JQuery?

    - by blu
    There is currently this Prototype code that does a PUT: new Ajax.Request(someUrl, { method: 'put', parameters: { 'foo': bar }, onSuccess: function(response) { } .bind(this) }); I found this post but the solution uses an extra parameter supported by RoR, however I am targeting an ASP.NET backend. I searched a bit and found that not all browsers support PUT operations so apparently this could fail in certain browsers? This is already in prod, so a direct port would be fine for now I suppose. As an aside, what is the deal with the bind(this) in the onSuccess function?

    Read the article

  • Getting value from key pair value into appended property using jQuery

    - by Neil
    How do I get the value from a key pair value into the rel property of an anchor tag? When I split the code to put the value in the correct place it doesn't work, the end of the a tag would appear on screen instead value wouldn't be applied. When I look at the resulting code in console in Firebug the rel and href swapped order so the rel is first. The 'key' should be and is in the correct location but the 'value' needs to be applied to the rel attribute. What am I doing wrong? $(function() { var obj = {"firstThing":"4","secondThing":"6","aThirdThing":"2","anotherThing":"3","followedByAnother":"4"}; $.each(obj, function(key,value) { $('#newmine').append("<li class='tagBlocks'>","<a href='#' rel=''>",value," ",key); }); });

    Read the article

  • Why are functional languages considered a boon for multi threaded environments?

    - by Billy ONeal
    I hear a lot about functional languages, and how they scale well because there is no state around a function; and therefore that function can be massively parallelized. However, this makes little sense to me because almost all real-world practical programs need/have state to take care of. I also find it interesting that most major scaling libraries, i.e. MapReduce, are typically written in imperative languages like C or C++. I'd like to hear from the functional camp where this hype I'm hearing is coming from....

    Read the article

  • Why I am not getting Row value on click using this?

    - by rockers
    $("#grid td:first-child").click(function() { var value = $(this).closest('tr').find('td:eq(2)').text(); // for third column alert(value); var value = $(this).closest('tr').find('td:eq(3)').text(); // for fourth column alert(value); var AccountName = accountid; var x = function() { $(this).click($("#showregiongrid").load('/analyst/ror/regionspeexc/?a=' + AccountName)); } clickTimer = window.setTimeout(x, 300); }); Why i am not getting the row values of eq(2) and eq(3).. is there anyting I am doing wrong? if I delete td:first-child from my click event I am getting null vallues on popup? thanks

    Read the article

  • Avoid multiple autocomplete calls by wrapping it with SetTimeOut

    - by pixelboy
    Here's my issue : using an autocomplete jQuery plugin, I'd like to avoid multiple ajax requests when user strikes his keynoard by surrounding the $('#query1').autocomplete({ serviceUrl:'/actions/autocomplete?population=salon', minChars:3, maxHeight:300, width:200, clearCache:true, onSelect: function(suggestions,data){ $(".btn1").attr("href", "${pageContext.request.contextPath}/actions/espaceClients?participantId=" + data) } }); with something like var search = false; $('#query1, #query2, #query3').keyup(function(){ if (!search){ search = true; } if (search) { search = false; autocompleteThem(); } }); A you can see, above code is stupid, but it kinda shows what i'm trying to do. In simple words, if user dosen't type anything else in a certain period of time, then you can call autocomplete. I hope i'm being clear, as my brains are a mess...

    Read the article

  • Generating random numbers in C

    - by moonstruckhorrors
    While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

    Read the article

  • Suggestion for R/LaTeX table creation package

    - by aL3xa
    I've been using xtable package for a long time, and looking forward to writting my first package in R... so I reckon that if I have some "cool" idea that's worth carying out, there's a great chance that somebody got there before me... =) I'm interested in functions/packages specialized for LaTeX table creation (through R, of course). I bumped on quantreg package which has latex.table function. Any suggestion for similar function(s)/package(s)? P.S. I'm thinking about building a webapp in which users can define their own presets/templates of tables, choose style, statistics, etc. It's an early thought, though... =)

    Read the article

  • How to have type hinting in PHP that specifies variable scope inside of a template? (specifically PhpStorm)

    - by Lance Rushing
    I'm looking for a doc comment that would define the scope/context of the current php template. (similar to @var) Example View Class: <?php class ExampleView { protected $pageTitle; public function __construct($title) { $this->pageTitle = $title; } public function render() { require_once 'template.php'; } } -- <?php // template.php /** @var $this ExampleView */ echo $this->pageTitle; PHPStorm gives an inspection error because the access on $pageTitle is protected. Is there a hint to give scope? Something like: <?php // template.php /** @scope ExampleView */ // <---???? /** @var $this ExampleView */ echo $this->pageTitle;

    Read the article

  • prevent hover set by the CSS

    - by meo
    I try to prevent the Browser from using the :hover effect of the CSS. $("ul#mainFilter a").hover( function(o){ o.preventDefault(); ...do my stuff... }, function(o){ o.preventDefault(); ...do my stuff... }); I tired it with return false; to but it does not work. Does anyone know how to do this? due the answers i give you some more nfo: I have set the a and a:hover styles, in my CSS already. Now if JS is available on the clients machine, i want to overwrite the effect with a smoother one. (using jQuery color plugin) As mentioned by fudgey, a work around would be to set the style (using .css()) but i would have to overwrite every single effect specified in the CSS (see here: http://jsfiddle.net/raPeX/1/ ). I am looking for a generic solution.

    Read the article

  • some confusions to singleton pattern in PHP

    - by SpawnCxy
    Hi all, In my team I've been told to write resource class like this style: class MemcacheService { private static $instance = null; private function __construct() { } public static function getInstance($fortest = false) { if (self::$instance == null) { self::$instance = new Memcached(); if ($fortest) { self::$instance->addServer(MEMTEST_HOST, MEMTEST_PORT); } else { self::$instance->addServer(MEM_HOST, MEM_PORT); } } return self::$instance; } } But I think in PHP resource handles will be released and initialized again every time after a request over. That means MemcacheService::getInstance() is totally equal new Memcached() which cannot be called singleton pattern at all. Please correct me if I'm wrong. Regards

    Read the article

  • Add a loading graphic jquery

    - by sea_1987
    I am using the jquery ajax api so load in some content, the code looks like this, $.ajax({ type:"POST", url:"/search/location", data: getQuery, success:function(data){ //alert(getQuery); //console.log(data); $('body.secEmp').html(data); //overwrite current data setUpRegionCheckBoxes(); //fire function again to reload DOM } }); In my HTML i have <div id="loading">Loading Content</div> this is has a css style on it of display:none, while my ajax is bring in the content I want to show the div that is hidden, but I cant find a away too have tried attaching .ajaxStart on my loading div then doing show() but that did not work. Any advice?

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • fb.init events when initialized

    - by oshafran
    Hi I have this code window.fbAsyncInit = function() { FB.init({ appId: 'balblablablbal', status: true, cookie: true, xfbml: false }); }; (function() { var e = document.createElement('script'); e.src = document.location.protocol + '//connect.facebook.net/en_US/all.js'; e.async = true; document.getElementById('fb-root').appendChild(e); } ()); I would like to do something only after those JSs have been loaded (i.e. hook on FB.init event) How can I do that thanks

    Read the article

  • Anova test in the loop and outputing the p-value in separate column

    - by Juanhijuan
    Once again I'm trying to get an answer. I am already stuck for like 5h with that so that's why I keep trying to get an answer. That's my data: id Sequence variable value 75 AAAAGAAAVANQGKK BiotinControl1_2 3893050.50 192 AAAAGAAAVANQGKK BiotinControl1_2 900604.61 3770 AAFTKLDQVWGSE BiotinControl1_2 90008.14 The code which I am trying to use to calculate the p-value: My Code: tbl_anv <- tbl_all_onlyK[,c("id", "BiotinControl1_2", "BiotinControl2", "BiotinControl3", "BiotinTreatment1_2", "BiotinTreatment2", "BiotinTreatment3", "Sequence")] tbl_reo <- melt(tbl_anv, measure.vars=2:7) set.seed(1) vars <- c("id", "BiotinControl1_2", "BiotinControl2", "BiotinControl3", "BiotinTreatment1_2", "BiotinTreatment2", "BiotinTreatment3", "Sequence") tbl_reo <- as.data.frame(tbl_reo) by(tbl_reo,tbl_reo$Sequence,function(x){ anova(lm(value ~ variable, data = x))$"Pr(>F)"[1] }) An error ocurs: There were 50 or more warnings (use warnings() to see the first 50) Anyway, how can I do that and export the p-value in the separate column. That's what I tried to do on my own: aov_test <- by(tbl_reo,tbl_reo$Sequence,function(x){ anova(lm(value ~ variable, data = x))$"Pr(>F)"[1] }) tbl_reo[,5] <- aov.test[[1]]$'Pr(>F)'[1]

    Read the article

  • jQuery Plugin with $.getJSON Returning undefined?

    - by Oscar Godson
    Inside of a jQuery plugin I made I have: $.getJSON(base_url,{ agenda_id:defaults.id, action:defaults.action+defaults.type, output:defaults.output },function(json){ return json; }); And in a separate JS file (yes, it comes after the plugin): json = $('#agenda-live-preview').agenda({action:'get',type:'agenda',output:'json'}); alert(json[0].agenda_id); If i do the above $.getJSON and put an alert inside of the $.getJSON it works and returns "3", which is correct. If I do it like the json=$('#agenda-live-preview').agenda(...)... it returns undefined. My JSON is valid, and the json[0].agenda_id is correct also, I know it's in a callback, so how do I get the stuff inside of a callback in a function return?

    Read the article

< Previous Page | 630 631 632 633 634 635 636 637 638 639 640 641  | Next Page >