Search Results

Search found 11438 results on 458 pages for 'self imposed homework'.

Page 69/458 | < Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >

  • How to create initializeDB() method for java database

    - by Holly
    I am working on a Java project for class and have not worked much with incorporating databases into Java. I can't find much on the initializeDB() method, but if I could get some help I would really appreciate it. Below is the code being used for the intializeDB() method: private void initializeDB() { try { // Load the JDBC driver System.out.println("Driver loaded"); // Establish a connection System.out.println("Database connected"); // Create a statement // Create a SQL Query string // Execute the query to create a recordset } catch (Exception ex) { ex.printStackTrace(); } }

    Read the article

  • Constructors taking references in C++

    - by sasquatch
    I'm trying to create constructor taking reference to an object. After creating object using reference I need to prints field values of both objects. Then I must delete first object, and once again show values of fields of both objects. My class Person looks like this : class Person { char* name; int age; public: Person(){ int size=0; cout << "Give length of char*" << endl; cin >> size; name = new char[size]; age = 0; } ~Person(){ cout << "Destroying resources" << endl; delete[] name; delete age; } void init(char* n, int a) { name = n; age = a; } }; Here's my implementation (with the use of function show() ). My professor said that if this task is written correctly it will return an error. #include <iostream> using namespace std; class Person { char* name; int age; public: Person(){ int size=0; cout << "Give length of char*" << endl; cin >> size; name = new char[size]; age = 0; } Person(const Person& p){ name = p.name; age = p.age; } ~Person(){ cout << "Destroying resources" << endl; delete[] name; delete age; } void init(char* n, int a) { name = n; age = a; } void show(char* n, int a){ cout << "Name: " << name << "," << "age: " << age << "," << endl; } }; int main(void) { Person *p = new Person; p->init("Mary", 25); p->show(); Person &p = pRef; pRef->name = "Tom"; pRef->age = 18; Person *p2 = new Person(pRef); p->show(); p2->show(); system("PAUSE"); return 0; }

    Read the article

  • Adding the sum of numbers using a loop statement

    - by Deonna
    I need serious help dividing the positive numbers and the negative numbers. I am to accumulate the total of the negative values and separately accumulate the total of the positive values. After the loop, you are then to display the sum of the negative values and the sum of the positive values. The data is suppose to look like this: -2.3 -1.9 -1.5 -1.1 -0.7 -0.3 0.1 0.5 0.9 1.3 1.7 2.1 2.5 2.9 Sum of negative values: -7.8 Sum of positive values: 12 So far I have this: int main () { int num, num2, num3, num4, num5, sum, count, sum1; int tempVariable = 0; int numCount = 100; int newlineCount = 0, newlineCount1 = 0; float numCount1 = -2.3; while (numCount <= 150) { cout << numCount << " "; numCount += 2; newlineCount ++; if(newlineCount == 6) { cout<< " " << endl; newlineCount = 0; } } **cout << "" << endl; while (numCount1 <=2.9 ) { cout << numCount1 << " "; numCount1 += 0.4; newlineCount1 ++; } while ( newlineCount1 <= 0 && newlineCount >= -2.3 ); cout << "The sum is " << newlineCount1 << endl;** return 0; }

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Linked Lists in Java - Help with assignment

    - by doron2010
    I have been trying to solve this assignment all day, please help me. I'm completely lost. Representation of a string in linked lists In every intersection in the list there will be 3 fields : The letter itself. The number of times it appears consecutively. A pointer to the next intersection in the list. The following class CharNode represents a intersection in the list : public class CharNode { private char _data; private int _value; private charNode _next; public CharNode (char c, int val, charNode n) { _data = c; _value = val; _next = n; } public charNode getNext() { return _next; } public void setNext (charNode node) { _next = node; } public int getValue() { return _value; } public void setValue (int v) { value = v; } public char getData() { return _data; } public void setData (char c) { _data = c; } } The class StringList represents the whole list : public class StringList { private charNode _head; public StringList() { _head = null; } public StringList (CharNode node) { _head = node; } } Add methods to the class StringList according to the details : (Pay attention, these are methods from the class String and we want to fulfill them by the representation of a string by a list as explained above) public char charAt (int i) - returns the char in the place i in the string. Assume that the value of i is in the right range. public StringList concat (String str) - returns a string that consists of the string that it is operated on and in its end the string "str" is concatenated. public int indexOf (int ch) - returns the index in the string it is operated on of the first appeareance of the char "ch". If the char "ch" doesn't appear in the string, returns -1. If the value of fromIndex isn't in the range, returns -1. public int indexOf (int ch, int fromIndex) - returns the index in the string it is operated on of the first appeareance of the char "ch", as the search begins in the index "fromIndex". If the char "ch" doesn't appear in the string, returns -1. public boolean equals (String str) - returns true if the string that it is operated on is equal to the string str. Otherwise returns false. This method must be written in recursion, without using loops at all. public int compareTo (String str) - compares between the string that the method is operated on to the string "str" that is in the parameter. The method returns 0 if the strings are equal. If the string in the object is smaller lexicographic from the string "str" in the paramater, a negative number will be returned. And if the string in the object is bigger lexicographic from the string "str", a positive number will be returned. public StringList substring (int i) - returns the list of the substring that starts in the place i in the string on which it operates. Meaning, the sub-string from the place i until the end of the string. Assume the value of i is in the right range. public StringList substring (int i, int j) - returns the list of the substring that begins in the place i and ends in the place j (not included) in the string it operates on. Assume the values of i, j are in the right range. public int length() - will return the length of the string on which it operates. Pay attention to all the possible error cases. Write what is the time complexity and space complexity of every method that you wrote. Make sure the methods you wrote are effective. It is NOT allowed to use ready classes of Java. It is NOT allowed to move to string and use string operations.

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • VB.net Network Graph code/algorithm

    - by Jens
    For a school project we need to visualise a computer network graph. The number of computers with specific properties are read from an XML file, and then a graph should be created. Ad random computers are added and removed. Is there any open source project or algorithm that could help us visualising this in VB.net? Or would you suggest us to switch to java. Update: We eventually switched java and used the Jung libraries because this was easier for us to understand and implement.

    Read the article

  • from loop to Nested loops ?

    - by WM
    I have this program that returns a factorial of N. For example, when entering 4,,, it will give 1! , 2! , 3! How could I convert this to use nested loops? public class OneForLoop { public static void main(String[] args) { Scanner input = new Scanner(System.in); System.out.print("Enter a number : "); int N = input.nextInt(); int factorial = 1; for(int i = 1; i < N; i++) { factorial *= i; System.out.println(i + "! = " + factorial); } } }

    Read the article

  • Passing an array of structs in C

    - by lelouch
    I'm having trouble passing an array of structs to a function in C. I've created the struct like this in main: int main() { struct Items { char code[10]; char description[30]; int stock; }; struct Items MyItems[10]; } I then access it like: MyItems[0].stock = 10; etc. I want to pass it to a function like so: ReadFile(MyItems); The function should read the array, and be able to edit it. Then I should be able to access the same array from other functions. I've tried heaps of declarations but none of them work. e.g. void ReadFile(struct Items[10]) I've had a look around for other questions, but the thing is they're all done different, with typedefs and asterisks. My teacher hasn't taught us pointers yet, so I'd like to do it with what I know. Any ideas? :S EDIT: Salvatore's answer is working after I fixed my prototype to: void ReadFile(struct Items[9]);

    Read the article

  • How to create a simple Proxy to access web servers in C

    - by jesusiniesta
    Hi. I’m trying to create an small Web Proxy in C. First, I’m trying to get a webpage, sending a GET frame to the server. I don’t know what I have missed, but I am not receiving any response. I would really appreciate if you can help me to find what is missing in this code. int main (int argc, char** argv) { int cache_size, //size of the cache in KiB port, port_google = 80, dir, mySocket, socket_google; char google[] = "www.google.es", ip[16]; struct sockaddr_in socketAddr; char buffer[10000000]; if (GetParameters(argc,argv,&cache_size,&port) != 0) return -1; GetIP (google, ip); printf("ip2 = %s\n",ip); dir = inet_addr (ip); printf("ip3 = %i\n",dir); /* Creation of a socket with Google */ socket_google = conectClient (port_google, dir, &socketAddr); if (socket_google < 0) return -1; else printf("Socket created\n"); sprintf(buffer,"GET /index.html HTTP/1.1\r\n\r\n"); if (write(socket_google, (void*)buffer, LONGITUD_MSJ+1) < 0 ) return 1; else printf("GET frame sent\n"); strcpy(buffer,"\n"); read(socket_google, buffer, sizeof(buffer)); // strcpy(message,buffer); printf("%s\n", buffer); return 0; } And this is the code I use to create the socket. I think this part is OK, but I copy it just in case. int conectClient (int puerto, int direccion, struct sockaddr_in *socketAddr) { int mySocket; char error[1000]; if ( (mySocket = socket(AF_INET, SOCK_STREAM, 0)) == -1) { printf("Error when creating the socket\n"); return -2; } socketAddr->sin_family = AF_INET; socketAddr->sin_addr.s_addr = direccion; socketAddr->sin_port = htons(puerto); if (connect (mySocket, (struct sockaddr *)socketAddr,sizeof (*socketAddr)) == -1) { snprintf(error, sizeof(error), "Error in %s:%d\n", __FILE__, __LINE__); perror(error); printf("%s\n",error); printf ("-- Error when stablishing a connection\n"); return -1; } return mySocket; } Thanks!

    Read the article

  • Returning multiple aggregate functions as rows

    - by SDLFunTimes
    I need some help formulating a select statement. I need to select the total quantity shipped for each part with a distinct color. So the result should be a row with the color name and the total. Here's my schema: create table s ( sno char(5) not null, sname char(20) not null, status smallint, city char(15), primary key (sno) ); create table p ( pno char(6) not null, pname char(20) not null, color char(6), weight smallint, city char(15), primary key (pno) ); create table sp ( sno char(5) not null, pno char(6) not null, qty integer not null, primary key (sno, pno) );

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • How do you determine using stat() whether a file is a symbolic link?

    - by hora
    I basically have to write a clone of the UNIX ls command for a class, and I've got almost everything working. One thing I can't seem to figure out how to do is check whether a file is a symbolic link or not. From the man page for stat(), I see that there is a mode_t value defined, S_IFLNK. This is how I'm trying to check whether a file is a sym-link, with no luck (note, stbuf is the buffer that stat() returned the inode data into): switch(stbuf.st_mode & S_IFMT){ case S_IFLNK: printf("this is a link\n"); break; case S_IFREG: printf("this is not a link\n"); break; } My code ALWAYS prints this is not a link even if it is, and I know for a fact that the said file is a symbolic link since the actual ls command says so, plus I created the sym-link... Can anyone spot what I may be doing wrong? Thanks for the help!

    Read the article

< Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >