Search Results

Search found 11438 results on 458 pages for 'self imposed homework'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 67/458 | < Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >

  • Problem with sending out variable to serial port using api JAVA

    - by sjaakensjon
    We are developing a java program for school. But we are experiencing problems with sending out a variable created by 3 sliders. The idea is that we have 3 sliders. One slider for every color. Red green and blue. The variable has to have a value between 0 and 255. Everytime the value of the slider changes is has to send a variable for the channel, that value is 1, 2 ,3. And after that it has to send the value of the slider through the serial port. Could you please help us out by creating an example program? Below is our code so far. Thanks in advance. Sjaak package main; import javax.swing.*; import javax.swing.event.*; import java.awt.*; import app.Com; import app.Parameters; public class menu{ JSlider sliderblauw; JLabel hoeveelblauw; JLabel blauw; JLabel rood; JSlider sliderrood; JLabel hoeveelrood; JLabel groen; JLabel hoeveelgroen; JSlider slidergroen; public menu(){ Frame venster = new JFrame("Color control"); JPanel blauwinstel = new JPanel(); ((JFrame) venster).setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); venster.setSize(500, 500); venster.setVisible(true); sliderblauw = new JSlider(JSlider.VERTICAL, 0, 255, 0); sliderblauw.addChangeListener(new veranderingblauw()); hoeveelblauw = new JLabel ("0"); blauwinstel.add(sliderblauw); blauwinstel.add(hoeveelblauw); venster.add(blauwinstel, BorderLayout.WEST); sliderblauw.setMajorTickSpacing(10); sliderblauw.setPaintTicks(true); JPanel roodinstel = new JPanel(); sliderrood = new JSlider(JSlider.VERTICAL, 0, 255, 0); sliderrood.addChangeListener(new veranderingrood()); hoeveelrood = new JLabel ("0"); roodinstel.add(sliderrood); roodinstel.add(hoeveelrood); venster.add(roodinstel, BorderLayout.EAST); sliderrood.setMajorTickSpacing(10); sliderrood.setPaintTicks(true); JPanel groeninstel = new JPanel(); slidergroen = new JSlider(JSlider.VERTICAL, 0, 255, 0); slidergroen.addChangeListener(new veranderinggroen()); hoeveelgroen = new JLabel ("0"); groeninstel.add(slidergroen); groeninstel.add(hoeveelgroen); venster.add(groeninstel, BorderLayout.CENTER); slidergroen.setMajorTickSpacing(10); slidergroen.setPaintTicks(true); } public class veranderingblauw implements ChangeListener{ public void stateChanged(ChangeEvent ce){ int value = sliderblauw.getValue(); String waarde_blauw = Integer.toString(value); hoeveelblauw.setText(waarde_blauw); }} public class veranderingrood implements ChangeListener{ public void stateChanged(ChangeEvent ce){ int value = sliderrood.getValue(); String waarde_rood = Integer.toString(value); hoeveelrood.setText(waarde_rood); }} public class veranderinggroen implements ChangeListener{ public void stateChanged(ChangeEvent ce){ int value = slidergroen.getValue(); String waarde_groen = Integer.toString(value); hoeveelgroen.setText(waarde_groen); }} public static void main( String[] args) { new menu(); } }

    Read the article

  • How to create and display a list in Java?

    - by lox
    i have to create a list of ,let's say 50 people, (in Java) and display the list, and i don't really know how to do that. so this is what i have tried to do so far . please correct and complete some of my code . public class Person { String name; String stuff; } public class CreatePerson { public static void ang() { ArrayList<Person> thing=new ArrayList<Person>(); Scanner diskScanner = new Scanner(in); for(int i=0; i<50; i++){ Person pers = new Person(); out.print("name: "); pers.name=diskScanner.nextLine(); out.print("stuff: "); pers.stuff=diskScanner.nextLine(); thing.add(pers); break; } // Display people for (int i=0; i<50; i++) { out.println(??);{ } } }}

    Read the article

  • help in security assignment

    - by scatman
    i have to write a program that sniffs network packets (part1-the simple part). and i have to update the program (part2) so that it will be able to terminate connections. the specific requirements are: construct raw packets by specifying data link layer and network layer information including appropriate source and destination MAC and IP addresses. These packets are intended to terminate the connection. To do so, you should used SOCK_RAW as the socket type to be able to set the header information by yourself. can anybody give me some ideas on the second part? should i hijack the session,apply a dos attack on one of the users?? all i need is some tips of how to terminate the connection. i am using c programming language. and this is a course assignment for the security course.

    Read the article

  • Find common nodes from two linked lists using recursion

    - by Dan
    I have to write a method that returns a linked list with all the nodes that are common to two linked lists using recursion, without loops. For example, first list is 2 - 5 - 7 - 10 second list is 2 - 4 - 8 - 10 the list that would be returned is 2 - 10 I am getting nowhere with this.. What I have been think of was to check each value of the first list with each value of the second list recursively but the second list would then be cut by one node everytime and I cannot compare the next value in the first list with the the second list. I hope this makes sense... Can anyone help?

    Read the article

  • Losing data after reading them correct from file

    - by user1388172
    i have the fallowing class of object with a class a data structure which i use in main combined. The ADT(abstract data type) is a linked list. After i read from file the input data and create and object which at print looks just fine after a print. after i push_back() the 3-rd int variable get initializated to 0. So example and code: Example: ex.in: 1 7 31 2 2 2 3 3 3 now i create objects from each line, which at print look as they suppose, but after push_back(): 1 7 0 2 2 0 3 3 0 Class.h: class RAngle { private: int x,y,l,b; public: int solution,prec; RAngle(){ x = y = solution = prec = b = l =0; } RAngle(int i,int j,int k){ x = i; y = j; l = k; solution = 0; prec=0; b=0; } friend ostream& operator << (ostream& out, const RAngle& ra){ out << ra.x << " " << ra.y << " " << ra.l <<endl; return out; } friend istream& operator >>( istream& is, RAngle& ra){ is >> ra.x; is >> ra.y; is >> ra.l; return is ; } }; ADT.h: template <class T> class List { private: struct Elem { T data; Elem* next; }; Elem* first; T pop_front(){ if (first!=NULL) { T aux = first->data; first = first->next; return aux; } T a; return a; } void push_back(T data){ Elem *n = new Elem; n->data = data; n->next = NULL; if (first == NULL) { first = n; return ; } Elem *current; for(current=first;current->next != NULL;current=current->next); current->next = n; } Main.cpp(after i call this function in main which prints object as they suppose to be the x var(from RAngle class) changes to 0 in all cases.) void readData(List <RAngle> &l){ RAngle r; ifstream f_in; f_in.open("ex.in",ios::in); for(int i=0;i<10;++i){ f_in >> r; cout << r; l.push_back(r); }

    Read the article

  • BFS algorithm problem

    - by Gorkamorka
    The problem is as follows: A wanderer begins on the grid coordinates (x,y) and wants to reach the coordinates (0,0). From every gridpoint, the wanderer can go 8 steps north OR 3 steps south OR 5 steps east OR 6 steps west (8N/3S/5E/6W). How can I find the shortest route from (X,Y) to (0,0) using breadth-first search? Clarifications: Unlimited grid Negative coordinates are allowed A queue (linked list or array) must be used No obstacles present

    Read the article

  • How to access the relative directory of a ASP.NET website?

    - by Michael Schilling
    I need to access a folder that will contain various text files for my web site. I'm using Visual Web Developer 2010 Express. I made a web site using visual basic. Here is the failing code: Dim fileName As String fileName = CurDir.ToString + fileName.Text + ".txt" FileOpen(1, fileName, OpenMode.Output) FileClose(1) CurDir.ToString is giving me strange directory path that isn't anywhere near where my website files are located. I need to be able to access the files in a folder inside of the WebSite1 folder without using C:\Users\..., but I'm at a loss on how to do that. Can anyone help me out?

    Read the article

  • How do I output the preorder traversal of a tree given the inorder and postorder tranversal?

    - by user342580
    Given the code for outputing the postorder traversal of a tree when I have the preorder and the inorder traversal in an interger array. How do I similarily get the preorder with the inorder and postorder array given? void postorder( int preorder[], int prestart, int inorder[], int inostart, int length) { if(length==0) return; //terminating condition int i; for(i=inostart; i<inostart+length; i++) if(preorder[prestart]==inorder[i])//break when found root in inorder array break; postorder(preorder, prestart+1, inorder, inostart, i-inostart); postorder(preorder, prestart+i-inostart+1, inorder, i+1, length-i+inostart-1); cout<<preorder[prestart]<<" "; } Here is the prototype for preorder() void preorder( int inorderorder[], int inostart, int postorder[], int poststart, int length)

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Using sigprocmask to implement locks

    - by EpsilonVector
    I'm implementing user threads in Linux kernel 2.4, and I'm using ualarm to invoke context switches between the threads. We have a requirement that our thread library's functions should be uninterruptable, so I looked into blocking signals and learned that using sigprocmask is the standard way to do this. However, it looks like I need to do quite a lot to implement this: sigset_t new_set, old_set; sigemptyset(&new_set); sigaddset(&new_set, SIGALRM); sigprocmask(SIG_BLOCK, &new_set, &old_set); This blocks SIGALARM but it does this with 3 function invocations! A lot can happen in the time it takes for these functions to run, including the signal being sent. The best idea I had to mitigate this was temporarily disabling ualarm, like this: sigset_t new_set, old_set; time=ualarm(0,0); sigemptyset(&new_set); sigaddset(&new_set, SIGALRM); sigprocmask(SIG_BLOCK, &new_set, &old_set); ualarm(time, 0); Which is fine except that this feels verbose. Isn't there a better way to do this?

    Read the article

  • Java - Removing duplicates in an ArrayList

    - by Will
    I'm working on a program that uses an ArrayList to store Strings. The program prompts the user with a menu and allows the user to choose an operation to perform. Such operations are adding Strings to the List, printing the entries etc. What I want to be able to do is create a method called removeDuplicates().This method will search the ArrayList and remove any duplicated values. I want to leave one instance of the duplicated value(s) within the list. I also want this method to return the total number of duplicates removed. I've been trying to use nested loops to accomplish this but I've been running into trouble because when entries get deleted, the indexing of the ArrayList gets altered and things don't work as they should. I know conceptually what I need to do but I'm having trouble implementing this idea in code. Here is some pseudo code: start with first entry; check each subsequent entry in the list and see if it matches the first entry; remove each subsequent entry in the list that matches the first entry; after all entries have been examined, move on to the second entry; check each entry in the list and see if it matches the second entry; remove each entry in the list that matches the second entry; repeat for entry in the list Here's the code I have so far: public int removeDuplicates() { int duplicates = 0; for ( int i = 0; i < strings.size(); i++ ) { for ( int j = 0; j < strings.size(); j++ ) { if ( i == j ) { // i & j refer to same entry so do nothing } else if ( strings.get( j ).equals( strings.get( i ) ) ) { strings.remove( j ); duplicates++; } } } return duplicates; }

    Read the article

  • How to solve this problem with lists?

    - by osabri
    what i don't understand in my task here what kind of list i can use, and if it should have 2 attributes key and value ? or only value? with pointers to another node ofc the task: "design a function which create a list using input from the keyboard _ the prefered solution. Assume that some magic stops the input; so the length of a list is not known in advance.(alternative solution: a function which creates explicitly a fixed list. However, all other function can not assume any knowledge about the length of lists). Necessary utilities( additional functions to be created): a function which deallocates the memory used for lists and a function which prints the content of the list. let the element of lists contain a letter. Design a function which create a copy of such list. can't also understand the list line !!!!!???

    Read the article

  • o write a C++ program to encrypt and decrypt certain codes.

    - by Amber
    Step 1: Write a function int GetText(char[],int); which fills a character array from a requested file. That is, the function should prompt the user to input the filename, and then read up to the number of characters given as the second argument, terminating when the number has been reached or when the end of file is encountered. The file should then be closed. The number of characters placed in the array is then returned as the value of the function. Every character in the file should be transferred to the array. Whitespace should not be removed. When testing, assume that no more than 5000 characters will be read. The function should be placed in a file called coding.cpp while the main will be in ass5.cpp. To enable the prototypes to be accessible, the file coding.h contains the prototypes for all the functions that are to be written in coding.cpp for this assignment. (You may write other functions. If they are called from any of the functions in coding.h, they must appear in coding.cpp where their prototypes should also appear. Do not alter coding.h. Any other functions written for this assignment should be placed, along with their prototypes, with the main function.) Step 2: Write a function int SimplifyText(char[],int); which simplifies the text in the first argument, an array containing the number of characters as given in the second argument, by converting all alphabetic characters to lower case, removing all non-alpha characters, and replacing multiple whitespace by one blank. Any leading whitespace at the beginning of the array should be removed completely. The resulting number of characters should be returned as the value of the function. Note that another array cannot appear in the function (as the file does not contain one). For example, if the array contained the 29 characters "The 39 Steps" by John Buchan (with the " appearing in the array), the simplified text would be the steps by john buchan of length 24. The array should not contain a null character at the end. Step 3: Using the file test.txt, test your program so far. You will need to write a function void PrintText(const char[],int,int); that prints out the contents of the array, whose length is the second argument, breaking the lines to exactly the number of characters in the third argument. Be warned that, if the array contains newlines (as it would when read from a file), lines will be broken earlier than the specified length. Step 4: Write a function void Caesar(const char[],int,char[],int); which takes the first argument array, with length given by the second argument and codes it into the third argument array, using the shift given in the fourth argument. The shift must be performed cyclicly and must also be able to handle negative shifts. Shifts exceeding 26 can be reduced by modulo arithmetic. (Is C++'s modulo operations on negative numbers a problem here?) Demonstrate that the test file, as simplified, can be coded and decoded using a given shift by listing the original input text, the simplified text (indicating the new length), the coded text and finally the decoded text. Step 5: The permutation cypher does not limit the character substitution to just a shift. In fact, each of the 26 characters is coded to one of the others in an arbitrary way. So, for example, a might become f, b become q, c become d, but a letter never remains the same. How the letters are rearranged can be specified using a seed to the random number generator. The code can then be decoded, if the decoder has the same random number generator and knows the seed. Write the function void Permute(const char[],int,char[],unsigned long); with the same first three arguments as Caesar above, with the fourth argument being the seed. The function will have to make up a permutation table as follows: To find what a is coded as, generate a random number from 1 to 25. Add that to a to get the coded letter. Mark that letter as used. For b, generate 1 to 24, then step that many letters after b, ignoring the used letter if encountered. For c, generate 1 to 23, ignoring a or b's codes if encountered. Wrap around at z. Here's an example, for only the 6 letters a, b, c, d, e, f. For the letter a, generate, from 1-5, a 2. Then a - c. c is marked as used. For the letter b, generate, from 1-4, a 3. So count 3 from b, skipping c (since it is marked as used) yielding the coding of b - f. Mark f as used. For c, generate, from 1-3, a 3. So count 3 from c, skipping f, giving a. Note the wrap at the last letter back to the first. And so on, yielding a - c b - f c - a d - b (it got a 2) e - d f - e Thus, for a given seed, a translation table is required. To decode a piece of text, we need the table generated to be re-arranged so that the right hand column is in order. In fact you can just store the table in the reverse way (e.g., if a gets encoded to c, put a opposite c is the table). Write a function called void DePermute(const char[],int,char[], unsigned long); to reverse the permutation cypher. Again, test your functions using the test file. At this point, any main program used to test these functions will not be required as part of the assignment. The remainder of the assignment uses some of these functions, and needs its own main function. When submitted, all the above functions will be tested by the marker's own main function. Step 6: If the seed number is unknown, decoding is difficult. Write a main program which: (i) reads in a piece of text using GetText; (ii) simplifies the text using SimplifyText; (iii) prints the text using PrintText; (iv) requests two letters to swap. If we think 'a' in the text should be 'q' we would type aq as input. The text would be modified by swapping the a's and q's, and the text reprinted. Repeat this last step until the user considers the text is decoded, when the input of the same letter twice (requesting a letter to be swapped with itself) terminates the program. Step 7: If we have a large enough sample of coded text, we can use knowledge of English to aid in finding the permutation. The first clue is in the frequency of occurrence of each letter. Write a function void LetterFreq(const char[],int,freq[]); which takes the piece of text given as the first two arguments (same as above) and returns in the 26 long array of structs (the third argument), the table of the frequency of the 26 letters. This frequency table should be in decreasing order of popularity. A simple Selection Sort will suffice. (This will be described in lectures.) When printed, this summary would look something like v x r s z j p t n c l h u o i b w d g e a q y k f m 168106 68 66 59 54 48 45 44 35 26 24 22 20 20 20 17 13 12 12 4 4 1 0 0 0 The formatting will require the use of input/output manipulators. See the header file for the definition of the struct called freq. Modify the program so that, before each swap is requested, the current frequency of the letters is printed. This does not require further calls to LetterFreq, however. You may use the traditional order of regular letter frequencies (E T A I O N S H R D L U) as a guide when deciding what characters to exchange. Step 8: The decoding process can be made more difficult if blank is also coded. That is, consider the alphabet to be 27 letters. Rewrite LetterFreq and your main program to handle blank as another character to code. In the above frequency order, space usually comes first.

    Read the article

  • How to convert between different currencies?

    - by sil3nt
    Hey there, this is part of a question i got in class, im at the final stretch but this has become a major problem. In it im given a certain value which is called the "gold value" and it is 40.5, this value changes in input. and i have these constants const int RUBIES_PER_DIAMOND = 5; // relative values. * const int EMERALDS_PER_RUBY = 2; const int GOLDS_PER_EMERALDS = 5; const int SILVERS_PER_GOLD = 4; const int COPPERS_PER_SILVER = 5; const int DIAMOND_VALUE = 50; // gold values. * const int RUBY_VALUE = 10; const int EMERALD_VALUE = 5; const float SILVER_VALUE = 0.25; const float COPPER_VALUE = 0.05; which means that basically for every diamond there are 5 rubies, and for every ruby there are 2 emeralds. So on and so forth. and the "gold value" for every diamond for example is 50 (diamond value = 50) this is how much one diamond is worth in golds. my problem is converting 40.5 into these diamonds and ruby values. I know the answer is 4rubies and 2silvers but how do i write the algorithm for this so that it gives the best estimate for every goldvalue that comes along?? please help!, im at my wits end

    Read the article

  • [java] Returning the element number of the longest string in an array

    - by JohnRoberts
    Hoookay, so. I'm trying to get the longestS method to take the user-inputted array of strings, then return the element number of the longest string in that array. I got it to the point where I was able to return the number of chars in the longest string, but I don't believe that will work for what I need. My problem is that I keep getting incompatible type errors when trying to figure this out. I don't understand the whole data type thing with strings yet. It's confusing me how I go about return a number of the array yet the array is of strings. The main method is fine, I got stuck on the ???? part. { public static void main(String [] args) { Scanner inp = new Scanner( System.in ); String [] responseArr= new String[4]; for (int i=0; i<4; i++) { System.out.println("Enter string "+(i+1)); responseArr[i] = inp.nextLine(); } int highest=longestS(responseArr); } public static int longestS(String[] values) { int largest=0 for( int i = 1; i < values.length; i++ ) { if ( ????? ) } return largest; } }

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • Challenging question find if there is an element repeating himself n/k times

    - by gleb-pendler
    here how it's goes: You have an array size n and a constant k (whatever) you can assume the the array of int type tho it kind be of whatever type but just for the clearane let assume it's an integer. Describe an algorithm that finds if there is an element/s that repeat itself at least n/k times... if there is return one - do it in linear time running O(n) Imortent: now the catch do this algorithm or even pseuo-code using a constant usage of memory and running over the array only TWICE!!!

    Read the article

  • c++ exercise question

    - by Djecua
    in need of help on a C++ program that will help a deli owner help her customers.Prompt the user for the number of bagels.if then calculate the customers payment two ways. first it finds the price of the smallest multiple of 13 bagels that is closet to the customer's order. it then calculates the price of the customer's order so that the customer's payment is the smallest amount possible with the customer getting the exact number of bagels ordered. if the first method is the smallest amount the program outputs the number of bagels the customer will receive along with the dollar amount owed and the dollar amount saved. otherwise just print the number of bagels received the dollar amount owed $ 3.80 for a dozen bagels (13 bagels) half a dozen(6 bagels) sing bagel cost $.50 owner of the deli is a honest merchant, customers always get the best price on an order, even if they get more bagels than ordered, for example a customer that orders 10 bagels would pay $ 4.60 (2.60 for a half dozen bagels plus $2.00 for 4 single bagels.merchant gives her customer 13 bagels saving the customer $0.80 If someone can example to me how would i design to give customer extra bagels and how to calculate cost.

    Read the article

  • consts and other animals

    - by bks
    Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >