Search Results

Search found 17621 results on 705 pages for 'just my correct opinion'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 655/705 | < Previous Page | 651 652 653 654 655 656 657 658 659 660 661 662  | Next Page >

  • Android library to get pitch from WAV file

    - by Sakura
    I have a list of sampled data from the WAV file. I would like to pass in these values into a library and get the frequency of the music played in the WAV file. For now, I will have 1 frequency in the WAV file and I would like to find a library that is compatible with Android. I understand that I need to use FFT to get the frequency domain. Is there any good libraries for that? I found that [KissFFT][1] is quite popular but I am not very sure how compatible it is on Android. Is there an easier and good library that can perform the task I want? EDIT: I tried to use JTransforms to get the FFT of the WAV file but always failed at getting the correct frequency of the file. Currently, the WAV file contains sine curve of 440Hz, music note A4. However, I got the result as 441. Then I tried to get the frequency of G4, I got the result as 882Hz which is incorrect. The frequency of G4 is supposed to be 783Hz. Could it be due to not enough samples? If yes, how much samples should I take? //DFT DoubleFFT_1D fft = new DoubleFFT_1D(numOfFrames); double max_fftval = -1; int max_i = -1; double[] fftData = new double[numOfFrames * 2]; for (int i = 0; i < numOfFrames; i++) { // copying audio data to the fft data buffer, imaginary part is 0 fftData[2 * i] = buffer[i]; fftData[2 * i + 1] = 0; } fft.complexForward(fftData); for (int i = 0; i < fftData.length; i += 2) { // complex numbers -> vectors, so we compute the length of the vector, which is sqrt(realpart^2+imaginarypart^2) double vlen = Math.sqrt((fftData[i] * fftData[i]) + (fftData[i + 1] * fftData[i + 1])); //fd.append(Double.toString(vlen)); // fd.append(","); if (max_fftval < vlen) { // if this length is bigger than our stored biggest length max_fftval = vlen; max_i = i; } } //double dominantFreq = ((double)max_i / fftData.length) * sampleRate; double dominantFreq = (max_i/2.0) * sampleRate / numOfFrames; fd.append(Double.toString(dominantFreq)); Can someone help me out? EDIT2: I manage to fix the problem mentioned above by increasing the number of samples to 100000, however, sometimes I am getting the overtones as the frequency. Any idea how to fix it? Should I use Harmonic Product Frequency or Autocorrelation algorithms?

    Read the article

  • C++: Templates for static functions?

    - by Rosarch
    I have a static Utils class. I want certain methods to be templated, but not the entire class. How do I do this? This fails: #pragma once #include <string> using std::string; class Utils { private: template<class InputIterator, class Predicate> static set<char> findAll_if_rec(InputIterator begin, InputIterator end, Predicate pred, set<char> result); public: static void PrintLine(const string& line, int tabLevel = 0); static string getTabs(int tabLevel); template<class InputIterator, class Predicate> static set<char> Utils::findAll_if(InputIterator begin, InputIterator end, Predicate pred); }; Error: utils.h(10): error C2143: syntax error : missing ';' before '<' utils.h(10): error C4430: missing type specifier - int assumed. Note: C++ does not support default-int utils.h(10): error C4430: missing type specifier - int assumed. Note: C++ does not support default-int utils.h(10): error C2238: unexpected token(s) preceding ';' utils.h(10): error C2988: unrecognizable template declaration/definition utils.h(10): error C2059: syntax error : '<' What am I doing wrong? What is the correct syntax for this? Incidentally, I'd like to templatize the return value, too. So instead of: template<class InputIterator, class Predicate> static set<char> findAll_if_rec(InputIterator begin, InputIterator end, Predicate pred, set<char> result); I'd have: template<class return_t, class InputIterator, class Predicate> static return_t findAll_if_rec(InputIterator begin, InputIterator end, Predicate pred, set<char> result); How would I specify that: 1) return_t must be a set of some sort 2) InputIterator must be an iterator 3) InputIterator's type must work with return_t's type. Thanks.

    Read the article

  • Template function as a template argument

    - by Kos
    I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

    Read the article

  • printf anomaly after "fork()"

    - by pechenie
    OS: Linux, Language: pure C I'm moving forward in learning C progpramming in general, and C programming under UNIX in a special case :D So, I detected a strange (as for me) behaviour of the printf() function after using a fork() call. Let's take a look at simple test program: #include <stdio.h> #include <system.h> int main() { int pid; printf( "Hello, my pid is %d", getpid() ); pid = fork(); if( pid == 0 ) { printf( "\nI was forked! :D" ); sleep( 3 ); } else { waitpid( pid, NULL, 0 ); printf( "\n%d was forked!", pid ); } return 0; } In this case the output looks like: Hello, my pid is 1111 I was forked! :DHello, my pid is 1111 2222 was forked! Why the second "Hello" string occured in the child's output? Yes, it is exactly what the parent printed on it's start, with the parent's pid. But! If we place '\n' character in the end of each string we got the expected output: #include <stdio.h> #include <system.h> int main() { int pid; printf( "Hello, my pid is %d\n", getpid() ); // SIC!! pid = fork(); if( pid == 0 ) { printf( "I was forked! :D" ); //removed the '\n', no matter sleep( 3 ); } else { waitpid( pid, NULL, 0 ); printf( "\n%d was forked!", pid ); } return 0; } And the output looks like: Hello, my pid is 1111 I was forked! :D 2222 was forked! Why does it happen? Is it ... ummm ... correct behaviour? Or it's a kind of the 'bug'?

    Read the article

  • Changing Data in ListView

    - by legr3c
    Hi In my app I use a ListView to display data from the database. The data changes sometimes, for example when the user applies new filters or changes the sorting method. I use AsyncTask to get the databsase cursor that points to the new data set because sometimes data needs to be loaded from the net which can take some time. What I do now looks something like this: private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); mCursorAdapter = new MyCustomCursorAdapter(MyActivity.this, mCursor); mListView.setAdapter(mCursorAdapter); } } } This works so far but I realize that creating a new CursorAdapter and calling setAdapter on my ListView each time isn't the correct way to do it. Also, after setAdapter the scroll position of the list is set back to the top. I found this post which describes how to do it properly. So now I want to do something like this: onCreate(){ // ... // create the CursorAdapter using null as the initial cursor MyCustomCursorAdapter cursorAdapter = new MyCustomCursorAdapter(this, null); mListView.setAdapter(cursorAdapter); // ... } private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ // this returns null! MyCustomCursorAdapter cursorAdapter = (MyCustomCursorAdapter)mListView.getAdapter(); Cursor oldCursor = cursorAdapter.getCursor(); if(oldCursor!=null){ MyActivity.this.stopManagingCursor(oldCursor); oldCursor.close(); } if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); cursorAdapter.changeCursor(mCursor); } } } This however doesn't work for me because (MyCustomCursorAdapter)mListView.getAdapter(); always returns null. Why does this happen? What am I doing wrong? Edit: Some additional information: my adapter implements SectionIndexer. I don't really think that this has anything to do with my problem but it has caused me some troubles before so I thought I'd mention it.

    Read the article

  • Makefile issue with compiling a C++ program

    - by Steve
    I recently got MySQL compiled and working on Cygwin, and got a simple test example from online to verify that it worked. The test example compiled and ran successfully. However, when incorporating MySQL in a hobby project of mine it isn't compiling which I believe is due to how the Makefile is setup, I have no experience with Makefiles and after reading tutorials about them, I have a better grasp but still can't get it working correctly. When I try and compile my hobby project I recieve errors such as: Obj/Database.o:Database.cpp:(.text+0x492): undefined reference to `_mysql_insert_id' Obj/Database.o:Database.cpp:(.text+0x4c1): undefined reference to `_mysql_affected_rows' collect2: ld returned 1 exit status make[1]: *** [build] Error 1 make: *** [all] Error 2 Here is my Makefile, it worked with compiling and building the source before I attempted to put in MySQL support into the project. The LIBMYSQL paths are correct, verified by 'mysql_config'. COMPILER = g++ WARNING1 = -Wall -Werror -Wformat-security -Winline -Wshadow -Wpointer-arith WARNING2 = -Wcast-align -Wcast-qual -Wredundant-decls LIBMYSQL = -I/usr/local/include/mysql -L/usr/local/lib/mysql -lmysqlclient DEBUGGER = -g3 OPTIMISE = -O C_FLAGS = $(OPTIMISE) $(DEBUGGER) $(WARNING1) $(WARNING2) -export-dynamic $(LIBMYSQL) L_FLAGS = -lz -lm -lpthread -lcrypt $(LIBMYSQL) OBJ_DIR = Obj/ SRC_DIR = Source/ MUD_EXE = project MUD_DIR = TestP/ LOG_DIR = $(MUD_DIR)Files/Logs/ ECHOCMD = echo -e L_GREEN = \e[1;32m L_WHITE = \e[1;37m L_BLUE = \e[1;34m L_RED = \e[1;31m L_NRM = \e[0;00m DATE = `date +%d-%m-%Y` FILES = $(wildcard $(SRC_DIR)*.cpp) C_FILES = $(sort $(FILES)) O_FILES = $(patsubst $(SRC_DIR)%.cpp, $(OBJ_DIR)%.o, $(C_FILES)) all: @$(ECHOCMD) " Compiling $(L_RED)$(MUD_EXE)$(L_NRM)."; @$(MAKE) -s build build: $(O_FILES) @rm -f $(MUD_EXE) $(COMPILER) -o $(MUD_EXE) $(L_FLAGS) $(O_FILES) @echo " Finished Compiling $(MUD_EXE)."; @chmod g+w $(MUD_EXE) @chmod a+x $(MUD_EXE) @chmod g+w $(O_FILES) $(OBJ_DIR)%.o: $(SRC_DIR)%.cpp @echo " Compiling $@"; $(COMPILER) -c $(C_FLAGS) $< -o $@ .cpp.o: $(COMPILER) -c $(C_FLAGS) $< clean: @echo " Complete compile on $(MUD_EXE)."; @rm -f $(OBJ_DIR)*.o $(MUD_EXE) @$(MAKE) -s build I like the functionality of the Makefile, instead of spitting out all the arguments etc, it just spits out the "Compiling [Filename]" etc. If I add -c to the L_FLAGS then it compiles (I think) but instead spits out stuff like: g++: Obj/Database.o: linker input file unused because linking not done After a full day of trying and research on google, I'm no closer to solving my problem, so I come to you guys to see if you can explain to me why all this is happening and if possible, steps to solve. Regards, Steve

    Read the article

  • Why does my Spring Controller direct me to the wrong page?

    - by kc2001
    I am writing my first Spring 3.0.5 MVC app and am confused about why my controller mappings aren't doing what I expect. I have a VerifyPasswordController that is called after a user tries to log in by entering his name and password. // Called upon clicking "submit" from /login @RequestMapping(value = "/verifyPassword", method = RequestMethod.POST) @ModelAttribute("user") public String verifyPassword(User user, BindingResult result) { String email = user.getEmail(); String nextPage = CHOOSE_OPERATION_PAGE; // success case if (result.hasErrors()) { nextPage = LOGIN_PAGE; } else if (!passwordMatches(email, user.getPassword())) { nextPage = LOGIN_FAILURE_PAGE; } else { // success } return nextPage; } I can verify in the debugger that this method is being called, but afterwards, the verifyPassword page is displayed rather than the chooseOperation page. The console output of WebLogic seems to show that my mapping are correct: INFO : org.springframework.web.servlet.mvc.annotation.DefaultAnnotationHandlerMapping - Mapped URL path [/chooseOperation] onto handler 'chooseOperationController' INFO : org.springframework.web.servlet.mvc.annotation.DefaultAnnotationHandlerMapping - Mapped URL path [/chooseOperation.*] onto handler 'chooseOperationController' INFO : org.springframework.web.servlet.mvc.annotation.DefaultAnnotationHandlerMapping - Mapped URL path [/chooseOperation/] onto handler 'chooseOperationController' Here is the ChooseOperationController: @Controller @SessionAttributes("leaveRequestForm") public class ChooseOperationController implements PageIfc, AttributeIfc { @RequestMapping(value = "/chooseOperation") @ModelAttribute("leaveRequestForm") public LeaveRequest setUpLeaveRequestForm( @RequestParam(NAME_ATTRIBUTE) String name) { LeaveRequest form = populateFormFromDatabase(name); return form; } // helper methods omited } I welcome any advice, particularly "generic" techniques for debugging such mapping problems. BTW, I've also tried to "redirect" to the desired page, but got the same result. servlet-context.xml: <?xml version="1.0" encoding="UTF-8"?> <beans:beans xmlns="http://www.springframework.org/schema/mvc" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:beans="http://www.springframework.org/schema/beans" xmlns:context="http://www.springframework.org/schema/context" xsi:schemaLocation=" http://www.springframework.org/schema/mvc http://www.springframework.org/schema/mvc/spring-mvc-3.0.xsd http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-3.0.xsd http://www.springframework.org/schema/context http://www.springframework.org/schema/context/spring-context-3.0.xsd"> <!-- DispatcherServlet Context: defines this servlet's request-processing infrastructure --> <!-- Enables the Spring MVC @Controller programming model --> <annotation-driven /> <!-- Handles HTTP GET requests for /resources/** by efficiently serving up static resources in the ${webappRoot}/resources directory --> <resources mapping="/resources/**" location="/resources/" /> <!-- Resolves views selected for rendering by @Controllers to .jsp resources in the /WEB-INF/views directory --> <beans:bean class="org.springframework.web.servlet.view.InternalResourceViewResolver"> <beans:property name="prefix" value="/WEB-INF/views/" /> <beans:property name="suffix" value=".jsp" /> </beans:bean> <context:component-scan base-package="com.engilitycorp.leavetracker" /> <beans:bean id="leaveRequestForm" class="com.engilitycorp.leavetracker.model.LeaveRequest" /> </beans:beans> The constants: String LOGIN_FAILURE_PAGE = "loginFailure"; String LOGIN_PAGE = "login"; String CHOOSE_OPERATION_PAGE = "chooseOperation";

    Read the article

  • NSArraycontroller selectionIndexes bindings

    - by Michael Scherbaum
    Hi all, I have the following set-up: A Window that has a splitView in which I display I NSCollectionView in the left view and a detailView in the right view. Both views are set-up in separate xibs. Furthermore I have a Datacontroller (of class NSArrayController) that manages a mutable Array of NSMutableDictionaries (moviesForChoice). The dataController is set-up as application delegate. The movie objects in the array have properties like (name, plot, genre etc.) so far so good... In the xib for the NScollectionview I bound a NSArraycontroller content property to my datacontroller via Application.delegate.moviesForChoice The collectionView accesses the arraycontroller.arrrangedObjects and arraycontroller.selectionIndexes. This works fine the contents are displayed and the selection works fine in the collectionview (my collectionviewItem renders a selection color) In the xib for the detailView I want to display information for the selected object in the collectionview. Therefore I also added an arraycontroller to the xib, bound the content aray to Application.delegate.moviesForChoice and bound the NSTextfields in the view to e.g. arraycontroller.selection.name Here comes my issue: everytime I open the window with the two xibs, my collectionview displays all movies that are for choice correctly, and the detailview displays the information for the 1st object in my collectionview. Whenever I click on a different movie in the collectionView the res. item renders a selection color, but the detailView doesn't update. My understanding of it would be that the DataController is not informed about updates in the selectionIndexes and can therefore not trigger an update in the detailView. Correct me if I'm wrong... To remedy this I tried to bind the selectionIndexes property of the arraycontroller in the collectionView xib to Application.delegate.moviesForChoice.selecionIndexes but this failed with: addObserver:forKeyPath:options:context:] is not supported. Key path: selectionIndexes I could imagine that this means that the datacontroller is not KVO compliant for my Array moviesForChoice, but I implemented the following methods for it: -(void)insertObject:(NSDictionary *)dict inMoviesForChoiceAtIndex:(NSUInteger)index { [moviesForChoice insertObject:dict atIndex:index]; } -(void)removeObjectFromMoviesForChoiceAtIndex:(NSUInteger)index { [moviesForChoice removeObjectAtIndex:index]; } -(void)setMoviesForChoice:(NSMutableArray *)a { moviesForChoice = a; } -(NSArray*)moviesForChoice { return moviesForChoice; } -(NSUInteger)countOfMoviesForChoice { return [moviesForChoice count]; } - (void)addMovieForChoiceObject:(Movie *)anObject { [moviesForChoice addObject:anObject]; } So where am I wrong? How do I correctly bind to the selectionIndexes? You help is much appreciated! M

    Read the article

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • Why won't C# accept a (seemingly) perfectly good Sql Server CE Query?

    - by VoidKing
    By perfectly good sql query, I mean to say that, inside WebMatrix, if I execute the following query, it works to perfection: SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER('o'), ''))) / len('o') AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%o%' UNION SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER('o'), ''))) / len('o') AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%o%' UNION SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER('o'), ''))) / len('o') AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%o%' Here i am using 'o' as a static search string to search upon. No problem, but not exeactly very dynamic. Now, when I write this query as a string in C# and as I think it should be (and even as I have done before) I get a server-side error indicating that the string was not in the correct format. Here is a pic of that error: And (although I am only testing the output, should I get it to quit erring), here is the actual C# (i.e., the .cshtml) page that queries the database: @{ Layout = "~/Layouts/_secondaryMainLayout.cshtml"; var db = Database.Open("Content"); string searchText = Request.Unvalidated["searchText"]; string selectQueryString = "SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER(@0), ''))) / len(@0) AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%' + @0 + '%'"; @:beginning <br/> foreach (var row in db.Query(selectQueryString, searchText)) { @:entry @:@row.location &nbsp; @:@row.occurences &nbsp; @:@row.tableName <br/> } } Since it is erring on the foreach (var row in db.Query(selectQueryString, searchText)) line, that heavily suggests that something is wrong with my query, however, everything seems right to me about the syntax here and it even executes to perfection if I query the database (mind you, un-parameterized) directly. Logically, I would assume that I have erred somewhere with the syntax involved in parameterizing this query, however, my double and triple checking (as well as, my past experience at doing this) insists that everything looks fine here. Have I messed up the syntax involved with parameterizing this query, or is something else at play here that I am overlooking? I know I can tell you, for sure, as it has been previously tested, that the value I am getting from the query string is, indeed, what I would expect it to be, but as there really isn't much else on the .cshtml page yet, that is about all I can tell you.

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • delphi vs c# post returns different strings - utf problem?

    - by argh
    I'm posting two forms - one in c# and one in delphi. But the result string seems to be different: c# returns: ¤@@1@@@@1@@@@1@@xsm˱Â0Ð... delphi returns: #$1E'@@1@@@@1@@@@1@@x'#$009C... and sice both are compressed streams I'm getting errors while trying to decompress it... The C# is 'correct' - ie. extracts. I'm not an expert on delphi - I just need to convert some piece of code from c# to delphi. c# code: string GetData(Hashtable aParam, string ServerURL) { string Result = ""; WebRequest Request = HttpWebRequest.Create(ServerURL); Request.Method = "POST"; Request.ContentType = "application/x-www-form-urlencoded; charset=UTF-8"; UTF8Encoding encUTF8 = new System.Text.UTF8Encoding(false); StreamWriter writer = new StreamWriter(Request.GetRequestStream(), encUTF8); foreach (DictionaryEntry element in aParam) { writer.Write(element.Key + "=" + element.Value + "&"); } writer.Close(); writer.Dispose(); WebResponse Response = Request.GetResponse(); StreamReader Reader = new StreamReader(Response.GetResponseStream(), System.Text.Encoding.Default); Result = Reader.ReadToEnd(); Reader.Close(); Response.Close(); Reader.Dispose(); return Result; } delphi code: function GetData(aParam:TStringList; ServerURL:string):string; var req: TIdHTTP; res: string; begin req := TIdHTTP.Create(); with req do begin Request.ContentType := 'application/x-www-form-urlencoded; charset=UTF-8'; Request.Method := 'POST'; Request.CharSet := 'utf-8'; Request.AcceptCharSet := 'utf-8'; res := Post(ServerURL, aParam); end; Result := res; req.Free; end; -edit- I'm using delphi 2010

    Read the article

  • Absolute Xpath to get list of childnodes?

    - by Googler
    Hi this my xml file, <?xml version="1.0"?> <worldpatentdata xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <meta name="elapsed-time" value="329" xmlns="http://ops.epo.org"/> <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> </exchange-documents> </worldpatentdata> For the above xml file, i need the xpath to receive the childnodes below it: Output i need is : <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> I using Linq-Xml to get the following data: This is my Xpath and code: var list = doc1.XPathSelectElement("exchange-document"); I couldnt retreive the needed output.It returns null for the above code. Can anyone pls help on this by providing the correct xpath to retieve the child nodes. Else is there any other way to retrieve it.

    Read the article

  • Tab Bar disappears below the bottom of the screen

    - by Manu
    Hi, In my application I'm using a Navigation Controller to push one view that loads a Tab Bar Controller and a custom Navigation Bar as well. The problem is that the Tab Bar disappears below the bottom of the screen, and I don't know what's causing the problem. If I load a simple Tab Bar in the next view, it positions itself correctly... but what I need is a Tab Bar Controller, and in that case the Tab Bar disappears below the bottom. I have tried changing the view and size properties of the Tab Bar, but that did not solve the problem. I also realised that the images and text of the tabs don't show (I have set up the "favourites" and "contacts" images and text, and they are big enough and should be visible on the top side of the tab, but they are not). Both tabs work perfectly, by the way. There is an image here. I load the Tab Bar with the following code: - (void)viewDidLoad { [super viewDidLoad]; myTabBarController = [[UITabBarController alloc] init]; SettingsViewController* tab1 = [[SettingsViewController alloc] init]; AboutViewController* tab2 = [[AboutViewController alloc] init]; NSArray* controllers = [NSArray arrayWithObjects:tab1, tab2, nil]; myTabBarController.viewControllers = controllers; [self.view insertSubview:myTabBarController.view belowSubview:myNavigationBar]; } It doesn't matter if I remove the Navigation Bar or not. I have tested using this instead: [self.view addSubview:myTabBarController.view]; ... forgetting about the Navigation Bar, but the Tab Bar still goes under the bottom. I don't know if the problem is in one of my NIB files or in how I load the view (although I do this as I read in the Apple's SDK documentation). Any ideas? Another question would be... do you know how could I change the title of my Navigation Bar when I select the second tab? I imagine I would have to do it in viewDidLoad in AboutViewController.m, would that be correct? Thanks for you time!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • PHP & MySQL Undefined variable problem

    - by comma
    I keep getting the following error Undefined variable: id on line 91 can some one help me correct this problem? The error is on this line. $query2 = "INSERT INTO users_skills (skill_id, user_id, date_created) VALUES ('$id', '$user_id', NOW())"; MySQL database tables. CREATE TABLE tags ( id INT UNSIGNED NOT NULL AUTO_INCREMENT, skill VARCHAR(255) NOT NULL, experience VARCHAR(255) NOT NULL, years VARCHAR(255) NOT NULL, PRIMARY KEY (id) ); CREATE TABLE users_skills ( id INT UNSIGNED NOT NULL AUTO_INCREMENT, skill_id INT UNSIGNED NOT NULL, user_id INT UNSIGNED NOT NULL, date_created DATETIME UNSIGNED NOT NULL, PRIMARY KEY (id) ); Here is the PHP & MySQL code. if (isset($_POST['info_submitted'])) { $mysqli = mysqli_connect("localhost", "root", "", "sitename"); $dbc = mysqli_query($mysqli,"SELECT learned_skills.*, users_skills.* FROM learned_skills INNER JOIN users_skills ON learned_skills.id = users_skills.skill_id WHERE user_id='$user_id'"); if (!$dbc) { print mysqli_error($mysqli); return; } $user_id = '5'; $skill = $_POST['skill']; $experience = $_POST['experience']; $years = $_POST['years']; $mysqli = mysqli_connect("localhost", "root", "", "sitename"); $dbc = mysqli_query($mysqli,"SELECT learned_skills.*, users_skills.* FROM learned_skills INNER JOIN users_skills ON users_skills.skill_id = learned_skills.id WHERE users_skills.user_id='$user_id'"); if (mysqli_num_rows($dbc) == 0) { if (isset($_POST['skill']) && trim($_POST['skill'])!=='') { $mysqli = mysqli_connect("localhost", "root", "", "sitename"); $query1 = mysqli_query($mysqli,"INSERT INTO learned_skills (skill, experience, years) VALUES ('" . $skill . "', '" . $experience . "', '" . $years . "')"); if (mysqli_query($mysqli, $query1)) { print mysqli_error($mysqli); return; } $mysqli = mysqli_connect("localhost", "root", "", "sitename"); $dbc = mysqli_query($mysqli,"SELECT id FROM learned_skills WHERE id='" . $skill . "' AND experience='" . $experience . "' AND years='" . $years . "'"); if (!$dbc) { print mysqli_error($mysqli); } else { while($row = mysqli_fetch_array($dbc)){ $id = $row["id"]; } } $query2 = "INSERT INTO users_skills (skill_id, user_id, date_created) VALUES ('$id', '$user_id', NOW())"; } }

    Read the article

  • Weirdest occurrence ever, UIButton @selector detecting right button, doing wrong 'else_if'?

    - by Scott
    So I dynamically create 3 UIButtons (for now), with this loop: NSMutableArray *sites = [[NSMutableArray alloc] init]; NSString *one = @"Constution Center"; NSString *two = @"Franklin Court"; NSString *three = @"Presidents House"; [sites addObject: one]; [one release]; [sites addObject: two]; [two release]; [sites addObject: three]; [three release]; NSString *element; int j = 0; for (element in sites) { UIButton *button = [UIButton buttonWithType:UIButtonTypeCustom]; //setframe (where on screen) //separation is 15px past the width (45-30) button.frame = CGRectMake(a, b + (j*45), c, d); [button setTitle:element forState:UIControlStateNormal]; button.backgroundColor = [SiteOneController myColor1]; [button addTarget:self action:@selector(showCCView:) forControlEvents:UIControlEventTouchUpInside]; [button setTag:j]; [self.view addSubview: button]; j++; } The @Selector method is here: - (void) showCCView:(id) sender { UIButton *button = (UIButton *)sender; int whichButton = button.tag; NSString* myNewString = [NSString stringWithFormat:@"%d", whichButton]; self.view = [[UIView alloc] initWithFrame:[[UIScreen mainScreen] applicationFrame]]; self.view.backgroundColor = [UIColor whiteColor]; UINavigationBar *cc = [SiteOneController myNavBar1:@"Constitution Center Content"]; UINavigationBar *fc = [SiteOneController myNavBar1:@"Franklin Court Content"]; UINavigationBar *ph = [SiteOneController myNavBar1:@"Presidents House Content"]; if (whichButton = 0) { NSLog(myNewString); [self.view addSubview:cc]; } else if (whichButton = 1) { NSLog(myNewString); [self.view addSubview:fc]; } else if (whichButton = 2) { NSLog(myNewString); [self.view addSubview:ph]; } } Now, it is printing the correct button tag to NSLog, as shown in the method, however EVERY SINGLE BUTTON is displaying a navigation bar with "Franklin Court" as the title, EVERY SINGLE ONE, even though when I click button 0, it says "Button 0 clicked" in the console, but still performs the else if (whichButton = 1) code. Am I missing something here?

    Read the article

  • Cell contents changing for rows present outside the height of tableview(to see this cells, we shud s

    - by wolverine
    I have set the size of the tableView that I show as the popoverController as 4*rowheight. And I am using 12cells in the tableView. Each cell contains an image and a label. I can see all the cells by scrolling. Upto 5th cell its ok. After th2 5th cell, the label and the image that I am using in the first four cells are being repeated for the remaining cells. And If I select the cell, the result is accurately shown. But when I again take the tableView, the image and labels are not accurate even for the first 5 cells. All are changed but the selection is giving the correct result. Can anyone help me?? - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [self tableviewCellWithReuseIdentifier:CellIdentifier rowNumber:indexPath.row]; } //tableView.backgroundColor = [UIColor clearColor]; return cell; } - (UITableViewCell *)tableviewCellWithReuseIdentifier:(NSString *)identifier rowNumber:(NSInteger)row { CGRect rect; rect = CGRectMake(0.0, 0.0, 360.0, ROW_HEIGHT); UITableViewCell *cell = [[[UITableViewCell alloc] initWithFrame:rect reuseIdentifier:identifier] autorelease]; UIImageView *myImageView = [[UIImageView alloc] initWithFrame:CGRectMake(10.00, 10.00, 150.00, 100.00)]; myImageView.tag = IMAGE_TAG; [cell.contentView addSubview:myImageView]; [myImageView release]; UILabel *label = [[UILabel alloc] initWithFrame:CGRectMake(170.00, -10.00, 170.00, 80.00)]; label.tag = LABEL_TAG; [label setBackgroundColor:[UIColor clearColor]]; [label setTextColor:[UIColor blackColor]]; [label setFont:[UIFont fontWithName:@"AmericanTypewriter" size:22]]; [label setTextAlignment:UITextAlignmentLeft]; [cell.contentView addSubview:label]; [label release]; if (row == 0) { UIImageView *imageView = (UIImageView *)[cell viewWithTag:IMAGE_TAG]; imageView.image = [UIImage imageNamed:[NSString stringWithFormat:@"cover_v.jpg"]]; UILabel *mylabel = (UILabel *)[cell viewWithTag:LABEL_TAG]; mylabel.text = [NSString stringWithFormat:@"COVER PAGE"]; } }

    Read the article

  • ASP.NET MVC 4/Web API Single Page App for Mobile Devices ... Needs Authentication

    - by lmttag
    We have developed an ASP.NET MVC 4/Web API single page, mobile website (also using jQuery Mobile) that is intended to be accessed only from mobile devices (e.g., iPads, iPhones, Android tables and phones, etc.), not desktop browsers. This mobile website will be hosted internally, like an intranet site. However, since we’re accessing it from mobile devices, we can’t use Windows authentication. We still need to know which user (and their role) is logging in to the mobile website app. We tried simply using ASP.NET’s forms authentication and membership provider, but couldn’t get it working exactly the way we wanted. What we need is for the user to be prompted for a user name and password only on the first time they access the site on their mobile device. After they enter a correct user name and password and have been authenticated once, each subsequent time they access the site they should just go right in. They shouldn’t have to re-enter their credentials (i.e., something needs to be saved locally to each device to identify the user after the first time). This is where we had troubles. Everything worked as expected the first time. That is, the user was prompted to enter a user name and password, and, after doing that, was authenticated and allowed into the site. The problem is every time after the browser was closed on the mobile device, the device and user were not know and the user had to re-enter user name and password. We tried lots of things too. We tried setting persistent cookies in JavaScript. No good. The cookies weren’t there to be read the second time. We tried manually setting persistent cookies from ASP.NET. No good. We, of course, used FormsAuthentication.SetAuthCookie(model.UserName, true); as part of the form authentication framework. No good. We tried using HTML5 local storage. No good. No matter what we tried, if the user was on a mobile device, they would have to log in every single time. (Note: we’ve tried on an iPad and iPhone running both iOS 5.1 and 6.0, with Safari configure to allow cookies, and we’ve tried on Android 2.3.4.) Is there some trick to getting a scenario like this working? Or, do we have to write some sort of custom authentication mechanism? If so, how? And, what? Or, should we use something like claims-based authentication and WIF? Or??? Any help is appreciated. Thanks!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 651 652 653 654 655 656 657 658 659 660 661 662  | Next Page >