Search Results

Search found 11438 results on 458 pages for 'self imposed homework'.

Page 66/458 | < Previous Page | 62 63 64 65 66 67 68 69 70 71 72 73  | Next Page >

  • Comparing lists in Standard ML

    - by user1050640
    I am extremely new to SML and we just got out first programming assignment for class and I need a little insight. The question is: write an ML function, called minus: int list * int list -> int list, that takes two non-decreasing integer lists and produces a non-decreasing integer list obtained by removing the elements from the first input list which are also found in the second input list. For example, minus( [1,1,1,2,2], [1,1,2,3] ) = [1,2] minus( [1,1,2,3],[1,1,1,2,2] ) = [3] Here is my attempt at answering the question. Can anyone tell me what I am doing incorrectly? I don't quite understand parsing lists. fun minus(xs,nil) = [] | minus(nil,ys) = [] | minus(x::xs,y::ys) = if x=y then minus(xs,ys) else x :: minus(x,ys); Here is a fix I just did, I think this is right now? fun minus(L1,nil) = L1 | minus(nil,L2) = [] | minus(L1,L2) = if hd(L1) > hd(L2) then minus(L1,tl(L2)) else if hd(L1) = hd(L2) then minus(tl(L1),tl(L2)) else hd(L1) :: minus(tl(L1), L2);

    Read the article

  • SQL to display an event on start date, end date and any days in between.

    - by Tim
    Hello, This should be fairly simple, but I can't get my head around it. I have an event in my database with a startDate and an endDate. I need to display this event (based on the current date) on every day the event occurs. So if the event starts on the 3rd of May and finishes on the 7th of May, the SQL query must find it on every single day. How can I achieve this? SELECT * FROM events WHERE startDate ??? Thanks, Tim

    Read the article

  • match strings in python

    - by mesun
    Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

    Read the article

  • Pointers to class fields

    - by newbie_cpp
    My task is as follows : Using pointers to class fields, create menu allowing selection of ice, that Person can buy in Ice shop. Buyer will be charged with waffel and ice costs. Selection of ice and charging buyers account must be shown in program. Here's my Person class : #include <iostream> using namespace std; class Iceshop { const double waffel_price = 1; public: } class Person { static int NUMBER; char* name; int age; const int number; double plus, minus; public: class Account { int number; double resources; public: Account(int number, double resources) : number(number), resources(resources) {} } Person(const char* n, int age) : name(strcpy(new char[strlen(n)+1],n)), number(++NUMBER), plus(0), minus(0), age(age) {} Person::~Person(){ cout << "Destroying resources" << endl; delete [] name; } friend void show(Person &p); int* take_age(){ return &age; } char* take_name(){ return name; } void init(char* n, int a) { name = n; age = a; } Person& remittance(double d) { plus += d; return *this; } Person& paycheck(double d) { minus += d; return *this; } Account* getAccount(); }; int Person:: Person::Account* Person::getAccount() { return new Account(number, plus - minus); } void Person::Account::remittance(double d){ resources = resources + d; } void Person::Account::paycheck(double d){ resources = resources - d; } void show(Person *p){ cout << "Name: " << p->take_name() << "," << "age: " << p->take_age() << endl; } int main(void) { Person *p = new Person; p->init("Mary", 25); show(p); p->remittance(100); system("PAUSE"); return 0; } How to start this task ? Where and in what form should I store menu options ?

    Read the article

  • Finding if a path between 2 sides of a game board exists

    - by Meny
    Hi, i'm currently working on a game as an assignment for school in java. the game cuurently is designed for Console. the game is for 2 players, one attacking from north to south, and the other from west to east. the purpose of the game is to build a "bridge"/"path" between the 2 of your sides before your opponent does. for example: A B C D E F 1 _ _ X _ _ _ 1 2 O X X _ _ _ 2 3 O X O O O O 3 4 O X O _ _ _ 4 5 X X _ _ _ _ 5 6 X O _ _ _ _ 6 A B C D E F player that attacks from north to south won (path/bridge from C to A) my problem is, what algorithm would be good to check if the user have managed to create a path (will be checked at the end of each turn). you're help would be very appreciated.

    Read the article

  • Simplest way of creating java next/previous buttons

    - by Holly
    I know that when creating buttons, like next and previous, that the code can be somewhat long to get those buttons to function. My professor gave us this example to create the next button: private void jbtnNext_Click() { JOptionPane.showMessageDialog(null, "Next" ,"Button Pressed", JOptionPane.INFORMATION_MESSAGE); try { if (rset.next()) { fillTextFields(false); }else{ //Display result in a dialog box JOptionPane.showMessageDialog(null, "Not found"); } } catch (SQLException ex) { ex.printStackTrace(); } } Though, I do not really understand how that short and simple if statement is what makes the next button function. I see that the fillTextFields(false) uses a boolean value and that you need to initialize that boolean value in the beginning of the code I believe. I had put private fillTextFields boolean = false; but this does not seem to be right... I'm just hoping someone could explain it better. Thanks :)

    Read the article

  • Adding string items to a list of type Person C#

    - by user1862808
    Im makeing a simple registration application and I have an assignment to learn more about lists. I have an assignment that says that i am to create a class called Persons and in that class set the values from the text fields in variables and add this to a list of type Person. So far: in the Person class: string strSocialSecurityNumber = string.Empty;//---( This will not be used now.) string strFirstName = string.Empty; string strLastName = string.Empty; string strFullName = string.Empty; string strAge = string.Empty; string strAll = string.Empty; int intAge = 0; List<Person> lstPerson = new List<Person>(); public void SetValues(string FirstName, string LastName, int Age) { strFirstName = FirstName; strLastName = LastName; strFullName = strFirstName + " " + strLastName; intAge = Age; strAge = Convert.ToString(intAge); strAll = strAge + " " + strFullName; } public List<Person> Person() { lstPerson.Add(strAll); return lstPerson; } Error message: "can not convert from string to Person" The assignment says that the list is to be of the type Person so i am suppose to add strings to it and ive looked how to do this but I dont know how. I have seen that there are options like "ConvertAll" But im not sure if I am allowed to use it since the list should be of type Person. Thank you!

    Read the article

  • Implement dictionary using java

    - by ahmad
    Task Dictionary ADT The dictionary ADT models a searchable collection of key-element entries Multiple items with the same key are allowed Applications: word-definition pairs Dictionary ADT methods: find(k): if the dictionary has an entry with key k, returns it, else, returns null findAll(k): returns an iterator of all entries with key k insert(k, o): inserts and returns the entry (k, o) remove(e): remove the entry e from the dictionary size(), isEmpty() Operation Output Dictionary insert(5,A) (5,A) (5,A) insert(7,B) (7,B) (5,A),(7,B) insert(2,C) (2,C) (5,A),(7,B),(2,C) insert(8,D) (8,D) (5,A),(7,B),(2,C),(8,D) insert(2,E) (2,E) (5,A),(7,B),(2,C),(8,D),(2,E) find(7) (7,B) (5,A),(7,B),(2,C),(8,D),(2,E) find(4) null (5,A),(7,B),(2,C),(8,D),(2,E) find(2) (2,C) (5,A),(7,B),(2,C),(8,D),(2,E) findAll(2) (2,C),(2,E) (5,A),(7,B),(2,C),(8,D),(2,E) size() 5 (5,A),(7,B),(2,C),(8,D),(2,E) remove(find(5)) (5,A) (7,B),(2,C),(8,D),(2,E) find(5) null (7,B),(2,C),(8,D),(2,E) Detailed explanation: NO Specific requirements: please Get it done i need HELP !!!

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • How do you search a document for a string in c++?

    - by Jeff
    Here's my code so far: #include<iostream> #include<string> #include<fstream> using namespace std; int main() { int count = 0; string fileName; string keyWord; string word; cout << "Please make sure the document is in the same file as the program, thank you!" << endl << "Please input document name: " ; getline(cin, fileName); cout << endl; cout << "Please input the word you'd like to search for: " << endl; cin >> keyWord; cout << endl; ifstream infile(fileName.c_str()); while(infile.is_open()) { getline(cin,word); if(word == keyWord) { cout << word << endl; count++; } if(infile.eof()) { infile.close(); } } cout << count; } I'm not sure how to go to the next word, currently this infinite loops...any recommendation? Also...how do I tell it to print out the line that that word was on? Thanks in advance!

    Read the article

  • C++ Greatest Number Verification

    - by Daniel
    Hey guys, I was assigned to create a program that creates n arrays composed by 10 random integers. The the program should sum all the integers and display the result. After, it has to verify which of the sums is the greatest and it has to display that array and the result. Im having troubles getting it done and would like to get some help! Thanks once again. Here is my code so far: #include <iostream> #include <iomanip> #include <cmath> using namespace std; double random(unsigned int &seed); unsigned int seed = 5; void generateData(int set[10]); int sumData(int set[10]); void checkData(int sumResult, int arrayNumber); int main (int argc, char * const argv[]) { int arrayNumber, sumResult; int set[10]; do { cout << "Number of Arrays to Compare: " << endl; cin >> arrayNumber; } while (arrayNumber < 0); for (int i = 0; i < arrayNumber; ++i) { generateData(set); sumResult = sumData(set); cout << "Sum --> " << sumResult << endl; checkData(sumResult, arrayNumber); } return 0; } double random(unsigned int &seed) { const int MODULUS = 15749; const int MULTIPLIER = 69069; const int INCREMENT = 1; seed = ((MULTIPLIER * seed) + INCREMENT) % MODULUS; return double(seed) / double(MODULUS); } void generateData(int set[10]) { for (int i = 0; i < 10; ++i) { set[i] = int (5 + 6 * random(seed)); cout << set[i] << " || "; } } int sumData(int set[10]) { int sumTotal = 0; for (int i = 0; i < 10; ++i) sumTotal = sumTotal + set[i]; return sumTotal; } void checkData(int sumResult, int arrayNumber) { int largerNumber; int tempSet[2]; for (int i = 0; i < arrayNumber; ++i) { if (sumResult > largerNumber) { tempSet[i] = sumResult; } } }

    Read the article

  • Optimally reducing maximum flow

    - by ArIck
    Given a parameter k, I'm trying to delete k edges from a directed graph such that the maximum flow is reduced by as much as possible. The graph has a source s and a sink t, and the capacity of each edge is one. The graph may or may not contain cycles. My proposed solution would be to first perform a topological sorting on the graph, using an algorithm that "forgives" cycles -- perhaps by ignoring edges that lead us back to the source. Then (assuming k = 1): i = 0 for each vertex u order by topological(u) for each edge (u, v) order by topological(v) descending if topological(v) > topological(u) then delete (u, v) if ++i = k then return else // edge doesn't contribute to max flow, ignore Would this work, or am I totally off-track here?

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • Losing data after reading them correct from file

    - by user1388172
    i have the fallowing class of object with a class a data structure which i use in main combined. The ADT(abstract data type) is a linked list. After i read from file the input data and create and object which at print looks just fine after a print. after i push_back() the 3-rd int variable get initializated to 0. So example and code: Example: ex.in: 1 7 31 2 2 2 3 3 3 now i create objects from each line, which at print look as they suppose, but after push_back(): 1 7 0 2 2 0 3 3 0 Class.h: class RAngle { private: int x,y,l,b; public: int solution,prec; RAngle(){ x = y = solution = prec = b = l =0; } RAngle(int i,int j,int k){ x = i; y = j; l = k; solution = 0; prec=0; b=0; } friend ostream& operator << (ostream& out, const RAngle& ra){ out << ra.x << " " << ra.y << " " << ra.l <<endl; return out; } friend istream& operator >>( istream& is, RAngle& ra){ is >> ra.x; is >> ra.y; is >> ra.l; return is ; } }; ADT.h: template <class T> class List { private: struct Elem { T data; Elem* next; }; Elem* first; T pop_front(){ if (first!=NULL) { T aux = first->data; first = first->next; return aux; } T a; return a; } void push_back(T data){ Elem *n = new Elem; n->data = data; n->next = NULL; if (first == NULL) { first = n; return ; } Elem *current; for(current=first;current->next != NULL;current=current->next); current->next = n; } Main.cpp(after i call this function in main which prints object as they suppose to be the x var(from RAngle class) changes to 0 in all cases.) void readData(List <RAngle> &l){ RAngle r; ifstream f_in; f_in.open("ex.in",ios::in); for(int i=0;i<10;++i){ f_in >> r; cout << r; l.push_back(r); }

    Read the article

  • Encountering NullPointerException when trying to add polynoms

    - by Ayler Cruz
    I need to add two polynomials, which is composed of two ints. For example, the coefficient and the exponent 3x^2 would be constructed using 3 and 2 as parameters. I am getting a NullPointerException but I can't figure out why. Any help would be appreciated! public class Polynomial { private Node poly; public Polynomial() { } private Polynomial(Node p) { poly = p; } private class Term { int coefficient; int exponent; private Term(int coefficient, int exponent) { this.coefficient = coefficient; this.exponent = exponent; } } private class Node { private Term data; private Node next; private Node(Term data, Node next) { this.data = data; this.next = next; } } public void addTerm(int coeff, int exp) { Node pointer = poly; if (pointer.next == null) { poly.next = new Node(new Term(coeff, exp), null); } else { while (pointer.next != null) { if (pointer.next.data.exponent < exp) { Node temp = new Node(new Term(coeff, exp), pointer.next.next); pointer.next = temp; return; } pointer = pointer.next; } pointer.next = new Node(new Term(coeff, exp), null); } } public Polynomial polyAdd(Polynomial p) { return new Polynomial(polyAdd(this.poly, p.poly)); } private Node polyAdd(Node p1, Node p2) { if (p1 == p2) { Term adding = new Term(p1.data.coefficient + p2.data.coefficient, p1.data.exponent); p1 = p1.next; p2 = p2.next; return new Node(adding, null); } if (p1.data.exponent > p2.data.exponent) { p2 = p2.next; } if (p1.data.exponent < p2.data.exponent) { p1 = p1.next; } if (p1.next != null && p2.next != null) { return polyAdd(p1, p2); } return new Node(null, null); } }

    Read the article

  • Challenging question find if there is an element repeating himself n/k times

    - by gleb-pendler
    here how it's goes: You have an array size n and a constant k (whatever) you can assume the the array of int type tho it kind be of whatever type but just for the clearane let assume it's an integer. Describe an algorithm that finds if there is an element/s that repeat itself at least n/k times... if there is return one - do it in linear time running O(n) Imortent: now the catch do this algorithm or even pseuo-code using a constant usage of memory and running over the array only TWICE!!!

    Read the article

  • Sorting a list of items using javascript

    - by Nicholas
    Hi all, I am working on a class assignment in which i need to accomplish the following: 1 User types a list of items into a text box (form field) 2 When the user presses the sort button, the list in the text box is sorted 3 It takes the text from the text box and puts the sorted text back in the text box Please help!

    Read the article

  • BFS algorithm problem

    - by Gorkamorka
    The problem is as follows: A wanderer begins on the grid coordinates (x,y) and wants to reach the coordinates (0,0). From every gridpoint, the wanderer can go 8 steps north OR 3 steps south OR 5 steps east OR 6 steps west (8N/3S/5E/6W). How can I find the shortest route from (X,Y) to (0,0) using breadth-first search? Clarifications: Unlimited grid Negative coordinates are allowed A queue (linked list or array) must be used No obstacles present

    Read the article

  • How to access the relative directory of a ASP.NET website?

    - by Michael Schilling
    I need to access a folder that will contain various text files for my web site. I'm using Visual Web Developer 2010 Express. I made a web site using visual basic. Here is the failing code: Dim fileName As String fileName = CurDir.ToString + fileName.Text + ".txt" FileOpen(1, fileName, OpenMode.Output) FileClose(1) CurDir.ToString is giving me strange directory path that isn't anywhere near where my website files are located. I need to be able to access the files in a folder inside of the WebSite1 folder without using C:\Users\..., but I'm at a loss on how to do that. Can anyone help me out?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Help with method logic in Java, hw

    - by Crystal
    I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

    Read the article

< Previous Page | 62 63 64 65 66 67 68 69 70 71 72 73  | Next Page >