Search Results

Search found 37844 results on 1514 pages for 'function composition'.

Page 632/1514 | < Previous Page | 628 629 630 631 632 633 634 635 636 637 638 639  | Next Page >

  • How does one avoid "Value restriction" errors with F#'s Seq.cast?

    - by gatoatigrado
    I see that Seq has a cast function from IEnumerable to Seq, but how do I get it to work? open System.Text.RegularExpressions;; let v = Regex.Match("abcd", "(ab)");; Seq.cast (v.Captures);; This produces, error FS0030: Value restriction. The value 'it' has been inferred to have generic type val it : seq<'_a Either define 'it' as a simple data term, make it a function with explicit arguments or, if you do not intend for it to be generic, add a type annotation.

    Read the article

  • jQuery click event still firing on filtered element

    - by Phil.Wheeler
    I'm trying to filter button events based on whether they have a CSS class assigned to them or not. Assume I have a button like this: <button id="save-button" class="ui-state-default ui-corner-all">Save</button> I want to get jQuery to select all buttons that currently do not have a class of "ui-state-disabled". The selector I'm using looks like this: $('#save-button:not(.ui-state-disabled)').click(function() { ... }); When the button is clicked, I'll call a different function, do some stuff and then add the class 'ui-state-disabled' to the button. However the button still continues to accept click events. I'm guessing this is because of two possible causes: The event binder looks only at the initial state when binding the click event and doesn't recognise that a new class has been added later on My filter ['... :not(.ui-state-disabled)] is not correct Any observations?

    Read the article

  • Zend Framework modular app, can't load models for each module, autoloading models?

    - by EricP
    Is there a way to have models for each module? I have 3 modules, one is a "contacts" module. I created a model for it in modules/contacts/models/Codes.php Codes Controller class Contacts_CodesController extends Zend_Controller_Action { public function init() { /* Initialize action controller here */ $this->view->messages = $this->_helper->flashMessenger->getMessages(); } public function indexAction() { $codesTable = new Contacts_Model_Codes(); } Codes Model: class Contacts_Model_Codes extends Zend_Db_Table { protected $_name = 'codes'; } The error I get: Fatal error: Class 'Contacts_Model_Codes' not found in /Applications/MAMP/htdocs/zf_site/application/modules/contacts/controllers/CodesController.php on line 26 thanks

    Read the article

  • Using jQuery to find keywords in string

    - by Nic Hubbard
    In php, I have used preg_match_all() to find keywords (using the format %keyword%) in a string, which works wonderfully and returns an array of all found keywords. What I would like to do, is do the same thing using jQuery or javascript. I have tried using the filter() function, and it kind of works. But I think I am missing something. How can I find ALL instances of the keyword in a string, using a regex? Here is what I have worked out so far: $("[id^='editableContent-']").filter(function() { alert($(this).html().match(/\%(.*?)\%/)); }); Any suggestions are welcome!

    Read the article

  • JPA Inheritance and Relations - Clarification question

    - by Michael
    Here the scenario: I have a unidirectional 1:N Relation from Person Entity to Address Entity. And a bidirectional 1:N Relation from User Entity to Vehicle Entity. Here is the Address class: @Entity public class Address implements Serializable { private static final long serialVersionUID = 1L; @Id @GeneratedValue(strategy = GenerationType.AUTO) privat Long int ... The Vehicles Class: @Entity public class Vehicle implements Serializable { @Id @GeneratedValue(strategy = GenerationType.AUTO) private Long id; @ManyToOne private User owner; ... @PreRemove protected void preRemove() { //this.owner.removeVehicle(this); } public Vehicle(User owner) { this.owner = owner; ... The Person Class: @Entity @Inheritance(strategy = InheritanceType.JOINED) @DiscriminatorColumn(name="PERSON_TYP") public class Person implements Serializable { @Id protected String username; @OneToMany(cascade = CascadeType.ALL, orphanRemoval=true) @JoinTable(name = "USER_ADDRESS", joinColumns = @JoinColumn(name = "USERNAME"), inverseJoinColumns = @JoinColumn(name = "ADDRESS_ID")) protected List<Address> addresses; ... @PreRemove protected void prePersonRemove(){ this.addresses = null; } ... The User Class which is inherited from the Person class: @Entity @Table(name = "Users") @DiscriminatorValue("USER") public class User extends Person { @OneToMany(mappedBy = "owner", cascade = {CascadeType.PERSIST, CascadeType.REMOVE}) private List<Vehicle> vehicles; ... When I try to delete a User who has an address I have to use orphanremoval=true on the corresponding relation (see above) and the preRemove function where the address List is set to null. Otherwise (no orphanremoval and adress list not set to null) a foreign key contraint fails. When i try to delete a user who has an vehicle a concurrent Acces Exception is thrown when do not uncomment the "this.owner.removeVehicle(this);" in the preRemove Function of the vehicle. The thing i do not understand is that before i used this inheritance there was only a User class which had all relations: @Entity @Table(name = "Users") public class User implements Serializable { @Id protected String username; @OneToMany(mappedBy = "owner", cascade = {CascadeType.PERSIST, CascadeType.REMOVE}) private List<Vehicle> vehicles; @OneToMany(cascade = CascadeType.ALL) @JoinTable(name = "USER_ADDRESS", joinColumns = @JoinColumn(name = "USERNAME") inverseJoinColumns = @JoinColumn(name = "ADDRESS_ID")) ptivate List<Address> addresses; ... No orphanremoval, and the vehicle class has used the uncommented statement above in its preRemove function. And - I could delte a user who has an address and i could delte a user who has a vehicle. So why doesn't everything work without changes when i use inheritance? I use JPA 2.0, EclipseLink 2.0.2, MySQL 5.1.x and Netbeans 6.8

    Read the article

  • what is the return value of BeautifulSoup.find ?

    - by prosseek
    I run to get some value as score. score = soup.find('div', attrs={'class' : 'summarycount'}) I run 'print score' to get as follows. <div class=\"summarycount\">524</div> I need to extract the number part. I used re module but failed. m = re.search("[^\d]+(\d+)", score) TypeError: expected string or buffer function search in re.py at line 142 return _compile(pattern, flags).search(string) What's the return type of the find function? How to get the number from the score variable? Is there any easy way to let BeautifulSoup to return the value(in this case 524) itself?

    Read the article

  • How to get the first non-null value in Java?

    - by froadie
    Is there a Java equivalent of SQL's COALESCE function? That is, is there any way to return the first non-null value of several variables? e.g. Double a = null; Double b = 4.4; Double c = null; I want to somehow have a statement that will return the first non-null value of a, b, and c - in this case, it would return b, or 4.4. (Something like the sql method - return COALESCE(a,b,c)). I know that I can do it explicitly with something like: return a != null ? a : (b != null ? b : c) But I wondered if there was any built-in, accepted function to accomplish this.

    Read the article

  • Why I am not getting Row value on click using this?

    - by rockers
    $("#grid td:first-child").click(function() { var value = $(this).closest('tr').find('td:eq(2)').text(); // for third column alert(value); var value = $(this).closest('tr').find('td:eq(3)').text(); // for fourth column alert(value); var AccountName = accountid; var x = function() { $(this).click($("#showregiongrid").load('/analyst/ror/regionspeexc/?a=' + AccountName)); } clickTimer = window.setTimeout(x, 300); }); Why i am not getting the row values of eq(2) and eq(3).. is there anyting I am doing wrong? if I delete td:first-child from my click event I am getting null vallues on popup? thanks

    Read the article

  • Safari javascript cookie issue

    - by Aaron Moodie
    I've hit a bit of a weird issue in Safari in regards to setting a js cookie. The cookie itself is just a rgb colour value, which gets set using .click(), and is working fine in Chrome and Firefox, yet in Safari the value of the cookie is incomplete, showing up as rgb(193 instead of rgb(193, 184, 76) as the other browsers do. The jQuery function I'm using to set the cookie is: $('.project_link a').click(function() { var link_colour = $(this).css("color"); document.cookie = "colour="+link_colour+";expires=;path=/"; });

    Read the article

  • Slider with keypress control bugs when keys pressed to quickly.

    - by Jaybuz
    Hello, I've made a slider that uses the left and right arrow keys to move the slide but when pressed to quickly it will bug a little and I was wondering if it's possible to limit the amount of presses in say a second. You can see it here: {link} $('#slider-nav div').click(function() { $('#slider-nav div').removeClass('selected').addClass(''); $('#slider-nav div:eq('+($.jcarousel.intval($(this).text())-1)+')').addClass('selected'); }) // Allow left and right keys to control slider $(document.documentElement).keypress(function(e) { var code = (e.keyCode ? e.keyCode : e.which); var direction = null; // handle cursor keys if (code == 37) { // left key direction = 'prev'; } else if (code == 39) { // right key direction = 'next'; } if (direction != null) { $('#slider-nav div.selected')[direction]().click(); } });

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • [PHP] preg_replace: replacing using %

    - by Juan
    Hi all, I'm using the function preg_replace but I cannot figure out how to make it work, the function just doesn't seem to work for me. What I'm trying to do is to convert a string into a link if any word contains the % (percentage) character. For instance if I have the string "go to %mysite", I'd like to convert the mysite word into a link. I tried the following... $data = "go to %mysite"; $result = preg_replace('/(^|[\s\.\,\:\;]+)%([A-Za-z0-9]{1,64})/e', '\\1%<a href=#>\\2</a>', $data); ...but it doesn't work. Any help on this would be much appreciated. Thanks Juan

    Read the article

  • Inverse relationship of two variables

    - by Jam
    this one is maybe pretty stupid.. Or I am just exhausted or something, but I just cant seem to solve it.. Problem : two variables X and Y, value of Y is dependent on value of X. X can have values ranging from some value to some value (lets say from 0 to 250) and y can have different values (lets say from 0.1 to 1.0 or something..) - but it is inverse relatonship (what I mean is: if value of X is e.g. 250, then value of Y would be 0.1 and when X decreases up to 0, value of Y raises up to 1.0.. So how should I do it? lets say I have function: -- double computeValue (double X) { /computation/ return Y; } Also, is there some easy way to somehow make the scaling of the function not so linear? - For example when X raises, Y decreases slower at first but then more rapidly in the end.. (rly dont know how to say it but I hope you guys got it) Thanks in advance for this stupid question :/

    Read the article

  • How modify ascii table in C?

    - by drigoSkalWalker
    like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ascii sequence in this function and when it return, the ascii sequence back to the original. thanks in advance!

    Read the article

  • How does an interpreter switch scope?

    - by Dox
    I'm asking this because I'm relatively new to interpreter development and I wanted to know some basic concepts before reinventing the wheel. I thought of the values of all variables stored in an array which makes the current scope, upon entering a function the array is swapped and the original array put on some sort of stack. When leaving the function the top element of the "scope stack" is popped of and used again. Is this basically right? Isn't swapping arrays (which means moving around a lot of data) not very slow and therefore not used by modern interpreters?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • Mocking imported modules in Python

    - by Evgenyt
    I'm trying to implement unit tests for function that uses imported external objects. For example helpers.py is: import os import pylons def some_func(arg): ... var1 = os.path.exist(...) var2 = os.path.getmtime(...) var3 = pylons.request.environ['HTTP_HOST'] ... So when I'm creating unit test for it I do some mocking (minimock in my case) and replacing references to pylons.request and os.path: import helpers def test_some_func(): helpers.pylons.request = minimock.Mock("pylons.request") helpers.pylons.request.environ = { 'HTTP_HOST': "localhost" } helpers.os.path = minimock.Mock(....) ... some_func(...) # assert ... This does not look good for me. Is there any other better way or strategy to substitute imported function/objects in Python?

    Read the article

  • Global javascript variable inside ready

    - by w0rldart
    Which is the right way of declaring a global javascript variable? The way I'm trying it, doesn't work $(document).ready(function() { var intro; if ($('.intro_check').is(':checked')) { intro = true; $('.intro').wrap('<div class="disabled"></div>'); }; $('.intro_check').change(function(){ if(this.checked) { intro = false; $('.enabled').removeClass('enabled').addClass('disabled'); } else { intro = true; if($('.intro').exists()) { $('.disabled').removeClass('disabled').addClass('enabled'); } else { $('.intro').wrap('<div class="disabled"></div>'); } } }); }); console.log(intro);

    Read the article

  • iPad javascript scrolling

    - by davids
    I'd like to get the same behaviour of the native javascript scrollTo function in iPad, just attaching a function to the swipe event and scrolling the content a specific number of pixels. That doesn't work in iPad using scrollTo or several different jquery plugins, like scrollTo or iScroll. I think I'm having problems because I'm working with an iframe, as I have another html document in it, with its body divided in columns, but I'm just showing the first one. The point of all this is that, after swiping, it should show the next/prev column, and I tried scrolling the iframe window or the inner's html body, which actually works in chrome, but it doesn't in iPad.

    Read the article

  • PHP combobox can't save the selected value on Edit Page

    - by bEtTy Barnes
    hello I've got problem with my combobox. It's not saving the selected value in Edit page. Here what I'm working with: private function inputCAR(){ $html = ""; $selectedId = $this->CAR; //$html .= '<option value="Roadmap Accelerator - Core">Roadmap Accelerator - Core</option>'; //$html .= '<option value="Roadmap Accelerator - Optional Core">Roadmap Accelerator - Optional Core</option>'; //$html .= '<option value="Regulatory">Regulatory</option>'; //$html .= '<option value="Mission Critical">Mission Critical</option>'; //$html .= '<option value="Various CARs/Types">Various CARs/types</option>'; $selection = array( "Roadmap Accelerator - Core", "Roadmap Accelerator - Optional Core", "Regulatory", "Mission Critical", "Various CARs/types" ); $html .= '<label for="car">CAR Type</label>'; $html .= HTML::selectStart("car"); foreach($selection as $value){ $text = $value; $html .= HTML::option($value, $text, $selectedId == $value ? true : false); } $html .= HTML::selectEnd(); return $html; } My option function: public static function option($value, $text, $isSelected=false) { $html = '<option value="' . $value . '"'; if($isSelected) { $html .= ' selected="selected"'; } $html .= '>'; $html .= $text; $html .= '</option>'; return $html; } When I first created a record. The selected value from my combobox got saved into the DB then the page refreshed to display. When I went to edit page, to select another value, and clicked save button. On the display page, it's not saving. For example. on Create page I selected Regulatory. then I changed my mind and changed it to Mission Critical on Edit page. On display page it is not changed. I don't know what's wrong or what I'm missing here. Any help is welcome and truly appreciated. Thanks.

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • flash cs4 file reference. Event.COMPLETE not called on a MAC,

    - by jobbie jones
    Hi, I am working with a fileReference, however I'm having issues running on Safari on a MAC... EDIT The below example also doesnt work on Safari on a MAC... http://www.permadi.com/blog/2010/06/flash-as3-using-filereference-to-load-files-example-for-flash-cs4-and-above/ # The workflow on a PC runs as such: 1) Create file reference 2) attach addEventListener's for Event.SELECT and Event.COMPLETE 3) call the browse() method On a PC, Event.SELECT is fired when a file has been selected. Event.COMPLETE is fired when the file data is available to flash. If I select an 500meg file, it takes a few seconds before Event.COMPLETE is fired. If I attempt to access the file data properties (such as reading the data stream) before Event.COMPLETE is fired, I receive null reference errors... So far so good. However, on a MAC (speficially Safari, not tested other browsers), the Event.COMPLETE is not fired. I have checked the Adobe docs, which say Event.COMPLETE is fired when the upload is completed. So why does it get fired on windows when the fileReference has parsed the file, but the upload method has not yet been called... Can anyone help? Here's snippets of the code I am working on: public function browseFile(target:Object):void { var imagesFilter:FileFilter = new FileFilter("Allowed files", "*.jpg;*.bmp;*.flv;"); fileReference.browse([imagesFilter]); fileReference.addEventListener(Event.SELECT, fileSelect); fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); } private function fileSelect(event:Event):void { // update label - IMPORTANT for large files as there's a delay while flash parses file, before control is handed back to this script... setStatusLabel("...loading file"); var fileReference:FileReference = event.target as FileReference; fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); // load the file into the fileReference object fileReference.load(); } // Called when upload file has been processed by flash (a few secs for large files, or fileRef.data is null...) private function fileSelectComplete(event:Event):void { var fileReference:FileReference=event.target as FileReference; trace("ready to do things - but not fired on Safari on a MAC "); }

    Read the article

  • Fullscreen image with jquery on window resize?

    - by lauthiamkok
    I am trying to make fullscreen images with jquery when the window resize function is triggered. But I get this kind of result - where you can see a gap at the bottom of the image which I don't know how to fix it. the basic html, <!-- container --> <div id="container" class="container"> <div class="holder-supersize" id="supersize"> <ul class="background-supersize"> <li><a href="#"><img src="styles/images/IMG_0250.jpg" alt="" width="1000" height="667" /></a></li> <li><a href="#"><img src="styles/images/IMG_0255.jpg" alt="" width="667" height="1000" /></a></li> <li class="active"><a href="#"><img src="styles/images/IMG_0323.jpg" alt="" width="1158" height="772" /></a></li> </ul> </div> </div> <!-- container --> jquery for updating image size on window resize, $(document).ready(function(){ $(window).resize(function(){ $(".holder-supersize").each(function() { //Define image ratio & minimum dimensions var minwidth = .5*(640); var minheight = .5*(480); var ratio = 480/640; //Gather browser and current image size var imagewidth = $(this).width(); var imageheight = $(this).height(); var browserwidth = $(window).width(); var browserheight = $(window).height(); //Check for minimum dimensions if ((browserheight < minheight) && (browserwidth < minwidth)){ $(this).height(minheight); $(this).width(minwidth); } else { //When browser is taller if (browserheight > browserwidth){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); if (browserwidth > imagewidth){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); } } //When browser is wider if (browserwidth >= browserheight){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); if (browserheight > imageheight){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); } } } return false; }); }); }); CSS for supersize image /* Supersize -------------------------------------------*/ .holder-supersize { width:100%; height:100%; position:absolute; left:0; top:0; z-index:0; } .background-supersize { width:100%; height:100%; overflow:hidden; position:relative; } .background-supersize li { width:100%; height:100%; overflow:hidden; position:absolute; left:0; top:0; text-align:center; } .background-supersize li img { /* for image with height < width */ /**/ width:100%; height:auto; /* for image with height > width */ /* width:auto; height:100%; */ } .background-supersize li , .background-supersize a, .background-supersize img{ display:none; } .background-supersize .active, .background-supersize .active a, .background-supersize .active img{ display:inline; } This is the link at jsfiddle and this is the link to see the actual product. Any ideas what I have done wrong and how can I fix it?

    Read the article

< Previous Page | 628 629 630 631 632 633 634 635 636 637 638 639  | Next Page >